|
|
||||||||
MS 8645 Received 4 September 1998; accepted after revision 20 October 1998.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Long QT syndrome (LQT) is a disorder that can cause sudden death from cardiac arrhythmias, torsade de pointes and ventricular fibrillation. Mutations in the human ether-a-go-go (eag)-related gene (HERG) underlie chromosome 7-linked LQT (Satler et al. 1998). HERG is a member of the eag family of potassium channels (Warmke & Ganetzky, 1994). Family members contain six putative membrane-spanning domains, an ion-conducting pore region and a putative cyclic nucleotide-binding domain. Expression of wild-type HERG protein in Xenopus oocytes revealed that HERG encodes the rapidly activating, inwardly rectifying K+ channel responsible for the cardiomyocyte current IKr (Sanguinetti et al. 1995), an important component of ventricular repolarization. These findings have led to the proposal that reduced IKr, resulting from mutations in HERG, can prolong cardiomyocyte action potential duration, thereby giving rise to LQT (reviewed in Roden et al. 1996).
It has recently been reported that HERG mutations Y611H and V822M result in an incompletely glycosylated form of the protein exhibiting a restricted perinuclear distribution with no detectable current (Zhou et al. 1998a). In addition, it has been demonstrated that N-linked oligosaccharides can act as determinants for cell surface transport of certain membrane proteins (Gut et al. 1998). The HERG amino acid sequence contains two extracellular consensus N-linked glycosylation sites, N598 and N629. In this study, we set out to determine whether N-linked glycosylation is required for surface membrane expression of HERG in a mammalian cell line, HEK 293. To do so, we generated stably transfected cell lines expressing green fluorescent protein (GFP)-tagged HERG (HERGGFP), and singly and doubly mutated HERGGFP that had had either one or both of the conserved N-linked glycosylation sites removed. The wild-type and N-linked glycosylation mutant HERGGFP fusion proteins were analysed for their biochemical and electrophysiological properties as well as their subcellular localization. We found that the wild-type protein exhibited a surface membrane localization and normal electrophysiological function; however, both single (N598Q, N629Q) and double (N598Q- N629Q) mutants showed an intracellular localization, with no detectable current. These results strongly suggest that N-linked glycosylation is required for surface membrane expression of HERG channels.
| METHODS |
|---|
|
|
|---|
DNA constructs and transfection of HEK 293 cells
HERG cDNA (kindly provided by Dr G. A. Robertson, University of Wisconsin, USA) was subcloned into BamHI/EcoRI sites of the pBK-CMV expression vector (Stratagene). GFP cDNA (kindly provided by Dr J. Orlowski, Department of Physiology, McGill University) was subcloned into the Not I/XbaI sites of the pBK-CMV expression vector. The HERG-GFP fusion construct (designated HERG GFP) was generated by ligating the 3' end of the HERG cDNA to the 5' end of the GFP cDNA. In order to do so, a Not I site at the 3' end of the HERG cDNA was introduced by polymerase chain reaction (PCR) and the GFP cDNA was sublconed into the Not I/XbaI sites of the pBK-CMV-HERG expression vector. The final fusion construct was purified using a Wizard Plus Midiprep Purification System (Promega) and sequenced (Sheldon Biotechnology, Montréal, Québec, Canada) in order to verify its integrity.
The following primers were used to mutate either singly or in combination the two N-linked glycosylation sites located in the extracellular loop between transmembrane segments S5 and S6 using the unique site elimination technique (Deng & Nickoloff, 1992): N598Q, 5' GGCAAACCCTACCAGAGCAGCGGCCTG; N629Q, 5' GTGGGCTTCGGCCAGGTCTCTCCCAAC (mutated codons are underlined). The N-linked glycosylation mutant HERG GFP fusion constructs were then purified using a Wizard Plus Midiprep DNA Purification System and sequenced (Sheldon Biotechnology).
HEK 293 cells were transfected with wild-type and mutant constructs using Lipofectamine (Gibco). After selection in 800 µg ml-1 geneticin (G418, 50 % active; Gibco) for 10-15 days, single colonies were selected, grown and assayed for HERGGFP expression. The stably transfected cells were maintained in
-minimum essential medium, 10 % fetal bovine serum, 1 % penicillin-streptomycin (Gibco) and 800 µg ml-1 geneticin.
Immunocytochemistry
For transient transfectants, native GFP fluorescence was used to localize HERGGFP fusion protein. Cells plated on coverslips were rinsed in phosphate-buffered saline (PBS), fixed in 4 % paraformaldehyde for 20 min at room temperature, rinsed in PBS and mounted using Immuno Fluore (Fisher Scientific). For tunicamycin (Sigma) treatment, 1 µg ml-1 tunicamycin was added to cells 5 h post-transfection for an additional 28 h. Cells were then fixed as above.
For the stable transfectants, however, an anti-HERG antibody was used to localize HERGGFP as the native GFP fluorescence was too low to allow for subcellular localization. The low level of native GFP fluorescence is due not to a low level of fusion protein expression but to a reduction in the absorption, and thus emission, of the chromophore due to dimerization of the GFP molecule. This dimerization results from high levels of fusion protein expression (information from Clontech). Briefly, stably transfected cells plated on coverslips were fixed in 2 % paraformaldehyde for 30 min followed by five rinses in PBS. Cells were then incubated in 0·5 % Triton X-100-0·5 % BSA in PBS for 30 min followed by incubation with an anti-HERG antibody generated against the amino terminus of HERG, anti-N (kindly provided by Drs A. Pond & J. M. Nerbonne, Department of Pharmacology and Molecular Biology, Washington University, St Louis, MO, USA; Pond & Nerbonne, 1996), for 1 h and subsequently rinsed in PBS. The cells were then incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc., Bar Harbor, ME, USA) for 1 h followed by three rinses in PBS. All incubations were performed at room temperature. Coverslips were mounted using Immuno Floure.
All imaging was performed using a Zeiss LSM 410 inverted confocal microscope. GFP and FITC were imaged by exciting the sample with a 488 nm line from an argon-krypton laser and the resulting fluorescence was collected on a photomultiplier after passage through FT510 and BP515-540 filter sets. Optical sections were taken using a × 25, 0·8 NA (optical thickness, 3·1 µm) objective and a × 63, 1·4 NA (optical thickness, 1·0 µm) objective. All images were printed on a Kodak XLS8300 high resolution (300 DPI) printer.
Immunoblot analysis
Parallel 100 mm plates of similarly confluent cultures were used to isolate crude membrane fractions. All steps were performed at 4°C. Briefly, the cells were rinsed 5 times with PBS, lysed with 2 ml of a solution containing (mM): 200 NaCl, 33 NaF, 10 EDTA and 50 Hepes (pH 7·4) and Complete protease inhibitor cocktail (Boehringer Mannheim, diluted according to manufacturer's instructions), and harvested with the aid of a rubber scraper. Cells were then homogenized and centrifuged at 3600 g for 10 min. The supernatants were collected and the membrane fractions were pelleted by centrifugation at 110 000 g for 40 min. The membrane-enriched pellets were solubilized in 50 mM Tris-HCl, 15 mM
-mercaptoethanol and 1 % SDS. The membrane proteins were then heated to 70°C in sample buffer (0·12 M Tris-HCl (pH 6·8), 2 % SDS, 2 %
-mercaptoethanol, 20 % glycerol and 0·001 % Bromophenol Blue) for 2 min and resolved on a 6·25 % SDS polyacrylamide gel. The proteins were then transferred onto a PVDF membrane (Amersham) overnight. Membranes were quenched in PBS with 5 % dried milk-0·1 % Tween 20 for 1 h at room temperature and subsequently incubated with the anti-N antibody at a 1 : 500 dilution for 2 h at room temperature, followed by three 10 min rinses in PBS with 0·1 % Tween 20. Membranes were then incubated in a 1 : 3000 dilution of horseradish peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch Laboratories, Inc.) for 1 h at room temperature. Horseradish peroxidase-conjugated secondary antibodies were detected using the chemiluminescence ECL+ detection kit (Amersham).
For N-glycosidase F treatment, 1 % NP-40, Complete protease inhibitor cocktail, and 2 U N-glycosidase F (Boehringer) were added to
30 µg of the resuspended membrane fractions. The mixture was then incubated at 37°C for 21 h. The reaction was stopped by adding sample buffer and boiling for 2 min.
Electrophysiological analysis
The whole-cell patch clamp technique was used to record membrane currents. Cells were plated on 35 mm Petri dishes and placed on the stage of an inverted microscope (Zeiss IM35). All experiments were carried out at 35 ± 1°C. Patch clamp electrodes were filled with medium containing (mM): 130 KCl, 1 MgCl2, 5 EGTA, 5 MgATP and 10 Hepes (pH 7·2 with KOH). The pipette tip resistance was 2-4 M
. The external medium contained (mM): 137 NaCl, 4 KCl, 1·8 CaCl2, 1 MgCl2, 10 glucose and 10 Hepes (pH 7·4 with NaOH). Membrane currents were recorded using an Axopatch amplifier (Axopatch-1D, Axon Instruments Corp.). Voltage clamp pulses were delivered from a custom-designed software package (Alembic Software Co., Montréal, Canada) implemented on a personal computer equipped with an analog-to-digital card (Omega Corp., Stanford, CT, USA). The data were stored on a computer hard disk and analysed using the same software. A two-step voltage clamp protocol was imposed from a holding potential of -80 mV to assess the presence of HERG current. The first step, which served to activate HERG current, consisted of a 4 s depolarizing pulse to potentials between -60 and +50 mV in increments of 10 mV. At the end of the first step the membrane was repolarized back to -60 mV for 2 s, in order to assess HERG tail currents, before returning to the -80 mV holding potential. Cell capacitance was estimated by analog measurements using the patch clamp amplifier. Graphics and statistical analysis were carried out using Origin software (Microcal, Northampton, MA, USA). E-4031 was a generous gift from Eisai Co. (Tsukuba Research Laboratories, Japan).
| RESULTS |
|---|
|
|
|---|
Role of N-linked glycosylation in surface membrane expression of HERGGFP
Fluorescence confocal microscopy was used to determine the subcellular localization of HERGGFP transiently expressed in HEK 293 cells. Native GFP fluorescence revealed that HEK 293 cells transiently expressing HERGGFP showed abundant surface membrane expression of HERGGFP (Fig. 1A, arrows indicate localization between cells; Fig. 1B, arrows indicate surface membrane expression). When the cells were treated for 28 h with tunicamycin, an inhibitor of N-linked glycosylation, the transfected protein was no longer seen at the surface membrane but showed an intracellular accumulation with a predominant perinuclear subcellular localization (Fig. 1C, the arrow indicates an endoplasmic reticulum (ER)-Golgi-like distribution pattern; Fig. 1D). These results indicate that treatment of cells with tunicamycin results in an intracellular retention of HERGGFP with no surface membrane expression.
![]() |
View larger version [in this window] [in a new window] |
|
|
A, subcellular localization of HERGGFP. Native GFP fluorescence overlayed on a transmitted-light image. Arrows indicate HERGGFP localization at surface membranes. B, fluorescence image revealing the subcellular localization of HERGGFP. Arrows indicate HERGGFP localization at surface membranes. C, subcellular localization of HERGGFP in cells treated with 1 µg ml-1 tunicamycin for 28 h. Native GFP fluorescence overlayed on a transmitted-light image. Arrows indicate the perinuclear localization of HERGGFP. D, fluorescence image revealing the subcellular localization of HERGGFP in cells treated with 1 µg ml-1 tunicamycin for 28 h. Representative images of three separate experiments are shown. | ||
Biochemical analysis of HERGGFP stably transfected into HEK 293 cells
Immunoblot analysis of HERGGFP stably transfected into HEK 293 cells is shown in Fig. 2. An antibody directed against the amino terminus of HERG, anti-N, was used to probe for HERGGFP protein. The anti-N antibody recognized multiple species of HERGGFP in stably transfected cells; an upper band with an apparent molecular mass of
185 kDa and a lower band with an apparent molecular mass of
165 kDa. A degradation product at
70 kDa was also evident (Fig. 2, lane 2). Neither band was present in untransfected HEK 293 cells (Fig. 2, lane 1). Similarly, Zhou et al. (1998b) reported that two bands of HERG are evident upon Western blot analysis; an upper band with an apparent molecular mass of 155 kDa and a lower band with an apparent molecular mass of 135 kDa. This is consistent with our results as we have an
30 kDa GFP molecule tagged to the carboxyl terminus of HERG.
To determine the extent of N-linked carbohydrate modification, protein isolated from HEK 293 cells stably expressing HERGGFP was treated with N-glycosidase F, which removes N-linked carbohydrate from proteins. This treatment converted the 185 kDa band to an
170 kDa band and shifted the lower 165 kDa band to an
162 kDa band (Fig. 2, lane 3). The
70 kDa degradation product was also shifted, suggesting that it is derived from a glycosylated portion of the protein. These results suggest that both molecular mass species of HERGGFP undergo N-linked glycosylation, with the higher molecular mass species most probably representing a fully glycosylated form of the protein.
![]() |
View larger version [in this window] [in a new window] |
|
|
Enriched membrane fractions were prepared as described in Methods. Each lane was loaded with ~30 µg of protein. An anti-HERG antibody was used to probe for HERGGFP. The control lane shows results with untransfected cells. The HERGGFP lanes show results with cells stably expressing HERGGFP before (-) and after (+) treatment with N-glycosidase F. The data are representative of four separate experiments. | ||
Biochemical analysis of HERGGFP and N-linked glycosylation mutants of HERGGFP stably transfected into HEK 293 cells
HERG contains two potential extracellular consensus N-linked glycosylation sites: one site (N598) near the putative pore region, and the second (N629) within the pore region. To determine the role of N-linked glycosylation at each of these sites three constructs were generated by site-directed mutagenesis: N598Q, N629Q and N598Q-N629Q. Each of these three N-linked glycosylation mutant HERGGFP fusion proteins was stably expressed in HEK 293 cells.
Immunoblot analysis of total membrane protein isolated from wild-type HERGGFP, N598Q-HERGGFP, N629Q-HERGGFP and N598Q-N629Q-HERGGFP stably expressed in HEK 293 cells is shown in Fig. 3. For each of the three N-linked glycosylation mutant HERGGFP proteins the anti-N antibody recognized a protein species with an apparent molecular mass of
162 kDa (Fig. 3, lanes 3-5). The apparent molecular mass of each of the mutant HERGGFP proteins was similar to the lower band of the enzymatically deglycosylated wild-type HERGGFP protein (Fig. 2, lane 3), suggesting that none of the mutant proteins was glycosylated, and that both N-linked glycosylation sites must be available for either site to be glycosylated as mutations at either N-linked glycosylation site led to a non-glycosylated form of the protein. An
70 kDa degradation product was also evident for the wild-type protein and a shifted correlate product was evident for all three mutant proteins, indicating that the degradation product is derived from a glycosylated portion of the protein.
![]() |
View larger version [in this window] [in a new window] |
|
|
Enriched membrane fractions were prepared as described in Methods. Each lane was loaded with ~30 µg of protein. An anti-HERG antibody was used to probe for HERGGFP. The control lane shows results with untransfected cells. Results from protein isolated from cells stably expressing HERGGFP, N598Q-HERGGFP (N598Q), N629Q-HERGGFP (N629Q) or N598Q-N629Q-HERGGFP (N598Q-N629Q) are shown in their respective lanes. The data are representative of four separate experiments. | ||
Functional analysis of N-linked glycosylation mutants
To evaluate the functional role of N-linked carbohydrate modification of HERGGFP, the whole-cell patch clamp technique was used to study the membrane currents in HEK 293 cells stably expressing wild-type HERGGFP and the N-linked glycosylation mutants. Figure 4Aa shows current traces recorded during a series of depolarizing voltage clamp steps from a -80 mV holding potential to potentials ranging from -60 to +50 mV. A tail current can be observed at the termination of the initial depolarizing step when the membrane is suddenly stepped to -60 mV. Figure 4Ab shows that the time-dependent current induced during the step and the current tail were almost completely blocked by E-4031, a selective inhibitor of IKr and IHERG (Sanguinetti et al. 1995). In the presence of E-4031 a small amplitude rapidly activating transient outward current persisted along with a residual steady-state background current. Control experiments carried out using untransfected HEK 293 cells (n = 32 cells) showed that the small amplitude transient current was present in most cells but the large time-dependent outward current observed in cells transfected with HERGGFP was never observed. These results indicate that the HERGGFP fusion protein is functional and that the time-dependent outward current in cells transfected with HERGGFP (IHERGGFP) has properties similar to IHERG. This is further illustrated in Fig. 4Ac, which shows the current-voltage relationship measured at the end of the initial 4 s depolarization step in HEK 293 cells stably transfected with HERGGFP and in control untransfected cells. The current-voltage relationship indicates that IHERGGFP is activated at membrane potentials positive to -40 mV. At potentials positive to 0 mV the current-voltage relationship showed a marked inward rectification with a negative slope conductance. In untransfected cells a small residual linear background current persisted with reversal close to 0 mV suggesting a degree of non-selectivity. The above observations are very similar to those recently reported for HEK 293 cells transfected with HERG (Zhou et al. 1998b) and demonstrate that HERG GFP encodes an ion channel with pharmacological and electrophysiological characteristics similar to the channel encoded by native HERG.
![]() |
View larger version [in this window] [in a new window] |
|
|
A two-step voltage clamp protocol was imposed from a holding potential of -80 mV to assess the presence of HERG current in HEK 293 cells stably transfected with wild-type HERGGFP or HERGGFP mutants. The outward currents were evoked during an initial 4 s depolarizing pulse to potentials between -60 and +50 mV in increments of 10 mV. At the end of the first step the membrane was repolarized back to -60 mV for 2 s before returning to the -80 mV holding potential. Aa, a series of current traces recorded in HEK 293 cells stably transfected with HERGGFP showing an inwardly rectifying delayed rectifier current. Ab, in the presence of E-4031 (1 µM) the HERGGFP-induced delayed rectifier current was completely blocked. The residual transient outward current and background current were similar to those observed in untransfected cells. Ac, current-voltage relationship of untransfected HEK 293 cells (n = 6 cells, | ||
The current recordings from HEK 293 cells stably expressing the N-linked glycosylation mutants N598Q-HERGGFP, N629Q-HERGGFP and N598Q-N629Q-HERGGFP are shown in Fig. 4B. The currents were induced using the same voltage clamp protocol as in Fig. 4A. It was found that the large IHERGGFP evident in wild-type HERG GFP stably transfected cells was absent in all three N-linked glycosylation mutants (n = 40 for each mutant). The recordings indicate that HEK 293 cells transfected with the mutants retain the small transient outward current. Current-voltage plots of the three mutants (data not shown) were similar to those observed in untransfected HEK 293 cells (Fig. 4Ac), consistent with the presence of a small amplitude endogenous background current.
Subcellular localization of N-linked glycosylation mutant proteins
Fluorescence confocal microscopy was used to determine the subcellular localization of the wild-type and N-linked glycosylation mutants of HERGGFP stably expressed in HEK 293 cells. Wild-type HERGGFP exhibited a surface membrane distribution pattern (Fig. 5A), consistent with the functional electrophysiological recordings. In contrast, N598Q-HERGGFP, N629Q-HERGGFP and N598Q-N629Q-HERGGFP revealed a perinuclear subcellular localization consistent with the absence of a HERG current upon electrophysiological analysis (Fig. 5B-D) indicating that both N-linked glycosylation sites must be available for surface membrane expression of HERGGFP.
![]() |
View larger version [in this window] [in a new window] |
|
|
Cells were immunolabelled with an anti-HERG antibody followed by a FITC-conjugated goat anti-rabbit IgG antibody. Representative immunofluorescence images are overlayed on transmitted-light images. A, surface membrane localization of wild-type HERGGFP. B, perinuclear localization of N598Q-HERGGFP. C, perinuclear localization of N629Q-HERGGFP. D, perinuclear localization of N598Q-N629Q-HERGGFP. Representative images of four separate experiments are shown. | ||
| DISCUSSION |
|---|
|
|
|---|
In the present study we set out to determine the role of N-linked glycosylation in surface membrane expression of HERG. In part, this was assessed using an inhibitor of N-linked glycosylation, tunicamycin. As a means to visualize the subcellular localization of HERG, we constructed a HERG-GFP fusion protein, HERGGFP. We found that treatment of HERGGFP transiently expressed in HEK 293 cells with tunicamycin led to an absence of surface membrane expression of the protein and an intracellular accumulation exhibiting a perinuclear subcellular distribution. In order to determine whether the HERGGFP fusion construct functioned normally, whole-cell patch clamp recordings of HERGGFP stably expressed in HEK 293 cells were performed. The HERGGFP current that was generated revealed similar properties to HERG stably expressed in the same cell line (Zhou et al. 1998b). These findings indicate that GFP tagged to the carboxyl terminus affects neither HERGGFP targeting to the cell surface nor its function.
Immunoblot analysis of HERGGFP revealed that it exists as two molecular mass species of
185 and
165 kDa. Upon enzymatic deglycosylation with N-glycosidase F, the larger molecular mass species shifted from
185 to
170 kDa, and the smaller molecular mass species shifted from
165 to
162 kDa. These findings are consistent with those of Zhou et al. (1998b) and indicate that the upper band most probably represents the fully glycosylated form of HERG. Since treatment with the enzyme did not convert the two protein bands to a single band, post-translational modifications other than N-linked glycosylation may be involved. Possibilities include palmitylation, sulfation, phosphorylation or acylation. O-linked glycosylation does not seem to be a possibility as HERG does not contain such a consensus site.
In order to elucidate the role of each of the two consensus N-linked glycosylation sites, N598 and N629, we constructed three N-linked glycosylation mutants, N598Q-HERGGFP, N629Q-HERGGFP and N598Q-N629Q-HERGGFP, and stably expressed them in HEK 293 cells. Replacement of the asparagine at amino acid 598 with a glutamine resulted in the loss of glycosylation not only at site 598, but also at 629, yielding a molecular mass species of
162 kDa. Similarly, replacement of the asparagine at amino acid 629 with glutamine resulted in the loss of glycosylation at sites 629 and 598, yielding a molecular mass species of
162 kDa. The double mutant also resulted in a molecular mass species of
162 kDa. These findings indicate that both glycosylation sites, N598 and N629, must be available for glycosylation to occur. Immunofluorescence analysis revealed that each of the N-linked glycosylation mutants showed an absence of surface membrane expression, with a perinuclear subcellular distribution. Moreover, no HERG current was detectable in any of the three N-linked glycosylation mutants. These results indicate that N-linked glycosylation is required for proper trafficking of HERGGFP as the unglycosylated 162 kDa form of the protein does not appear to exit the ER-Golgi apparatus. An alternative explanation is that the replacement of the asparagine with a glutamine yields a three-dimensional configuration of the protein rendering it susceptible to degradation prior to exiting the ER-Golgi apparatus. However, treatment of cells with tunicamycin resulted in an ER-Golgi-like retention of HERGGFP that was similar to that observed with the N-linked glycosylation mutants. This further supports the notion that N-linked carbohydrate is required for trafficking of HERGGFP to its final destination at the cell surface. Moreover, in one of the cells stably expressing N598Q-HERGGFP we were able to record a small HERG-like current indicating that at least some of the protein retains its proper three-dimensional configuration in the non-glycosylated state, and that a small percentage is able to reach the surface membrane. Thus it appears that for HERGGFP, the consensus N-linked glycosylation sites must both be available for glycosylation to occur, and that the non-glycosylated form of the protein is retained intracellularly.
To date, 19 different HERG mutations in LQT patients have been reported (Curran et al. 1995; Akimoto et al. 1996; Benson et al. 1996; Dausse et al. 1996; Satler et al. 1996, 1998; Tanaka et al. 1997). Importantly, it was recently reported that HERG protein resulting from mutations Y611H and V822M was incompletely glycosylated and no current was detectable (Zhou et al. 1998a). In addition, a recent study has demonstrated that N-linked oligosaccharides can act as determinants for cell surface transport of certain membrane proteins (Gut et al. 1998). Recently two mutations resulting in LQT were found at a consensus extracellular N-linked glycosylation site, N629D and N629S (Satler et al. 1998). Taken in the context of the results presented in this paper, these observations suggest that mutations at N-linked glycosylation sites or mutations that inhibit N-linked glycosylation may affect HERG protein trafficking and surface expression.
The role of carbohydrates in the trafficking and function of certain ion channels has been reported by several groups. Waechter et al. (1983) demonstrated that tunicamycin reduced the number as well as the function of sodium channels on the cell surface. The effect of tunicamycin was not mediated solely by increasing the rate of proteolytic degradation of internalized sodium channels but must also reduce the rate of sodium channel appearance on the cell surface and/or increase the rate of internalization of channels from the cell surface. Merlie et al. (1982) reported that when muscle cells were treated with tunicamycin, the
1 subunit of the muscle-type nicotinic acetylcholine receptor failed to assemble into toxin-binding receptors on the cell surface. In addition, Mishina et al. (1985) reported that when the asparagine at amino acid 141 of the Torpedo
1 subunit was replaced with aspartic acid, there was no acetylcholine response and no detectable
-bungarotoxin-binding sites on the cell surface. N-linked glycosylation has also been shown to be necessary for proper trafficking of the GLYT1 glycine transporter to the plasma membrane (Olivares et al. 1995).
The role of N-linked glycosylation has not been clearly established for K+ channels. Santacruz-Toloza et al. (1994) reported that for the Shaker K+ channel, N-linked glycosylation is not required for the assembly of functional channels or for their transport to the cell surface. Similarly, Deal et al. (1994) reported that glycosylation at the single extracellular N-linked glycosylation site is not required for subunit assembly, transport to the surface, protein stability or function of the Kv1.1 channel.
Early studies with tunicamycin demonstrated that when N-linked carbohydrate addition to protein was blocked, most non-glycosylated forms of the proteins accumulated in the ER, aggregated, and did not exit. This led to the concept that carbohydrate addition aids protein folding and stabilizes the protein conformation rendering it less susceptible to proteolytic degradation (Fiedler & Simons, 1995). Further studies have demonstrated that glycoproteins associate with ER resident chaperones, including calnexin, calreticulin, PDI, Bip and Grp94, and that this association promotes correct folding and oligomeric assembly, prevents degradation and supports quality control (Hammond & Helenius, 1995; Hebert et al. 1997). ER retention of misfolded or unassembled proteins has been demonstrated for the
F508 cystic fibrosis transmembrane conductance regulator, the truncated
chain of
-hexosaminidase and unassembled subunits of the T cell receptor (Bonifacino & Lippincot-Schwartz, 1991; Ward & Kopito, 1995).
In summary, we report that inhibition of N-linked glycosylation using tunicamycin results in a perinuclear accumulation of HERGGFP in HEK 293 cells. Replacement of the asparagines at the each of the consensus N-linked glycosylation sites with glutamine leads to a similar perinuclear accumulation of HERGGFP with no surface membrane expression and no detectable current. These findings may help to provide insight into a mechanism responsible for the lack of HERG current resulting from certain mutations observed in individuals with LQT2.
| REFERENCES |
|---|
|
|
|---|
| Akimoto, K., Furutani, M., Kasanuki, H., Imammura, S.-I., Furutani, Y., Takao, A., Monma, K. & Matsuoka, R. (1996). Coexistence of missense mutation of HERG and mitochondrial DNA in Japanese long QT family. Circulation 94, I164. | |
| Benson, D. W., MacRae, C. A., Vesely, M. R., Walsh, E. P., Seidman, J. G., Seidman, C. E. & Satler, C. A. (1996). Missense mutation in the pore region of HERG causes familial long QT syndrome. Circulation 93, 1791-1795 | [Abstract/Full Text] |
| Bonifacino, J. S. & Lippincot-Schwartz, J. (1991). Degradation of proteins within the endoplasmic reticulum. Current Opinion in Cell Biology 7, 592-600. | |
| Curran, M. E., Splawski, I., Timothy, K. W., Vincent, G. M., Green, E. D. & Keating, M. T. (1995). A molecular basis for cardiac arrhythmia. HERG mutations cause long QT syndrome. Cell 80, 795-803 | [Medline] |
| Dausse, E., Berthet, M., Denjoy, I., Andre-Fouet, X., Cruaud, C., Bennaceur, M., Faure, S., Coumel, P., Schwartz, K. & Guicheney, P. (1996). A mutation in HERG associated with notched T waves in long QT syndrome. Journal of Molecular and Cellular Cardiology 28, 1609-1615 | [Medline] |
| Deal, K. K., Lovinger, D. M. & Tamkun, M. M. (1994). The brain Kv1.1 potassium channel: in vitro and in vivo studies on subunit assembly and posttranslational processing. Journal of Neuroscience 14, 1666-1676 | [Abstract] |
| Deng, W. P. & Nickoloff, J. A. (1992). Site-directed mutagenesis of virtually any plasmid by eliminating a unique site. Analytical Biochemistry 200, 81-88 | [Medline] |
| Fiedler, K. & Simons, K. (1995). The role of N-glycans in the secretory pathway. Cell 81, 309-312 | [Medline] |
| Gut, A., Kappeler, F., Hyka, N., Balda, M. S., Hauri, H.-P. & Matter, K. (1998). Carbohydrate-mediated Golgi to cell surface transport and apical targetting of membrane proteins. EMBO Journal 17, 1919-1929 | [Full Text] |
| Hammond, C. & Helenius, A. (1995). Quality control in the secretory pathway. Current Opinion in Cell Biology 3, 592-600. | |
| Hebert, D. N., Zhang, J.-X., Chen, W., Foellmer, B. & Helenius, A. (1997). The number and location of glycans on influenza hemagglutinin determine folding and association with calnexin and calreticulin. Journal of Cell Biology 139, 613-623 | [Abstract/Full Text] |
| Merlie, J. P., Sebbane, R., Tzartos, S. & Lindstrom, J. (1982). Inhibition of glycosylation with tunicamycin blocks assembly of newly synthesized acetylcholine receptor subunits in muscle cells. Journal of Biological Chemistry 257, 2694-2701 | [Abstract] |
| Mishina, M., Tobimatsu, T., Imoto, K., Tanaka, K., Fujita, Y., Fukuda, K., Kurasaki, M., Takahashi, H., Morimoto, Y., Hirose, T., Inayama, S., Takahashi, T., Kuno, M. & Numa, S. (1985). Location of functional region of acetylcholine receptor alpha-subunits by site-directed mutagenesis. Nature 313, 364-369 | [Medline] |
| Olivares, L., Aragon, C., Gimenez, C. & Zafra F. (1995). The role of N-glycosylation in the targeting and activity of the GLYT1 glycine transporter. Journal of Biological Chemistry 270, 9437-9442 | [Abstract/Full Text] |
| Pond, A. & Nerbonne, J. M. (1996). A truncated form of HERG identified in human heart. Circulation 94, I641. | |
| Roden, D. M., Lazzara, R., Rosen, M., Schwartz, P. J., Towbin, J. & Vincent, G. M. (1996). Multiple mechanisms in the long-QT syndrome. Current knowledge, gaps, and future directions. The SADS Foundation Task Force on LQTS. Circulation 94, 1996-2012 | [Abstract/Full Text] |
| Sanguinetti, M. C., Jiang, C., Curran, M. E. & Keating, M. T. (1995). A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell 81, 299-307 | [Medline] |
| Santacruz-Toloza, L., Huang, Y., John, S. A. & Papazian, D. M. (1994). Glycosylation of shaker potassium channel protein in insect cell culture and in Xenopus oocytes. Biochemistry 33, 5607-5613 | [Medline] |
| Satler, C. A., Vesely, M. R., Duggal, P., Ginsburg, G. S. & Beggs, A. H. (1998). Multiple different missense mutations in the pore region of HERG in patients with long QT syndrome. Human Genetics 102, 265-272. | [Medline] |
| Satler, C. A., Walsh, E. P., Vesely, M. R., Plummer, M. H., Ginsburg, G. S. & Jacob, H. J. (1996). Novel missense mutation in the cyclic nucleotide-binding domain of HERG causes long QT syndrome. American Journal of Medical Genetics 65, 27-35. | [Medline] |
| Tanaka, T., Nagai, R., Tomoike, H., Takata, S., Yano, K., Yabuta, K., Haneda, N., Nakano, O., Shibata, A., Sawayama, T., Kasai, H., Yazaki, Y. & Nakamura, Y. (1997). Four novel KVLQT1 and four novel HERG mutations in familial long-QT syndrome. Circulation 95, 565-567 | [Abstract/Full Text] |
| Waechter, C. J., Schmidt, J. W. & Catterall, W. A. (1983). Glycosylation is required for maintenance of functional sodium channels in neuroblastoma cells. Journal of Biological Chemistry 258, 5117-5123 | [Abstract] |
| Ward, C. L. & Kopito, R. R. (1995). Degradation of CFTR by the ubiquitin-proteasome pathway. Cell 83, 121-127 | [Medline] |
| Warmke, J. W. & Ganetzky, B. (1994). A family of potassium channel genes related to eag in Drosophila and mammals Proceedings of the National Academy of Sciences of the USA 91, 3438-3442 | [Abstract] |
| Zhou, Z., Gong, Q., Epstein, M. & January, C. T. (1998a). Multiple mechansims of HERG channel dysfunction in human long QT associated mutation. Biophysical Journal 74, A26. | |
| Zhou, Z., Gong, Q., Ye, B., Fan, Z., Makielski, J. C., Robertson, G. A. & January, C. T. (1998b). Properties of HERG channels stably expressed in HEK 293 cells studied at physiological temperature. Biophysical Journal 74, 230-241 | [Abstract/Full Text] |
The authors would like to thank Dr J. Orlowski for his advice throughout this project and Dr J. J. M. Bergeron for his critical evaluation of the manuscript. This research was supported by a grant to A. S. from the Medical Research Council of Canada. K. P. was supported by a grant from the Fonds pour la Formation de Chercheurs et l'Aide à la Recherche.
Corresponding author
A. Shrier: Department of Physiology, McGill University, 3655 Drummond Street, Montréal, Québec, Canada H3G 1Y6.
Email: ashrier{at}physio.mcgill.ca
This article has been cited by other articles:
![]() |
V. E. Walker, R. Atanasiu, H. Lam, and A. Shrier Co-chaperone FKBP38 Promotes HERG Trafficking J. Biol. Chem., August 10, 2007; 282(32): 23509 - 23516. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. B. Maryon, S. A. Molloy, and J. H. Kaplan O-Linked Glycosylation at Threonine 27 Protects the Copper Transporter hCTR1 from Proteolytic Cleavage in Mammalian Cells J. Biol. Chem., July 13, 2007; 282(28): 20376 - 20387. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Chen, O. Frohlich, Y. Yang, J. D. Klein, and J. M. Sands Loss of N-Linked Glycosylation Reduces Urea Transporter UT-A1 Response to Vasopressin J. Biol. Chem., September 15, 2006; 281(37): 27436 - 27442. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, Y. Fu, W. Tian, and D. M. Cohen Glycosylation of the osmoresponsive transient receptor potential channel TRPV4 on Asn-651 influences membrane trafficking Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1103 - F1109. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Sun, X. Liu, Q. Xiong, S. Shikano, and M. Li Chronic Inhibition of Cardiac Kir2.1 and hERG Potassium Channels by Celastrol with Dual Effects on Both Ion Conductivity and Protein Trafficking J. Biol. Chem., March 3, 2006; 281(9): 5877 - 5884. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Napp, F. Monje, W. Stuhmer, and L. A. Pardo Glycosylation of Eag1 (Kv10.1) Potassium Channels: INTRACELLULAR TRAFFICKING AND FUNCTIONAL CONSEQUENCES J. Biol. Chem., August 19, 2005; 280(33): 29506 - 29512. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Miranda, T. Giraldez, P. de la Pena, D. G Manso, C. Alonso-Ron, D. Gomez-Varela, P. Dominguez, and F. Barros Specificity of TRH receptor coupling to G-proteins for regulation of ERG K+ channels in GH3 rat anterior pituitary cells J. Physiol., August 1, 2005; 566(3): 717 - 736. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Delisle, J. K. Slind, J. A. Kilby, C. L. Anderson, B. D. Anson, R. C. Balijepalli, D. J. Tester, M. J. Ackerman, T. J. Kamp, and C. T. January Intragenic Suppression of Trafficking-Defective KCNH2 Channels Associated with Long QT Syndrome Mol. Pharmacol., July 1, 2005; 68(1): 233 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Clancy and R. S. Kass Inherited and Acquired Vulnerability to Ventricular Arrhythmias: Cardiac Na+ and K+ Channels Physiol Rev, January 1, 2005; 85(1): 33 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tovar-Palacio, N. A. Bobadilla, P. Cortes, C. Plata, P. de los Heros, N. Vazquez, and G. Gamba Ion and diuretic specificity of chimeric proteins between apical Na+-K+-2Cl- and Na+-Cl- cotransporters Am J Physiol Renal Physiol, September 1, 2004; 287(3): F570 - F577. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Folco, G.-X. Liu, and G. Koren Caveolin-3 and SAP97 form a scaffolding protein complex that regulates the voltage-gated potassium channel Kv1.5 Am J Physiol Heart Circ Physiol, August 1, 2004; 287(2): H681 - H690. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Delisle, B. D. Anson, S. Rajamani, and C. T. January Biology of Cardiac Arrhythmias: Ion Channel Protein Trafficking Circ. Res., June 11, 2004; 94(11): 1418 - 1428. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Faillace, R. O. Bernabeu, and J. I. Korenbrot Cellular Processing of Cone Photoreceptor Cyclic GMP-gated Ion Channels: A ROLE FOR THE S4 STRUCTURAL MOTIF J. Biol. Chem., May 21, 2004; 279(21): 22643 - 22653. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Thomas, J. Kiehn, H. A Katus, and C. A Karle Defective protein trafficking in hERG-associated hereditary long QT syndrome (LQT2): molecular mechanisms and restoration of intracellular protein processing Cardiovasc Res, November 1, 2003; 60(2): 235 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Much, C. Wahl-Schott, X. Zong, A. Schneider, L. Baumann, S. Moosmang, A. Ludwig, and M. Biel Role of Subunit Heteromerization and N-Linked Glycosylation in the Formation of Functional Hyperpolarization-activated Cyclic Nucleotide-gated Channels J. Biol. Chem., October 31, 2003; 278(44): 43781 - 43786. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Akhavan, R. Atanasiu, and A. Shrier Identification of a COOH-terminal Segment Involved in Maturation and Stability of Human Ether-a-go-go-related Gene Potassium Channels J. Biol. Chem., October 10, 2003; 278(41): 40105 - 40112. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Meade, R. S. Hoover, C. Plata, N. Vazquez, N. A. Bobadilla, G. Gamba, and S. C. Hebert cAMP-dependent activation of the renal-specific Na+-K+-2Cl- cotransporter is mediated by regulation of cotransporter trafficking Am J Physiol Renal Physiol, June 1, 2003; 284(6): F1145 - F1154. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shimoni and X.-F. Liu Role of PKC in autocrine regulation of rat ventricular K+ currents by angiotensin and endothelin Am J Physiol Heart Circ Physiol, April 1, 2003; 284 (4): H1168 - H1181. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. S. Hoover, E. Poch, A. Monroy, N. Vazquez, T. Nishio, G. Gamba, and S. C. Hebert N-Glycosylation at Two Sites Critically Alters Thiazide Binding and Activity of the Rat Thiazide-sensitive Na+:Cl- Cotransporter J. Am. Soc. Nephrol., February 1, 2003; 14(2): 271 - 282. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Jin, T. M. Weiger, and I. B. Levitan Reciprocal Modulation between the alpha and beta 4 Subunits of hSlo Calcium-dependent Potassium Channels J. Biol. Chem., November 8, 2002; 277(46): 43724 - 43729. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kupershmidt, T. Yang, S. Chanthaphaychith, Z. Wang, J. A. Towbin, and D. M. Roden Defective Human Ether-a-go-go-related Gene Trafficking Linked to an Endoplasmic Reticulum Retention Signal in the C Terminus J. Biol. Chem., July 19, 2002; 277(30): 27442 - 27448. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Conti, C. M. Radeke, and C. A. Vandenberg Membrane Targeting of ATP-sensitive Potassium Channel. EFFECTS OF GLYCOSYLATION ON SURFACE EXPRESSION J. Biol. Chem., July 5, 2002; 277(28): 25416 - 25422. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Gong, C. L. Anderson, C. T. January, and Z. Zhou Role of glycosylation in cell surface expression and stability of HERG potassium channels Am J Physiol Heart Circ Physiol, July 1, 2002; 283(1): H77 - H84. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Finley, Y. Li, F. Hua, J. Lillich, K. E. Mitchell, S. Ganta, R. F. Gilmour Jr., and L. C. Freeman Expression and coassociation of ERG1, KCNQ1, and KCNE1 potassium channel proteins in horse heart Am J Physiol Heart Circ Physiol, July 1, 2002; 283(1): H126 - H138. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Schwalbe, A. Rudin, S.-L. Xia, and C. S. Wingo Site-directed Glycosylation Tagging of Functional Kir2.1 Reveals That the Putative Pore-forming Segment Is Extracellular J. Biol. Chem., June 28, 2002; 277(27): 24382 - 24389. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yan, J. Khoshnoodi, V. Ruotsalainen, and K. Tryggvason N-Linked Glycosylation Is Critical for the Plasma Membrane Localization of Nephrin J. Am. Soc. Nephrol., May 1, 2002; 13(5): 1385 - 1389. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. Cayabyab and L. C. Schlichter Regulation of an ERG K+ Current by Src Tyrosine Kinase J. Biol. Chem., April 12, 2002; 277(16): 13673 - 13681. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ohya, K. Asakura, K. Muraki, M. Watanabe, and Y. Imaizumi Molecular and functional characterization of ERG, KCNQ, and KCNE subtypes in rat stomach smooth muscle Am J Physiol Gastrointest Liver Physiol, February 1, 2002; 282(2): G277 - G287. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Ufret-Vincenty, D. J. Baro, and L. F. Santana Differential contribution of sialic acid to the function of repolarizing K+ currents in ventricular myocytes Am J Physiol Cell Physiol, August 1, 2001; 281(2): C464 - C474. [Abstract] [Full Text] [PDF] |
||||