J Physiol Volume 511, Number 1, 15-24, August 15, 1998
The Journal of Physiology (1998), 511.1, pp. 15-24
© Copyright 1998 The Physiological Society
The dependence of Ag+ block of a potassium channel, murine Kir2.1, on a cysteine residue in the selectivity filter
C. Dart, M. L. Leyland, R. Barrett-Jolley, P. A. Shelton, P. J. Spencer *, E. C. Conley ¹, M. J. Sutcliffe ² and P. R. Stanfield
Ion Channel Group, Departments of Cell Physiology and Pharmacology, * Biochemistry, ¹ Pathology, ² Chemistry and Centre for the Mechanisms of Human Toxicity, University of Leicester, PO Box 138, Leicester LE1 9HN, UK
Received 5 March 1998; accepted after revision 18 May 1998.
 |
ABSTRACT |
- Externally applied Ag+ (100-200 nM) irreversibly blocked the strong inwardly rectifying K+ channel, Kir2.1.
- Mutation to serine of a cysteine residue at position 149 in the pore-forming H5 region of Kir2.1 abolished Ag+ blockage.
- To determine how many of the binding sites must be occupied by Ag+ before the channel is blocked, we measured the rate of channel block and found that our results were best fitted assuming that only one Ag+ ion need bind to eliminate channel current.
- We tested our hypothesis further by constructing covalently linked dimers and tetramers of Kir2.1 in which cysteine had been replaced by serine in one (dimer) or three (tetramer) of the linked subunits. When expressed, these constructs yielded functional channels with either two (dimer) or one (tetramer) cysteines per channel at position 149.
- Blockage in the tetramer was complete after sufficient exposure to 200 nM Ag+, a result that is also consistent with only one Ag+ being required to bind to Cys149 to block fully. The rate of development of blockage was 16 times slower than in wild-type channels; the rate was 4 times slower in channels formed from dimers.
 |
INTRODUCTION |
The Kir2.0 subfamily of K+ channels is composed of strong inward rectifiers. These channels are found in many cell types (Kubo et al. 1993; Takahashi et al. 1994; Perier et al. 1994; Karschin et al. 1996), where they are important in setting cellular resting potential and excitability. The channels are active around the equilibrium potential for K+ (EK), but their open probability (Popen) falls under depolarization, owing to gating by intracellular Mg2+ (Matsuda et al. 1987; Stanfield et al. 1994) and polyamines (Fakler et al. 1994; Lopatin et al. 1994; Ficker et al. 1994).
Little direct evidence exists regarding the topology of Kir channels, and the current topological model of the Kir family is derived largely from hydropathy plots and analogy with the much-studied voltage-gated K+ channels. Each subunit of a Kir channel is believed to contain two membrane-spanning domains (M1 and M2) which flank a short loop of amino acids known as the H5 or P region (Ho et al. 1993; Kubo et al. 1993). The primary sequence of this region of the inward rectifier subunit is very similar to that of the pore-forming P region of voltage-gated and Ca2+-activated K+ channels, and includes the conserved T(S)xxTxGY(F)G motif believed to be an essential part of the K+ selectivity filter (Heginbotham et al. 1992; Sutcliffe & Stanfield, 1994). While a significant part of the selectivity of Kir channels lies outside the H5 region (Reuveny et al. 1996; Abrams et al. 1996), mutation of conserved residues within H5 disrupts the ability of Kir channels to discriminate between K+ and Na+. This result is consistent with the idea that H5 lines the Kir pore and forms its primary selectivity filter (Slesinger et al. 1996; Schwalbe et al. 1996; Yang et al. 1997).
Silver, like cadmium and zinc, blocks ion channels by binding to the thiolate group of exposed cysteine residues within the channel pore. This property of cysteine to form a high-affinity binding site for metal ions and other thiol-specific reagents has proved particularly useful over recent years in assessing the secondary structure of ion channels by determining which residues line the aqueous pore (Akabas et al. 1992; Stauffer & Karlin, 1994; Lü & Miller, 1995; Pascual et al. 1995; Sun et al. 1996).
Kir channels have several conserved cysteine residues within stretches of the protein that may form part of the pore. The proximity of one of the conserved cysteine residues in the Kir2.0 family to the selectivity filter motif suggested to us that this residue might line the ion conduction pathway. To investigate this possibility, we tested whole-cell wild-type Kir2.1 currents for block by Ag+. Our findings indicate that externally applied Ag+ is able to block Kir2.1 by binding irreversibly to the cysteine at position 149 in the H5 region.
As with voltage-gated K+ channels (MacKinnon, 1991; Liman et al. 1992), functional inward rectifier channels assemble as tetramers with four subunits surrounding a central pore (Yang et al. 1995). The tetrameric structure of Kir2.1 gives four potential binding sites for Ag+ per channel (one binding site carried by each subunit). To determine how many of the binding sites must be occupied by Ag+ before the channel is blocked, we measured the rate of channel blockage and have found that our results are best fitted assuming that the binding of only one Ag+ is sufficient to eliminate channel current.
We tested our hypothesis further by constructing tandem dimers and tetramers of Kir2.1 in which two or three cysteine residues, respectively, had been removed. Results from the dimers and tetramers also support the idea that C149 is situated close enough to the ion conduction pathway that the binding of only one Ag+ is sufficient to cause channel blockage.
 |
METHODS |
Cells
Chinese hamster ovary (CHO) cells were grown in minimal essential medium (Gibco), supplemented with 10 % (v/v) fetal calf serum. The coding sequence for Kir2.1 or sequences encoding a dimeric or tetrameric form of the channel were subcloned into the expression vector pCDNA3 as EcoRI/Xho I fragments and transfected into the cells using the LipoTAXITM cationic lipid transfection reagent (Stratagene) according to manufacturers' instructions. As a transfection marker, plasmid DNA containing the cDNA for Green Fluorescent Protein (Molecular Probes) was co-transfected with the Kir2.1 cDNAs.
Electrophysiology
Whole-cell currents were recorded from CHO cells typically 24-48 h post lipofection using an Axopatch 200A amplifier (Axon Instruments). Currents recorded in response to voltage steps were filtered at 5 kHz (-3 dB, 8-pole Bessel), digitized at 10 kHz using a DigiData 1200 interface (Axon Instruments), and analysed on a 486 computer using software written in AxoBasic (Axon Instruments) by Dr N. W. Davies.
Electrodes were pulled from borosilicate glass (o.d., 1·5 mm; Clark Electromedical, Pangbourne, UK) and fire polished to give a final resistance of 5 M
when filled. The pipette-filling solution contained (mM): KCl, 140; MgCl2, 1; EGTA, 10; Hepes, 10; pH 7·2. In some experiments, such as in the measurement of the time course of the Ag+ block of C149S wild-type tetramers, 3 mM Na2ATP (Sigma) was included in the pipette solution to reduce any possible effects of run-down. However, its inclusion did not affect the time course of the experiments. The external solution contained (mM): KNO3, 70; NaNO3, 70; Mg(NO3)2, 2; Ca(NO3)2, 2; Hepes, 10; pH 7·25. AgNO3 stock solution was stored in the dark and diluted into the experimental solution immediately prior to use. The Ag-AgCl electrode was connected to the bath by an agar bridge containing 300 mM NaNO3. The junction potential between pipette and external solutions was sufficiently small (< 1·5 mV, calculated using JPCalc; Barry, 1994) to be neglected.
As far as possible, analog means were used to correct capacity transients. Up to 90 % compensation was routinely used to correct for series resistance. All experiments were performed at room temperature (18-22°C), and the results are expressed as means ± S.E.M. All curve fitting was performed by Levenberg- Marquardt minimization of
2 (Microcal Origin).
Mutagenesis and construction of dimeric and tetrameric Kir2.1 molecules
We designed sequences encoding dimeric and tetrameric forms of Kir2.1 so that the subunit at the C-terminus could be altered independently of the other one (dimer) or three (tetramer) subunit(s) (Leyland et al. 1997; Dart et al. 1998). To achieve this design, we removed unique BsmBI and Afl II sites from the wild-type sequence of the one (dimer) or three (tetramer) subunits at the N-terminus, but retained these sites in the C-terminal subunit. We removed the stop codon from the sequence encoding the N-terminal subunit, the start codon from that specifying the C-terminal subunit, and both stop and start codons from the segments encoding the two central subunits of the tetramer (see Fig. 1). In both dimer and tetramer, subunits were linked by ten Gln residues. Site-directed mutagenesis was performed using the method of Kunkel (1985). The constructs used (N for N-terminal; C for C-terminal) were made as follows.
|
 |
View larger version
[in this window]
[in a new window] |
|
|
Figure 1. Structure of concatameric channels
A, tetramers are formed by linking four coding regions, leaving the native BsmBI and Afl II sites in the subunit at the 3' end of the coding region. The positions of the EcoRI and Xho I sites used to manipulate the construct are also shown as are the positions of the start (s) and stop ( ) codons. The start codon is preceded by a Kozak initiation sequence. Subunits are linked with 10 CAG triplets, each encoding a Gln residue. B, the structure of the dimer, with its restriction sites and start and stop codons.
|
Construct N. The unique Bgl II site in Kir2.1 was removed by silent mutagenesis (codon 408, GAT changed to GAC) and this construct was subcloned into pBluescript SK+ as a Not I/Xho I fragment. 'Adapter 1' (Table 1) was ligated into the Not I/BsmBI sites. This procedure introduced a unique BamHI site at codons 2-3 of Kir2.1 by silent mutagenesis (codon 2, GGC changes to GGA; codon 12, GTC changes to GTG). 'Adapter 2' was ligated into the Afl II/Xho I sites, a procedure that both destroyed the unique Afl II site by introducing the mutation R423K (ACG changed to AAG) and inserted a decameric CAG repeat (encoding for 10 Gln residues) immediately following codon 428. A Bgl II site was incorporated at the 3' end of the CAG repeat.
Table 1. Oligonucleotides used in the construction of concatameric Kir2.1 ion channels
| Adapter 1 |
| GGCCGCGAATTCCCGCCATGGGATCCGTGAGAACCAACCGCTACAGCATCGTGTCT |
| CGCTTAAGGGCGGTACCCTAGGCACTCTTGGTTGGCGATGTCGTAGCACAGAAGCC |
| Adapter 2 |
| TTAAAGCGAGAATCGGAGATACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAGATCTTGAC |
| TCGCTCTTAGCCTCTATGTCGTCGTCGTCGTCGTCGTCGTCGTCGTCTCTAGAACTGAGCT |
| Adapter 3 |
| GGCCGCGAATTCCCGCCATGGGATCCGTGAGAACCAACCGCTACAGCATCGTCTCT |
| CGCTTAAGGGCGGTACCCTAGGCACTCTTGGTTGGCGATGTCGTAGCAGAGAAGCC |
| Adapter 4 |
| TTAAGGCGAGAATCGGAGATATGAC |
| CCGCTCTTAGCCTCTATACTGAGCT |
Construct C. The Kir2.1 coding sequence was inserted into the Not I/Xho I sites of pBluescript SK+ and 'adapter 3' (Table 1) was ligated between the Not I/BsmBI sites. This adapter was identical to adapter 1, except that the unique BsmBI site of the wild-type was retained. 'Adapter 4' (Table 1) was ligated into Afl II/Xho I sites to retain the unique Afl II site and the Kir2.1 stop codon.
The coding sequence for a Kir2.1 dimer was constructed by ligating a BamHI/Xho I fragment of construct C into the Bgl II/Xho I site of construct N (BamHI and Bgl II produce compatible sticky ends). A Kir2.1 tetramer was assembled in two steps from constructs N and C. First, a BamHI/Xho I fragment of construct N was inserted into a Bgl II/Xho I-digested form of construct N. This procedure gave a dimeric construct, into whose Bgl II/Xho I sites a BamHI/Xho I fragment of the Kir2.1 dimer was inserted (see also Fig. 1).
 |
RESULTS |
Silver blocks whole-cell Kir2.1 currents
Membrane currents were recorded from single transfected CHO cells using the conventional whole-cell clamp technique and in response to voltage steps from a holding potential of -17 mV (the K+ equilibrium potential, EK) to test potentials ranging from -107 to +63 mV in 10 mV increments. The extracellular and intracellular K+ concentrations were 70 and 140 mM, respectively. In CHO cells transfected with the gene for Kir2.1, substantial inward currents were recorded at membrane potentials negative to EK, whilst much smaller outward currents were recorded at more positive voltages (Fig. 2A and B). Under these conditions, no significant whole-cell currents were detected in non-transfected CHO cells.
|
 |
View larger version
[in this window]
[in a new window] |
|
|
Figure 2. Silver blocks wild-type Kir2.1 currents
A, membrane currents recorded from a single CHO cell expressing the gene for Kir2.1 in response to voltage steps from a holding potential of -17 mV to test potentials ranging from +63 to -107 mV, in 10 mV increments and in the absence (left) and presence (right) of 100 nM externally applied Ag+. Extracellular [K+] was 70 mM, intracellular [K+] was 140 mM. Exposure time to Ag+ was 90 s. In 10 similar experiments, the current was reduced to 0·32 ± 0·07 of control levels after 90 s exposure to 100 nM Ag+. B, current- voltage relation of the cell shown in A in the absence ( ) and presence ( ) of 100 nM externally applied Ag+.
|
The addition of 100 nM Ag+ to the extracellular superfusion solution led to a rapid reduction in whole-cell current (Fig. 2A; 90 s exposure time). The inhibitory effect of Ag+ proved to be irreversible, even following prolonged washing in Ag+-free solutions. Whole-cell currents could be restored, however, by extracellular application of the reducing agent dithiothreitol ([DTT] = 1 mM; n = 6; not shown).
Whilst inward currents were clearly reduced, exposure to external Ag+ invariably resulted in a slight increase in outward current. Further investigation revealed this effect to be due to a current which was activated by Ag+ and which reversed at EK. This induced current is entirely independent of Kir2.1 currents and occurs in non-transfected CHO (n = 5; data not shown) and MEL (murine erythroleukaemia) cell lines exposed to similar external concentrations of Ag+.
We judged that the onset of Ag+ block was too slow to determine adequately the voltage sensitivity of block from the experiments outlined above. We therefore applied 100 nM extracellular Ag+ at different holding potentials (+30, -17 and -70 mV) for 90 s and then determined the fractional remaining current. The fractional current remaining after 90 s exposure to 100 nM external Ag+ was identical regardless of the holding potential. We therefore conclude that there is no significant voltage dependence of Ag+ block over the range tested, suggesting that Ag+ traverses not more than a small fraction of the transmembrane voltage field to reach its binding site. Thus, the block site is situated somewhere on the external face of the channel.
Blockage occurs at position 149 in the H5 region
Silver is known to react with the thiolate group of exposed cysteine residues. The amino acid sequence of the H5 region of Kir2.1 from residue 138 to 152 is given in Fig. 3A. The GYG (glycine-tyrosine-glycine) motif at positions 144-146, part of the 'K+ channel signature sequence', is believed to form a substantial part of the selectivity filter for K+ (Heginbotham et al. 1992), and is therefore presumed to be located at the narrowest part of the pore. We postulated that any cysteine residue(s) near to this stretch of amino acids may also be situated close enough to the ion conduction pathway for a bound Ag+ to occlude the pore. We therefore used site-directed mutagenesis to replace the naturally occurring cysteine at position 149 with serine (C149S), a residue very similar in size and shape to cysteine but which lacks the highly reactive sulfhydryl group. In making this simple substitution, we created Kir2.1 channels that are insensitive to block by externally applied Ag+ (Fig. 3B and C). The slight increase in both inward and outward whole-cell currents upon exposure to Ag+ is due to the Ag+-induced leak. In all respects other than Ag+ sensitivity, the C149S Kir2.1 channels behave essentially like wild-type channels.
|
 |
View larger version
[in this window]
[in a new window] |
|
|
Figure 3. Removal of cysteine at position 149 in the H5 region renders channels insensitive to Ag+
A, amino acid sequence of the H5 region of Kir2.1 from residue 138 to 152. Underlined is the Gly-Tyr-Gly (GYG) motif believed to form part of the selectivity filter for K+. The cysteine residue at position 149 is shown in bold. B, membrane currents recorded from a single CHO cell expressing the gene for a Kir2.1 channel in which the cysteine residue at position 149 has been mutated to serine (C149S). The recording conditions were identical to those in Fig. 2. Exposure time to 100 nM Ag+ was 90 s. In 6 similar experiments, externally applied Ag+ had no effect upon the whole-cell C149S currents. C, current-voltage relation for the cell shown in B in the absence ( ) and presence ( ) of Ag+.
|
A single Ag+ ion is sufficient to cause block
Inward rectifier K+ channels are believed to be tetrameric, composed of four subunits surrounding the central pore (Yang et al. 1995). Thus there will be a ring of four cysteine residues at position 149 (one carried on each of the four subunits) and, consequently, four potential binding sites per channel for Ag+.
Figure 4 shows the decay of whole-cell wild-type Kir2.1 currents with time in response to two different concentrations of externally applied Ag+ (
, 100 nM and
, 200 nM; different cells). Clearly, the higher concentration of external Ag+ caused a faster decay of whole-cell current.
This binding of Ag+ is to the ionized form of the sulfhydryl group (-S-) and the -log of the dissociation constant (pKa) of the group is about 8·6 (Jocelyn, 1972). Thus the binding reaction will follow the scheme:
The rate of Ag+ blockage will be determined by the transition rate constants k+, k- and k1, though if deprotonation and its reversal are very rapid compared with the binding of Ag+, the probability, p, of a Cys being occupied will be described by:
where t is time and k' is a pseudo first-order rate constant.
If it is assumed that all the Cys residues may bind Ag+ independently of each other, and that the probability of any Cys being occupied is p (as in eqn (1)), the probability of a channel with n binding sites having exactly r occupied will be given by the binomial distribution:
where q = (1 - p). Thus if block occurs when r or more sites are occupied, the fractional current, F, will be given by:
This decay of current after application of Ag+ is illustrated in Fig. 4B andC, where the mean time course for three cells in 100 nM Ag+ is shown (
). The continuous lines correspond to the decay of the fractional current if one, two, three or four Ag+ ions are required to block the channel. The experimental results are best fitted using the model where a single Ag+ binds to block.
|
 |
View larger version
[in this window]
[in a new window] |
|
|
Figure 4. Time course of Ag+ block of wild-type Kir2.1
A, fractional current for wild-type Kir2.1 plotted against time for 100 nM ( ) and 200 nM ( ) Ag+. The data are fitted with a single exponential (continuous line). Time constant (200 nM) = 30 s; (100 nM) = 69 s, mean values given in Table 2. B, mean fractional current for 3 cells exposed to 100 nM external Ag+ plotted against time. Data are fitted assuming only 1 Ag+ has to bind to the channel to block; other lines give the results where 2, 3 or 4 Ag+ ions are required for blockage (eqns (2) and (3)). C, same data as B, with fractional current (ordinate) plotted on a log scale.
|
Testing the model: dimers and tetramers
To test our model and to examine the effect on channel block of deleting two or more cysteine residues from a wild-type channel, we constructed tandem dimers and tetramers of Kir2.1. In the dimer, we mutated the cysteine at position 149 to serine in the coding region at the 5' end of the cDNA. We expected that when the two dimeric proteins were expressed they would come together to form functional channels, each of which would carry only two Ag+ binding sites at level 149. Similarly, for the tetramer, four Kir2.1 coding regions were linked together and the cysteine at position 149 mutated to serine in the three 5' coding regions. Expression of this construct would be expected to produce channels with only one Ag+ binding site at position 149.
Figure 5A shows whole-cell currents recorded from cells expressing wild-type monomers, C149S-wild-type dimers, and C149S-wild-type tetramers in response to voltage steps from a holding potential of -17 mV to +32 and -97 mV. The arrows and times indicate the length of exposure to 200 nM Ag+.
|
 |
View larger version
[in this window]
[in a new window] |
|
|
Figure 5. Ag+ blockage of monomers, dimers and tetramers
A, whole-cell currents from CHO cells expressing either wild-type Kir2.1 monomers (left), wild-type-C149S dimers (centre) or wild-type-C149S tetramers (right). Subunit formation is indicated in cartoons above the current records, wild-type subunits being indicated by shaded circles, C149S subunits by open circles. The membrane currents shown were recorded in response to voltage steps from a holding potential of -17 mV to test potentials of +32 and -97 mV in the presence and absence of 200 nM external Ag+. The times and arrows to the right of the current records indicate the length of exposure to external Ag+. B, fractional current for wild-type monomer ( ), wild-type-C149S dimer ( ) and wild-type-C149S tetramer ( ) plotted against time. The results are fitted with single exponentials (eqn (3), where k' changes with the number of Cys residues present). Note that given sufficient time, currents through channels formed from the tetrameric construct (which has only 1 cysteine residue at position 149) are completely inhibited by external Ag+. In the absence of extracellular Ag+, whole-cell currents reduced by less than 5 % over a 10 min period. C, same results as B, plotted with fractional current (ordinate) on a log scale.
|
Whereas 60 s exposure to 200 nM Ag+ was sufficient almost entirely to inhibit whole-cell current in cells expressing the wild-type monomers (left; each channel with four C149), the same level of exposure caused only modest reductions in cells expressing either C149S-wild-type dimers (centre; each channel with two C149) or C149S-wild-type tetramers (right; each channel with a single C149).
The full time course of Ag+ block for the monomers, dimers and tetramers is shown in Fig. 5B and C. An important feature is that, given sufficient time, the channels produced by the tetramer with only one cysteine residue at 149 (
) were blocked to zero current by external Ag+. This supports the idea that only one Ag+ is required to bind to the channel to produce block.
The rate at which channels are blocked clearly depends upon the number of cysteine residues present at position 149. The simplest case is the tetramer. Here the development of blockage will follow occupancy of the single Cys by Ag+.
The rates of channel blockage are given in Table 2. For the tetramer, assuming a pKa for CysSH of 8·6 and rapid (de)protonation, the microscopic transition rate constant for Ag+ blockage was 2·3 × 105 M-1 s-1. The ratio of observed rate constants for channel blockage in the tetramer, in the dimer, and in channels formed from wild-type monomers (tetramer: dimer: monomer) was 1 : 4 : 16. This result was not expected from eqn (3), where the rate is expected to change with the number of binding sites, n. The results show rather that the rate varies with n2.
Table 2. Properties of Ag+ blockage in wild-type and concatameric channels
| No. of Ag+ binding sites per channel, n |
Time constant, (200 nM Ag+) (s) |
Observed rate constant, nk' (× 104 M-1 s-1) |
Relative nk' |
Calculated rate constant, k1 (× 105 M-1 s-1) |
| Wild-type | 4 | 33·2 ± 2·9 | 15·0 ± 1·5 | 16·1 | - |
| Dimer | 2 | 131·6 ± 11·0 | 3·8 ± 0·4 | 4·1 | - |
| Tetramer | 1 | 536·6 ± 53·7 | 0·93 ± 0·1 | 1 (defined) | 2·29 ± 0·25 |
The number of cells in this study was: wild-type, 4; dimer, 5; tetramer, 5.
= 1/(k' [Ag+]n) in eqn (3). k1 is the transition rate constant for the binding, within the channel, of Ag+ to CysS-.
 |
DISCUSSION |
Silver block of Kir2.1
Our results indicate that Ag+, a cysteine-reactive K+ analogue, blocks the strong inward rectifying K+ channel Kir2.1 by binding to a cysteine residue at position 149 in the pore-forming H5 region. This residue is located sufficiently close to the ion conduction pathway that the binding of only one Ag+ to one of the four potential binding sites is sufficient to block channel current.
Silver is very similar in size to a K+ ion (0·25 nm unhydrated diameter compared with 0·26 nm for K+). Like K+, Ag+ sheds its hydration shell easily and must do so in order to interact with the sulfhydryl group of cysteine. R-S-Ag replaces R-S-H on the sulfhydryl group, keeping the group electroneutral and ruling out electrostatic repulsion as a mechanism of block. Presumably, therefore, Ag+ blocks the channel by fully occluding the pore, which implies that the Kir pore is already fairly narrow at the level of C149.
Use of dimers and tetramers
The decay of whole-cell current in response to the application of external Ag+ clearly follows a single exponential, implying that the binding of one Ag+ to the channel is sufficient to occlude the channel pore. Our results, particularly with the tetrameric channel, support this idea but interpretation of the results using concatamers relies on the assumption that the dimer and tetramer fold neatly and in the desired configuration to produce a uniform population of channels with a known number of Ag+ binding sites per channel. The use of concatamers is not new and previous studies have addressed this point and have concluded that the concatamers preferentially fold or assemble in the desired configuration (Liman et al. 1992; Heginbotham & MacKinnon, 1992; Yang et al. 1995). Omori et al. (1997), however, suggest the contrary and it is therefore important that we consider all possible options. For example, dimeric constructs (A-B) could potentially produce a functional tetrameric K+ channel in a number of ways. They might simply pair as A-B-A-B or, since the linker of ten glutamine residues is fairly long, as A-A-B-B. Alternatively, some of the dimers may contribute only one subunit (A or B) to the functional channel, leaving the other half of the dimer outside the complex. If this is the case, all combinations of channels ranging from A-A-A-A to B-B-B-B could occur.
We consider the last case to be unlikely for the following reasons. From our results, the rate of blockage by Ag+ is much slower in the dimers than in the wild-type monomers, partly as would be expected from a reduction in the number of binding sites on each channel. The rate of block of the dimers fits well to a single exponential, suggesting only a single population of channels is present and the rate is 4 times slower than that of the wild-type.
The inclusion of a lethal mutation on one subunit of the dimer pair led to a dramatic drop in the number of functional channels. The mutation R148C disrupts an intersubunit salt bridge in Kir2.1, which is believed to stabilize the central pore structure (Yang et al. 1997). Monomers carrying this mutation are unable to form functional channels. Expression of R148C wild-type dimer in CHO cells resulted in only tiny inwardly rectifying whole-cell currents (< 5 pA pF-1) compared with normal levels of dimer expression of several nanoamps. We assume that these tiny currents represented the small population of channels which formed from the association of the wild-type half of four dimers. These results are consistent with the findings of Heginbotham & MacKinnon (1992) who concluded that only a few per cent of the channels formed half-dimer associations.
Similarly, with the tetramers we have shown that only one Ag+ ion has to bind to the channel to elicit blockage. We would therefore expect that, given a sufficient amount of time, the tetramers should be blocked to zero current in a similar way to the wild-type. Figure 5 demonstrates that this is indeed the case. Since each tetramer is composed of three Ag+-insensitive (C149S) subunits and only one wild-type subunit, one might expect a significant population of channels that were insensitive to Ag+ if the tetramers assorted randomly with each other to form channels. Since this does not seem to be the case, we have to conclude that the tetramers preferentially fold to form functional K+ channels carrying one mutant subunit per channel.
Thus, based on our dimer and tetramer constructs, we conclude that only a single Ag+ is required to bind to Cys149 to elicit block of Kir2.1. However, the results show the rate of blockage by Ag+ to vary with the square of the number of binding sites - with n2. It is possible that the microscopic rate constant is raised by the presence of more than one Cys. While in protein molecules Ag+ binds preferentially to the thiolate anions formed by the sulphur atom at the end of the side chains of cysteine residues, a number of Ag+ thiolates are known to be oligomeric or polymeric (Dance, 1981). This oligomerization/polymerization arises through an interaction between the silver and a lone pair of electrons on a sulphur atom which is not bonded to the silver. The possibility exists that when the Ag+ thiolate is formed in the ion conduction pathway, the sulphur atoms on other subunits (in all but the tetrameric construct) can interact with this Ag+ via a lone pair, thus increasing the affinity of Ag+ for such sites. However, such polymerization would require an appropriate distance between sulfhydryl groups. Alternatively, the presence of several Cys might reduce the pKa of the sulfhydryl group, increasing apparent affinity. Neither of these mechanisms however, is likely to produce the dependence on n2.
A likely explanation concerns the time Ag+ spends in the relevant position in the channel. Each Cys side chain spends nearly 5 % of the time negatively charged. This charge will attract Ag+ electrostatically and will affect the time Ag+ spends in a position where it can bind. If there are n Cys, Ag+ may be expected to spend n times longer in this position. At any instant, Ag+ will also have n sites to which it can bind. Thus the rate of blockage will be proportional to n2, as we find.
 |
REFERENCES |
| Abrams, C. J., Davies, N. W., Shelton, P. A. & Stanfield, P. R. (1996). The roles of a single aspartate residue in ionic selectivity and block of a murine inward rectifier K+ channel Kir2.1. The Journal of Physiology 493, 643-649 |
[Abstract] |
| Akabas, M. H., Stauffer, D. A., Xu, M. & Karlin, A. (1992). Acetylcholine receptor channel structure probed in cysteine-substitution mutants. Science 258, 307-310 |
[Medline] |
| Barry, P. H. (1994). JPCalc, a software package for calculating liquid junction potential corrections in patch clamp, intracellular, epithelial and bilayer measurements and for correcting junction potential measurements. Journal of Neuroscience Methods 51, 107-116 |
[Medline] |
| Dance, I. G. (1981). Crystallization and structure of bis(tetramethylammonium) octakis(benzenethiolato)hexaargentate(I), extending the series of cages [M4(SPh)6]2-, [M5(SPh)7]2-, [M6(SPh)8]2-, and [M12(SPh)16]4-. Inorganic Chemistry 20, 1487-1492. |
|
| Dart, C, Leyland, M. L., Spencer, P. J., Stanfield, P. R. & Sutcliffe, M. J. (1998). The selectivity filter of a potassium channel, murine Kir2.1, investigated using scanning cysteine mutagenesis. The Journal of Physiology 511, 25-32. |
[Abstract/Full Text] |
| Fakler, B., Brandle, U., Bond, C. H., Glowatzki, E., Konig, C., Adelman, J. P., Zenner, H. P. & Ruppersberg, J. P. (1994). A structural determinant of differential sensitivity of cloned inward rectifier K+ channels to intracellular spermine. FEBS Letters 356, 199-203 |
[Medline] |
| Ficker, E., Taglialatela, M., Wible, B. A., Henley, C. M. & Brown, A. M. (1994). Spermine and spermidine as gating molecules for inward rectifier K+ channels. Science 266, 1068-1072 |
[Medline] |
| Heginbotham, L., Abramson, T. & MacKinnon, R. (1992). A functional connection between the pores of distantly related ion channels as revealed by mutant K+ channels. Science 258, 1152-1155 |
[Medline] |
| Heginbotham, L. & MacKinnon, R. (1992). The aromatic binding site for tetraethylammonium ion on potassium channels. Neuron 8, 483-491 |
[Medline] |
| Ho, K., Nichols, C. G., Lederer, W. J., Lytton, J., Vassilev, P., Kanazirska, M. V. & Herbert, S. C. (1993). Cloning and expression of an inwardly rectifying ATP-regulated potassium channel. Nature 362, 31-38 |
[Medline] |
| Jocelyn, P. C. (1972). Biochemistry of the SH Group. Academic Press, London. |
|
| Karschin, C., Dissmann, E., Stühmer, W. & Karschin, A. (1996). IRK(1-3) and GIRK(1-4) inwardly rectifying K+ channel mRNAs are differentially expressed in the adult rat brain. Journal of Neuroscience 16, 3559-3570 |
[Abstract/Full Text] |
| Kubo, Y., Baldwin, T. J., Jan, Y. N. & Jan, L. Y. (1993). Primary structure and functional expression of a mouse inward rectifier potassium channel. Nature 362, 127-133 |
[Medline] |
| Kunkel, T. A. (1985). Rapid and efficient site-specific mutagenesis without phenotypic selection. Proceedings of the National Academy of Sciences of the USA 82, 488-492 |
[Medline] |
| Leyland, M. L., Shelton, P. A., Dart, C., Conley, E. C. & Stanfield, P. R. (1997). Single subunit mutations of the murine K+ channel IRK1. The Journal of Physiology 499.P, 125-126P. |
|
| Liman, E. R., Tytgat, J. & Hess, P. (1992). Subunit stoichiometry of a mammalian K+ channel determined by construction of multimeric cDNAs. Neuron 9, 861-871 |
[Medline] |
| Lopatin, A. N., Makhina, E. N. & Nichols, C. G. (1994). Potassium channel block by cytoplasmic polyamines as the mechanism of inward rectification. Nature 372, 366-369 |
[Medline] |
| Lü, Q. & Miller, C. (1995). Silver as a probe of pore-forming residues in a potassium channel. Science 268, 304-307 |
[Medline] |
| MacKinnon, R. (1991). Determination of the subunit stoichiometry of a voltage-activated potassium channel. Nature 350, 232-235 |
[Medline] |
| Matsuda, H., Saigusa, A. & Irisawa, H. (1987). Ohmic conductance through the inward rectifier K channel and blocking by internal Mg2+. Nature 325, 156-159 |
[Medline] |
| Omori, K., Oishi, K. & Matsuda, H. (1997). Inwardly rectifying potassium channels expressed by gene transfection into the Green Monkey kidney cell line COS-1. The Journal of Physiology 499, 369-378 |
[Abstract] |
| Pascual, J. M., Sheih, C.-C., Kirsch, G. E. & Brown, A. M. (1995). K+ pore structure revealed by reporter cysteines at inner and outer surfaces. Neuron 14, 1055-1063 |
[Medline] |
| Perier, F., Radecke, C. M. & Vandenberg, C. A. (1994). Primary structure and characterization of a small-conductance inwardly rectifying potassium channel from human hippocampus. Proceedings of the National Academy of Sciences of the USA 91, 6240-6244 |
[Abstract] |
| Reuveny, E., Jan, Y. N. & Jan, L. Y. (1996). Contributions of a negatively charged residue in the hydrophobic domain of the IRK1 inward rectifier K+ channel to K+-selective permeation. Biophysical Journal 70, 754-761 |
[Abstract] |
| Schwalbe, R. A., Wang, Z., Bianchi, L. & Brown, A. M. (1996). Novel sites of N-glycosylation in ROMK1 reveal the putative pore-forming segment H5 as extracellular. Journal of Biological Chemistry 271, 24201-24206 |
[Abstract/Full Text] |
| Slesinger, P., Patil, N., Liao, Y. J., Jan, Y. N., Jan, L. Y. & Cox, D. R. (1996). Functional effects of the mouse weaver mutation on G-protein-gated inwardly rectifying K+ channels. Neuron 16, 321-331 |
[Medline] |
| Stanfield, P. R., Davies, N. W., Shelton, P. A., Khan, I. A., Brammar, W. J., Standen, N. B. & Conley, E. C. (1994). The intrinsic gating of inward rectifier K+ channels expressed from the murine IRK1 gene depends on voltage, K+ and Mg2+. The Journal of Physiology 475, 1-7 |
[Abstract] |
| Stauffer, D. A. & Karlin, A. (1994). Electrostatic potential of acetylcholine binding sites in the nicotinic receptor probed by reactions of binding-site cysteines with charged methanethiosulphonates. Biochemistry 33, 6840-6849 |
[Medline] |
| Sun, Z. P., Akabas, M. H., Goulding, E. H., Karlin, A. & Siegelbaum, S. A. (1996). Exposure of residues in the cyclic nucleotide-gated channel pore: P region structure and function in gating. Neuron 16, 141-149 |
[Medline] |
| Sutcliffe, M. J. & Stanfield, P. R. (1994). Pore region of K+ channel RACTK1. Nature 369, 616. |
|
| Takahashi, N., Morishige, K.-I., Jahangir, A., Yamada, M., Findlay, I., Koyama, H. & Kurachi, Y. (1994). Molecular cloning and functional expression of cDNA encoding a second class of inward rectifier potassium channels in the mouse brain. Journal of Biological Chemistry 269, 23274-23279 |
[Abstract] |
| Yang, J., Jan, Y. N. & Jan, L. Y. (1995). Determination of the subunit stoichiometry of an inwardly rectifying potassium channel. Neuron 15, 1441-1447 |
[Medline] |
| Yang, J., Yu, M., Jan, Y. N. & Jan, L. Y. (1997). Stabilization of ion selectivity filter by pore loop ion pairs in an inwardly rectifying potassium channel. Proceedings of the National Academy of Sciences of the USA 94, 1568-1572 |
[Abstract/Full Text] |
Acknowledgements
We thank The Wellcome Trust and The Royal Society for their support. M. J. S. is a Royal Society University Research Fellow.
Corresponding author
P. R. Stanfield: Ion Channel Group, Department of Cell Physiology and Pharmacology, University of Leicester, PO Box 138, Leicester LE1 9HN, UK.
Email: prs{at}le.ac.uk
C. Dart and M. L. Leyland contributed equally to this work and should be considered as joint first authors.
This article has been cited by other articles:

|
 |

|
 |
 
M. L. Leyland and C. Dart
An Alternatively Spliced Isoform of PSD-93/Chapsyn 110 Binds to the Inwardly Rectifying Potassium Channel, Kir2.1
J. Biol. Chem.,
October 15, 2004;
279(42):
43427 - 43436.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Dart and M. L. Leyland
Targeting of an A Kinase-anchoring Protein, AKAP79, to an Inwardly Rectifying Potassium Channel, Kir2.1
J. Biol. Chem.,
June 1, 2001;
276(23):
20499 - 20505.
[Abstract]
[Full Text]
[PDF]
|
 |
|