HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Beesley, A. H. Articles by White, S. J. Search for Related Content PubMed PubMed Citation Articles by Beesley, A. H. Articles by White, S. J.

Rapid Report

Regulation of distal nephron K⁺ channels (ROMK) mRNA expression by aldosterone in rat kidney

A. H. Beesley, D. Hornby * and S. J. White

Received 2 March 1998; accepted after revision 5 May 1998.

	ABSTRACT

Top Abstract Introduction Methods Results Discussion References

1. The expression of ROMK mRNA isoforms in rat kidney was measured using competitive polymerase chain reaction. Under basal conditions the expression of ROMK2 and 3 mRNA was significantly higher than that of ROMK1 or 6.

2. Administration of aldosterone for a period of 1 week significantly increased the mRNA expression not only of the 1-subunit of the Na⁺-K⁺-ATPase, but also of ROMK2, 3 and 6.

3. These data not only provide evidence that ROMK K⁺ channels may be involved with mineralocorticoid-sensitive K⁺ secretion in the distal nephron, but also demonstrate for the first time that ROMK6 may be involved in this process.

	INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

The distal nephron has long been recognized as a site of renal K⁺ secretion (Field & Giebisch, 1989). Patch clamp studies in rat and rabbit have demonstrated the involvement of a low conductance (20-30 pS), inwardly rectifying K⁺ channel which is both pH- and ATP-sensitive and which displays voltage-independent open probability (Bleich et al. 1990; Wang et al. 1990). Recently an inwardly rectifying K⁺ channel has been cloned from rat kidney (rat outer medullary K⁺ channel - ROMK1), which has the biophysical characteristics of the distal tubule K⁺ channel (Ho et al. 1993); previous inconsistencies in the conductance properties reported for the native K⁺ channel and those of ROMK expressed in vitro have now been resolved (Palmer et al. 1997). The mRNA for ROMK in the rat has been localized by in situ hybridization to regions of the distal nephron including the thick ascending limb of Henle's loop (Lee & Hebert, 1995). This correlates well with studies that have demonstrated not only that ROMK protein localizes to these same areas, but also that it is targeted to the apical poles of cells in these tissues (Li et al. 1995; Xu et al. 1997). The evidence to date thus indicates that ROMK K⁺ channels may be involved with K⁺ secretion in the distal nephron. As yet, however, there have been few studies that have addressed the question of whether ROMK gene expression is regulated by factors that are known to affect renal K⁺ secretion. In addition, although there has been much work on the rat ROMK isoforms 1-3, there has been little study of the latest member of this gene family to be described, ROMK6 (Kondo et al. 1996). Although expressed in the kidney, its distribution, and thus its involvement in renal K⁺ handling, is entirely unknown.

The action of aldosterone on Na⁺ and K⁺ handling by the kidney has been studied extensively. Whilst net K⁺ excretion is largely unaffected by a rise in the level of circulating aldosterone, micropuncture studies have clearly demonstrated that there is an increase in K⁺ secretion in the distal nephron which is masked by a reduction in urinary flow rate resulting from enhanced Na⁺ reabsorption (Field et al. 1984). To maintain the driving force for these two events (increased Na⁺ absorption and K⁺ secretion), aldosterone also stimulates Na⁺-K⁺-ATPase activity (Verrey & Beron, 1996). This appears to involve an increase in the expression of the 1-subunit of the basolateral pump (Welling et al. 1993) which is selectively localized to the distal nephron (Farman et al. 1991).

The purpose of the present study was to extend our understanding of the involvement of ROMK K⁺ channels in renal K⁺ secretion by studying the effect of chronic aldosterone administration on ROMK mRNA expression in rat kidney using competitive polymerase chain reaction (PCR). The expression of the 1-subunit of the Na⁺-K⁺-ATPase was also determined as a positive control for the effects of aldosterone on kidney gene expression.

	METHODS

Top Abstract Introduction Methods Results Discussion References

Preparation of animals

Alzet osmotic mini-pumps were loaded with either d-aldosterone (delivery, 20 µg kg^-1 day^-1) or vehicle (polyethylene glycol 200) and implanted subcutaneously in male Wistar rats (180-200 g) under 2-5 % halothane anaesthesia. Animals were allowed to recover under direct observation, and were subsequently examined on a twice daily basis to check post-operative health and condition. These animals were allowed free access to water and standard rat pellet diet (Argo Feeds, Sheffield, UK). After 1 week, animals were anaesthetized with sodium pentobarbitone (Sagatal, 60 mg kg^-1 I.P.; RMB Animal Health Ltd, Dagenham, UK) and a 2 ml blood sample was taken by cardiac puncture for radioimmunoassay analysis of aldosterone concentration. Both kidneys were removed, decapsulated and snap frozen in liquid nitrogen, and the animals killed with a lethal overdose of anaesthetic (Sagatal).

Overview of competitive PCR

In standard PCR a single DNA target is amplified selectively with the use of oligonucleotide primers which are specific to that gene sequence. In competitive PCR the amount of starting DNA template in the reaction is quantified by co-amplification with an internal standard (IS) DNA molecule. In this case the IS molecule is identical to the target DNA except for an internal deletion; thus the molecules compete for amplification with the same primers but generate products of a different size which can be resolved on an agarose gel. PCR reactions are performed with different amounts of IS and the relative yield of each product is compared to find the concentration at which they are equal.

Reverse transcription-PCR (RT-PCR)

Total RNAs were extracted from whole kidneys using TRIzol Reagent (Gibco BRL), then treated with DNaseI (Promega) to remove genomic DNA. Reverse transcription reactions (20 µl volume) contained: 2 µg total rat RNA, 2·5 µM oligo-(dT) primer, 200 µM mixed dNTPs, 50 mM Tris-HCl (pH 8·3), 75 mM KCl, 3 mM MgCl₂, 10 mM DTT and 300 U M-MLV reverse transcriptase (Promega). Samples were heated to 90°C for 2 min to denature RNA secondary structures, left on ice for 10 min to allow primer annealing, heated at 35°C for 1 h to reverse transcribe the RNA, and finally heated to 95°C to end the reaction. PCR was performed with primers selective for rat ROMK isoforms (1, 2, 3 and 6), the 1-subunit of the Na⁺-K⁺-ATPase, or the housekeeping gene -actin. PCR reactions (25 µl volume) contained: 50 mM KCl, 10 mM Tris-HCl (pH 9·0), 0·1 % Triton X-100, 200 µM mixed dNTPs, 3 mM MgCl₂, 2·5 U Taq DNA polymerase (Promega), 200 nM of each primer (see Table 1), 0·002-400 fM IS DNA, and 1 µl of the above reverse transcription reaction product. Samples were heated to 94°C for 5 min then subjected to 30-35 cycles of denaturation (94°C, 1 min), annealing (55-60°C, 1 min) and extension (72°C, 1·5 min). For the 1-subunit of the Na⁺-K⁺-ATPase, extension times were increased to 2·5 min per cycle. A final extension phase (72°C, 5-10 min) was included for all samples. PCR products were separated on a 3 % agarose gel and visualized by ethidium bromide staining under ultraviolet light (302 nm).

Quantification of target molecules

Photographs of gels were scanned into Molecular Analyst software (Bio-Rad) and the intensity of the bands quantified. Fluorescence data were divided by the molecular weight of each band to correct for differences in the incorporation of ethidium bromide. Resolvable heteroduplexes were quantified and then apportioned equally between target and competitor bands in the same lane. At the point where target and IS products are in equivalence (i.e. ratio of fluorescence = 1), the amount of target cDNA present in the reverse transcription sample is equal to the starting amount of IS. This is then proportional to the amount of mRNA in the original tissue sample.

Generation of internal standard DNA

IS molecules were generated by RT-PCR as above, but with different primer combinations adapted from the method of Van Den Heuvel et al. (1993). PCR reactions were performed using the normal 5' primer in conjunction with the corresponding IS (3') primer for each gene (Table 1). The IS (3') primers are composite oligonucleotides consisting of an initial sequence identical to the normal antisense primer (underlined in Table 1), coupled to a novel sequence that binds 60-200 bp further along the target gene. Following PCR amplification a cDNA is generated which contains both normal 5' and 3' primer ends for standard PCR, but has a 60-200 bp deletion.

Table 1. PCR primer sequences

Gene	Primer	Sequence (5' to 3')
ROMK1	5'	CAATGCAAGTAAATGTCATT
ROMK2	5'	TTTACCCCAGCAATCCATGA
ROMK3	5'	GGCAGTACAGACAATGGTGT
ROMK6	5'	GAAGTCATCGTGCATCAGCTTG
ROMK1-6	3'	CAGAAAGGCTGAAGTCATGC
ROMK1-6	IS (3')	CAGAAAGGCTGAAGTCATGCCATACGCTACGACATACCAC
-actin	5'	CATGTACGTAGCCATCCAG
-actin	3'	AAACGCAGCTCAGTAACAG
-actin	IS (3')	AAACGCAGCTCAGTAACAGGATAGAGCCACCAATCCAC
1-subunit	5'	GCAGCTGTATCAGAACATGG
1-subunit	3'	AGGTGCTTAGGCTCCGATGC
1-subunit	IS (3')	AGGTGCTTAGGCTCCGATGCGTTACAGAGACCAGCAATTC

Statistical analysis

Data are expressed as means ± S.E.M. (for n samples). Levels of mRNA are presented as arbitrary units (a.u.) unless otherwise stated. Statistical comparison of groups was performed with Student's t test or Mann-Whitney rank sum test as appropriate, or one-way ANOVA for multiple comparisons. The strength of association between data was assessed with Pearson's product moment correlation coefficient.

	RESULTS

Top Abstract Introduction Methods Results Discussion References

Expression of ROMK, -actin and Na⁺-K⁺-ATPase 1-subunit mRNA in normal kidney

As might be expected for a widely expressed housekeeping gene, the level of -actin mRNA was relatively high (166 ± 48 amol cDNA (µg total RNA)^-1 (n = 7); Fig. 1A). In contrast the expression of ROMK isoforms and the 1-subunit was several orders of magnitude lower (0·04-1·23 amol cDNA (µg total RNA)^-1; Fig. 1B), suggesting that message levels for these genes under normal conditions are relatively low, and consistent with the fact that (with the exception of ROMK6) they have all previously been localized to limited regions of the nephron.

To reduce the variability between sample groups caused by differences in RNA extraction efficiency, we wished to normalize data on the basis of the expression of the housekeeping gene -actin. To confirm the validity of this approach we correlated the level of expression of each of the ROMK isoforms and of the 1-subunit against the level of -actin mRNA in each sample. As shown in Fig. 1C, there was a significant correlation between -actin expression and the level of mRNA for each of the five genes studied (P < 0·05 for all). Subsequently, all data for ROMK and 1 mRNA were normalized for the level of -actin mRNA in each sample and presented as arbitrary units.

		View larger version [in this window] [in a new window]
Figure 1. Relative expression of -actin, ROMK and the 1-subunit of the Na+-K+-ATPase in rat kidney Relative levels of mRNA expression for -actin (A), and ROMK1-6 and the 1-subunit of the Na+-K+-ATPase (B) in control rat kidney. (Values for n are given in parentheses.) C, the relationship between the mRNA expression of -actin and that of ROMK1-6 and the 1-subunit (* P < 0·05).

Relative levels of ROMK isoforms in rat kidney

A comparison of the basal expression of the ROMK isoforms showed that mRNAs for ROMK2 and 3 (Fig. 2) were present at significantly higher levels (6·7 ± 1·0 (n = 7) and 7·8 ± 0·8 (n = 7), respectively) than mRNAs for ROMK1 and 6 (2·2 ± 0·4 (n = 7) and 1·4 ± 0·3 (n = 7), respectively; P < 0·05), an observation that is consistent with the wider distribution of ROMK2 and 3 that has been reported along the distal nephron (Boim et al. 1995). The distribution of ROMK6 mRNA within the kidney is as yet unknown, but the present data show that it is expressed at levels not significantly different to ROMK1 (Fig. 2; P > 0·05).

		View larger version [in this window] [in a new window]
Figure 2. Comparison of ROMK isoform expression in rat kidney Normalized levels of ROMK1, 2, 3 and 6 mRNA expression in the control rat kidney (in arbitrary units, a.u.). P < 0·05 vs. ROMK2; * P < 0·05 vs. ROMK3.

Effect of chronic aldosterone administration

The basal level of plasma aldosterone in control animals was 20·9 ± 1·7 ng dl^-1 (n = 7). In contrast, animals in the high aldosterone group had a mean plasma aldosterone level which was nearly double this value (P < 0·001; Fig. 3A). The level of -actin mRNA expression was not significantly affected by chronic aldosterone administration (Fig. 3B), but there was a 246 % increase in the level of 1 mRNA in the high aldosterone group (Fig. 3C;P < 0·05), consistent with previous reports of the effect of aldosterone on this Na⁺-K⁺-ATPase subunit. There were also increases in the expression of ROMK2 (138 %), ROMK3 (80 %) and ROMK6 (117 %) compared with control levels (Fig. 3C;P 0·05 for each). However, despite a mean rise in ROMK1 expression following aldosterone treatment (61 %), these two groups were not significantly different. The pattern of mRNA expression between ROMK isoforms observed under basal conditions (Fig. 2) was maintained following aldosterone treatment (P < 0·05 for ROMK2 vs. 1 and 6, and for ROMK3 vs. 1 and 6).

		View larger version [in this window] [in a new window]
Figure 3. Effects of aldosterone on rat kidney mRNA expression A, plasma aldosterone levels in control and treated rats; * P < 0·001. B, effect of aldosterone treatment on -actin mRNA expression. C, effect of aldosterone on the mRNA expression of ROMK1-6 and the 1-subunit of the Na+-K+-ATPase; * P <= 0·05.

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

The level of mRNA expression of ROMK isoforms described in this paper under control conditions correlates well with data from previous studies of the distribution of ROMK isoforms along the length of the kidney tubule (Boim et al. 1995). Using single-tubule RT-PCR, mRNA for ROMK2 has been localized to the medullary and cortical thick ascending limb, distal convoluted tubule, connecting tubule and cortical collecting duct. The pattern of distribution for ROMK3 mRNA is the same (with the exception of the cortical collecting duct), whereas ROMK1 mRNA appears to be confined mainly to the cortical collecting duct and outer medullary collecting duct. Our observation that ROMK1 mRNA expression is about one-third of the value for ROMK2 and 3 correlates well with these findings. Interestingly, although the distribution for the newly cloned ROMK6 (Kondo et al. 1996) has not yet been described, the present data suggest that, like ROMK1, the expression of ROMK6 may be confined to more limited regions of the nephron.

As predicted from previous studies of the regulation of the 1-subunit (Farman et al. 1992; Welling et al. 1993; Tsuchiya et al. 1996), rats chronically treated with aldosterone demonstrate an increased expression of this mRNA. Similarly, aldosterone treatment also increased the expression of ROMK2, 3 and 6 in these animals. The fact that ROMK1 expression was not significantly increased following aldosterone treatment may be a reflection of variability in the data, since the mean value demonstrated a similar percentage increase to that of other isoforms, and because the background pattern of expression between isoforms remained unchanged after aldosterone treatment (Fig. 3C).

These observations lend further weight to the hypothesis that members of the ROMK family of K⁺ channels are involved in mineralocorticoid-sensitive K⁺ secretion in the kidney. The fact that ROMK6 mRNA is increased in response to aldosterone treatment suggests that this new family member may also be involved with the processes of renal K⁺ secretion.

	REFERENCES

Top Abstract Introduction Methods Results Discussion References

Bleich, M., Schlatter, E. & Greger, R. (1990). The luminal K⁺ channel of the thick ascending limb of Henle's loop. Pflügers Archiv 415, 449-460.

[Medline] Boim, M. A., Ho, K., Shuck, M. E., Bienowski, M. J., Block, J. H., Slightom, J. L., Yang, Y., Brenner, B. M. & Hebert, S. C. (1995). ROMK inwardly rectifying ATP-sensitive K⁺ channel. II. Cloning and distribution of alternative forms. American Journal of Physiology 268, F1132-1140.

[Medline] Farman, N., Corthesytheulaz, I., Bonvalet, J. P. & Rossier, B. C. (1991). Localization of alpha-isoforms of Na⁺/K⁺-ATPase in rat-kidney by in situ hybridization. American Journal of Physiology 260, C468-474.

[Medline] Farman, N., Coutry, N., Logvinenko, N., Blotchabaud, M., Bourbouze, R. & Bonvalet, J. P. (1992). Adrenalectomy reduces -1 and not -1 Na⁺/K⁺-ATPase mRNA expression in rat distal nephron. American Journal of Physiology 263, C810-817.

[Medline] Field, M. J. & Giebisch, G. (1989). Mechanisms of segmental potassium reabsorption and secretion. In The Regulation of Potassium Balance, ed. Seldin, D. W. & Giebisch, G., pp. 139-155. Raven Press, New York.

Field, M. J., Stanton, B. A. & Giebisch, G. H. (1984). Differential acute effects of aldosterone, dexamethasone, and hyperkalaemia on distal tubular potassium secretion in the rat kidney. Journal of Clinical Investigation 74, 1792-1802.

[Medline] Ho, K., Nichols, C. G., Lederer, W. J., Lytton, J., Vassilev, P. M., Kanazirska, M. V. & Hebert, S. C. (1993). Cloning and expression of an inwardly rectifying ATP-regulated potassium channel. Nature 362, 31-37.

[Medline] Kondo, C., Isomoto, S., Matsumoto, S., Yamada, M., Horio, Y., Yamashita, S., Takemura-Kameda, K., Matsuzawa, Y. & Kurachi, Y. (1996). Cloning and functional expression of a novel isoform of ROMK inwardly rectifying ATP-dependent K⁺ channel, ROMK6 (Kir1.1f). FEBS Letters 399, 122-126.

[Medline] Lee, W.-S. & Hebert, S. C. (1995). ROMK inwardly rectifying ATP-sensitive K⁺ channel. I. Expression in rat distal nephron segments. American Journal of Physiology 268, F1124-1131.

[Medline] Li, Q., Cope, G., Hornby, D. & White, S. J. (1995). Immunocytochemical location of the potassium channel ROMK1 in rat kidney cortex. The Journal of Physiology 489.P, 93P.

Palmer, L. G., Choe, H. & Frindt, G. (1997). Is the secretory K channel in the rat CCT ROMK? American Journal of Physiology 42, F404-410.

Tsuchiya, K., Giebisch, G. & Welling, P. A. (1996). Aldosterone-dependent regulation of Na⁺-K⁺-ATPase subunit mRNA in the rat CCD: competitive PCR analysis. American Journal of Physiology 271, F7-15.

[Medline] Van Den Heuvel, J. P., Tyson, F. L. & Bell, D. A. (1993). Construction of recombinant RNA templates for use as internal standards in quantitative RT-PCR. Biotechniques 14, 395-398.

[Medline] Verrey, F. & Beron, J. (1996). Activation and supply of channels and pumps by aldosterone. News in Physiological Sciences 11, 126-123.

Wang, W., White, S., Giebel, J. & Giebisch, G. (1990). A potassium channel in the apical membrane of rabbit thick ascending limb of Henle's loop. American Journal of Physiology 258, F244-253.

[Medline] Welling, P. A., Caplan, M., Sutters, M. & Giebisch, G. (1993). Aldosterone-mediated Na⁺/K⁺-ATPase expression is 1 isoform-specific in the renal cortical collecting duct. Journal of Biological Chemistry 268, 23469-23476.

[Abstract] Xu, J. Z., Hall, A. E., Peterson, L. N., Bienkowski, M. J., Eessalu, T. E. & Hebert, S. C. (1997). Localization of the ROMK protein on apical membranes of rat kidney nephron segments. American Journal of Physiology 42, F739-748.

Acknowledgements

This work was supported by the National Kidney Research Fund. The authors thank Dr N. Payne (University College London) for performing aldosterone assays and Mr A. J. Parker for his technical support.

Corresponding author

S. J. White: Laboratory for Membrane Protein Function, Department of Biomedical Science, University of Sheffield, Western Bank, Sheffield S10 2TN, UK.

Email: S.J.White{at}Sheffield.ac.uk

This article has been cited by other articles:

				G. Remuzzi, D. Cattaneo, and N. Perico The Aggravating Mechanisms of Aldosterone on Kidney Fibrosis J. Am. Soc. Nephrol., August 1, 2008; 19(8): 1459 - 1462. [Abstract] [Full Text] [PDF]

				A. M. Ring, Q. Leng, J. Rinehart, F. H. Wilson, K. T. Kahle, S. C. Hebert, and R. P. Lifton An SGK1 site in WNK4 regulates Na+ channel and K+ channel activity and has implications for aldosterone signaling and K+ homeostasis PNAS, March 6, 2007; 104(10): 4025 - 4029. [Abstract] [Full Text] [PDF]

				M. P. Ponda and T. H. Hostetter Aldosterone Antagonism in Chronic Kidney Disease Clin. J. Am. Soc. Nephrol., July 1, 2006; 1(4): 668 - 677. [Full Text] [PDF]

				S. C. Hebert, G. Desir, G. Giebisch, and W. Wang Molecular Diversity and Regulation of Renal Potassium Channels Physiol Rev, January 1, 2005; 85(1): 319 - 371. [Abstract] [Full Text] [PDF]

				E. Feraille and A. Doucet Sodium-Potassium-Adenosinetriphosphatase-Dependent Sodium Transport in the Kidney: Hormonal Control Physiol Rev, January 1, 2001; 81(1): 345 - 418. [Abstract] [Full Text] [PDF]

				L. G. Palmer Potassium secretion and the regulation of distal nephron K channels Am J Physiol Renal Physiol, December 1, 1999; 277(6): F821 - F825. [Abstract] [Full Text] [PDF]

				L. G. Palmer and G. Frindt Regulation of apical K channels in rat cortical collecting tubule during changes in dietary K intake Am J Physiol Renal Physiol, November 1, 1999; 277(5): F805 - F812. [Abstract] [Full Text] [PDF]

				F. Verrey Early aldosterone action: toward filling the gap between transcription and transport Am J Physiol Renal Physiol, September 1, 1999; 277(3): F319 - F327. [Abstract] [Full Text] [PDF]

				A. H. Beesley, B. Ortega, and S. J. White Splicing of a retained intron within ROMK K+ channel RNA generates a novel set of isoforms in rat kidney Am J Physiol Cell Physiol, March 1, 1999; 276(3): C585 - C592. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Beesley, A. H. Articles by White, S. J. Search for Related Content PubMed PubMed Citation Articles by Beesley, A. H. Articles by White, S. J.