HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gerster, U. Articles by Flucher, B. E. Search for Related Content PubMed PubMed Citation Articles by Gerster, U. Articles by Flucher, B. E.

Current modulation and membrane targeting of the calcium channel _1C subunit are independent functions of the subunit

Uli Gerster, Birgit Neuhuber, Klaus Groschner *, Jörg Striessnig and Bernhard E. Flucher

MS 8939 Received 6 November 1998; accepted after revision 24 February 1999.

	ABSTRACT

Top Abstract Introduction Methods Results Discussion References

1. The subunits of voltage-sensitive calcium channels facilitate the incorporation of channels into the plasma membrane and modulate calcium currents. In order to determine whether these two effects of the subunit are interdependent or independent of each other we studied plasma membrane incorporation of the channel subunits with green fluorescent protein and immunofluorescence labelling, and current modulation with whole-cell and single-channel patch-clamp recordings in transiently transfected human embryonic kidney tsA201 cells.

2. Coexpression of rabbit cardiac muscle _1C with rabbit skeletal muscle _1a, rabbit heart/brain _2a or rat brain ₃ subunits resulted in the colocalization of _1C with and in a marked translocation of the channel complexes into the plasma membrane. In parallel, the whole-cell current density and single-channel open probability were increased. Furthermore, the _2a isoform specifically altered the voltage dependence of current activation and the inactivation kinetics.

3. A single amino acid substitution in the subunit interaction domain of _1C (_1CY467S) disrupted the colocalization and plasma membrane targeting of both subunits without affecting the subunit-induced modulation of whole-cell currents and single-channel properties.

4. These results show that the modulation of calcium currents by subunits can be explained by subunit-induced changes of single-channel properties, but the formation of stable _1C- complexes and their increased incorporation into the plasma membrane appear not to be necessary for functional modulation.

	INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

Voltage-sensitive calcium channels are multimeric protein complexes formed by the ₁ subunit and the auxiliary subunits ₂, and (Leung et al. 1987; Takahashi et al. 1987; Vaghy et al. 1987). The ₁ subunit by itself shows the characteristic properties of a voltage-gated ion channel, i.e. voltage sensing, ion permeation and drug binding. The physiological roles of the auxiliary subunits are currently the subject of intensive investigations. The subunit modulates calcium currents by increasing the current density and by changing the current kinetics when coexpressed in heterologous expression systems (Lacerda et al. 1991; Varadi et al. 1991; Lory et al. 1992). Furthermore, it has been suggested that the subunit is involved in the targeting of the ₁ subunit to the plasma membrane (Chien et al. 1995; Gregg et al. 1996). Both the ₁ and subunits exist in multiple tissue-specific isoforms, which differ from one another in their primary structure and in their functional properties (Birnbaumer et al. 1994; Isom et al. 1994). The skeletal muscle _1S isoform, for example, shows slow activation and inactivation kinetics compared with the other ₁ isoforms. Also, whereas _1C expressed in heterologous expression systems exhibits currents even in the absence of auxiliary subunits (Perez-Garcia et al. 1995), expression of _1S in heterologous systems rarely gives rise to measurable calcium currents (Johnson et al. 1997). The subunit isoforms differ in their current modulation (Hullin et al. 1992; Sather et al. 1993; Parent et al. 1997) and, when expressed alone, in their subcellular distribution (Chien et al. 1995, 1996; Brice et al. 1997). For example, _2a drastically reduced the speed of inactivation when coexpressed with the neuronal _1E subunit in oocytes (Parent et al. 1997), whereas other subunit isoforms showed only minor effects on current inactivation. Analogously, _2a differs from most other isoforms in that it was localized in the plasma membrane when expressed without an ₁ subunit in a heterologous expression system (Chien et al. 1995), whereas _1a, ₃ and ₄ showed a cytoplasmic localization (Brice et al. 1997; Neuhuber et al. 1998b).

A conserved subunit binding motif has been identified in the cytoplasmic loop between repeats I and II of _1S, _1A, _1B and _1C (Pragnell et al. 1994). Point mutations within this binding motif perturbed ₁- binding and affected calcium current properties when the neuronal _1A isoform was coexpressed with _1b in oocytes. A point mutation (Y366S) within the subunit binding motif in the I-II linker of the skeletal muscle _1S resulted in the expected loss of _1S-_1a binding, but the probability that tsA201 human embryonic kidney cells cotransfected with _1SY366S and _1a exhibited calcium currents was still increased by the _1a subunit (Neuhuber et al. 1998b). This indicates that stable binding of _1a to the known motif in the I-II linker of _1S is not necessary for the subunit to increase the frequency of current expression. Thus, association of with this interaction domain in the cytoplasmic I-II linker plays an important role in subunit-dependent modulation of calcium currents, but other mechanisms for ₁- interaction may exist. De Waard et al. (1994, 1996) identified a conserved 30 amino acid domain in the subunit that is complementary to the binding site in the I-II linker on _1A and is involved in the interaction with this subunit. Mutations within this domain of perturbed binding to _1A and affected modulation of calcium current properties. However, this domain in the subunit cannot account for all observed modulatory effects of _1A- interactions, since certain truncated subunits were only affected in their modulation of inactivation kinetics, not in current stimulation. Therefore, a region of the subunit other than that interacting with the I-II linker of ₁ may be involved in the modulation of _1A (De Waard et al. 1994). Moreover, using chimeras of different isoforms Olcese et al. (1994) and Qin et al. (1996) have found that regulation of activation and inactivation of _1E channels are two separable functions of the subunit, suggesting the existence of two separate interaction domains on each of the subunits. Indeed, Tareilus et al. (1997) identified a second subunit binding domain within the last 277 amino acids of the C-terminus of _1E, and Walker et al. (1998) identified a low affinity binding site in the carboxy-terminal region of _1A that accounts for ₄-induced modulation of current inactivation.

Despite this progress in understanding the function of the calcium channel subunit the mechanism of current modulation by remains largely unresolved. For example, it is still controversial whether increased insertion of channels into the plasma membrane and modulation of current properties are two independent functions of the subunit or whether the latter is a direct result of the former. Also, we do not know whether ₁ and form a stable complex in which serves as a necessary cofactor or mediator of modulatory signals, or whether association and dissociation of the subunit in itself is the modulatory mechanism. To address these questions we studied the interactions of three different subunit isoforms with _1C and an _1C mutant with a single amino acid substitution in the subunit interaction domain of the I-II linker (_1CY467S) using a combination of structural and functional techniques. This approach allowed us to distinguish isoform-specific effects from common effects of _1C- interactions and to demonstrate that increased membrane incorporation and modulation of channel properties are two independent effects of subunits. Single-channel analysis showed that changes in the open probability are sufficiently large to explain the increase in whole-cell current density observed upon coexpression of the subunit. Further, the comparison of subunit effects on wild-type and mutant _1C shows that this increase in current density occurs even without the formation of stable _1C- complexes or their increased incorporation into the plasma membrane.

	METHODS

Top Abstract Introduction Methods Results Discussion References

Cell lines

tsA201 cells, a HEK cell subclone stably transfected with the SV40 large T-antigen, were plated and allowed to proliferate in F12 medium (Gibco BRL, Vienna, Austria) containing 10 % fetal bovine serum. Cells were grown to 80 % confluency before passaging. For structural analysis (green fluorescent protein (GFP) and immunocytochemistry), cells were plated at dilutions of about 1 : 10 onto poly-L-lysine-coated 13 mm round coverslips and transfected on the following day (see below) when cells reached 30 % confluency. For patch-clamp analysis cells were plated on 35 mm culture dishes at a dilution of 1 : 10. After transfection at about 50 % confluency, cells were replated onto poly-L-lysine-coated 25 mm round coverslips at dilutions between 1 : 5 and 1 : 10 to get isolated cells for patch-clamp recordings on the following day.

Transfection

Transfections were carried out with a liposomal transfection reagent (DOTAP, Boehringer Mannheim) according to the manufacturer's instructions. The total amount of DNA used per 35 mm culture dish was 10 µg, 5-8 µg of which was specific DNA (expression plasmids encoding _1C constructs, subunit and GFP), with the rest made up with inert DNA (pUC18; Norrander et al. 1985). In co-transfection experiments two or more expression plasmids were combined at equimolar concentrations. This resulted in coexpression of with any _1C construct in approximately 70 % of subunit-transfected cells. The liposome-DNA mixture was diluted in 1·5 ml F12 medium and then added to the culture. On the following day the cells were processed for immunocytochemistry or replated for patch-clamp analysis.

Expression plasmids

Details of the expression plasmids are given in Table 1. The coding sequence of rabbit cardiac muscle _1C DNA (Mikami et al. 1989) with an alternative exon in IVS3 (Koch et al. 1990) was inserted into the expression plasmid pcDNA3 (Invitrogen, San Diego, CA, USA) via HindIII and NotIdigestion. The tyrosine to serine substitution in position 467 in _1C (_1CY467S) was introduced by site-directed mutagenesis of _1C-pcDNA3 using the splicing by overlap extension technique. The following mutagenic sense primer was used:

5' AAGCAGCAGCTAGAAGAGGACCTCAAAGGCTCCCTGGACGGAT 3'.

To facilitate the identification of positive clones, a PvuII site (nucleotide 1376) was eliminated in the mutagenic primers by silent mutation. The mutated _1C fragment was inserted into _1C-pcDNA3 after digestion with BamHI (nucleotide 1263) and EcoRI (nucleotide 2213). The mutation was verified by sequence analysis. In addition, a GFP-_1C fusion protein (Grabner et al. 1998) was used for double fluorescence labelling. The subcellular distribution and the electrophysiological properties of GFP-_1C and _1C were identical.

Table 1. Expression plasmids

Name	Vector	Insert	Reference
1C	pcDNA3	Rabbit cardiac muscle 1	Mikami et al. 1989; Koch et al. 1990
GFP-1C	pcDNA3	GFP-1C fusion protein	Grabner et al. 1998
1CY467S	pcDNA3	Cardiac muscle 1C Y to S substitution	Present study
1a	pcDNA3	Rabbit skeletal muscle	Ruth et al. 1989
1a-GFP	pcDNA3	1a-GFP fusion protein	Neuhuber et al. 1998b
2a	pCMV6	Rabbit heart/brain	Perez-Reyes et al. 1992
3	pCMV6	Rat brain	Castellano et al. 1993
GFP (S65T)	pRK5	Green fluorescent protein	Heim et al. 1995
pUC18	pUC18	-	Norrander et al. 1985

GFP and immunofluorescence labelling

Paraformaldehyde-fixed cultures were immuno-stained as previously described (Flucher et al. 1993). For double labelling with GFP, Texas Red-conjugated antibodies (Jackson Immuno Research, West Grove, PA, USA) were used to exclude bleed-through between the red and the green channels. Working dilutions and the sources of primary antibodies are listed in Table 2. Samples were evaluated on a Zeiss Axiovert microscope with epifluorescence and phase-contrast optics and documented on 35 mm high speed black and white film. Controls, such as the omission of primary antibodies and incubation with inappropriate antibodies, were routinely performed. Localization of _1C and GFP-_1C, or _1a and _1a-GFP gave the same results with respect to distribution patterns in all examined conditions.

Table 2. Antibodies

Specificity	Code	Type	Dilution	Reference
DHP-receptor, 1C	CNC	Affinity purified, rabbit	1 : 1500	Safayhi et al. 1997
DHP-receptor,	com	Affinity purified, rabbit	1 : 1200	Pichler et al. 1997; Neuhuber et al. 1998b

Patch-clamp recording

Whole-cell and single-channel recordings were performed as described by Hamill et al. (1981). Cultures grown on 25 mm round coverslips were mounted in a recording chamber and viewed with a × 16 phase-contrast multi-immersion lens on a Zeiss Axiovert microscope. Fluorescent cells (indicating successful transfection with _1a-GFP or GFP) were selected for recording. An Axopatch 200A patch-clamp amplifier controlled by the software pCLAMP 6.0 (Axon Instruments) was used for all recordings.

Whole-cell recordings

The bath solution contained (mM): 40 BaCl₂, 100 TEA-Cl and 10 Hepes (adjusted to pH 7·4 using TEA-OH). Patch pipettes, pulled from borosilicate glass and fire polished, were filled with (mM): 130 caesium aspartate, 10 Hepes, 2 Mg-ATP, 2 Cs-EGTA and 0·5 MgCl₂ (adjusted to pH 7·4 with CsOH). Resistances of the patch pipettes were between 4 and 7 M. Capacitative currents were compensated using built-in analog circuits (series resistance error was corrected for 80 %), and the value for the whole-cell capacity was determined from this adjustment of the amplifier and used to calculate the current density. Leak resistance in the cell-attached mode was normally larger than 8 G. Current data were low-pass Bessel filtered at 2 kHz and sampled at 1 kHz with an IBM compatible PC. In the electrophysiological experiments _1C was used in place of GFP-_1C, which was primarily used in the structural analysis. In control experiments we did not find any difference between calcium currents from cells transfected with GFP-_1C or _1C. I-V curves, obtained by plotting the peak current density, i, against the test potential, V, were fitted by a modified Boltzmann function:

where g is the specific conductance (in pA (pF mV)^-1), V_rev is the reversial potential (in mV), V₅₀ is the potential of half-maximal activation (in mV), and k is the slope factor (in mV) which determines the steepness of the voltage dependence of activation.

Single-channel recordings

The bath solution contained (mM): 110 potassium aspartate, 20 KCl, 2 MgCl₂, 20 Hepes and 2 EGTA (adjusted to pH 7·4 with KOH). Patch pipettes, pulled from borosilicate glass, fire polished and coated with Sigmacote (Sigma), were filled with (mM): 80 BaCl₂, 30 TEA-Cl, 15 Hepes and 1 EDTA (adjusted to pH 7·4 with TEA-OH) and had resistances between 5 and 15 M. If not otherwise specified in the text the following procedures for data acquisition and analysis were used. Test pulses of 200 ms duration from -70 to 0 mV were applied at 3 s intervals. Data were low-pass Bessel filtered at 2 kHz, sampled at 10 kHz, and analysed with Fetchan 6.0 (Axon Instruments) after digital Gaussian filtering at 1·5 kHz. The event detection threshold was 0·5 pA. With this event detection threshold events arising from endogenous low voltage-activated small conductance calcium channels, which we sometimes observed in non-transfected tsA201 cells, were excluded from the analysis. This also applies for the low threshold small conductance channels described by Meir & Dolphin (1998) in COS7 cells transfected with ₁ subunits. Furthermore, events with a duration of 0·2 ms or shorter were excluded from the analysis. The open probability for a patch, i.e. NP_o where N is the number of channels in the patch and P_o is the single-channel open probability, was calculated by dividing the sum of the duration of all events, which was obtained from the event list provided by Fetchan 6.0, by the total observation time. This simplified method could be applied since, due to the rare occurrence and short duration of channel openings under our experimental conditions, higher conductance levels were almost never observed. In order to estimate the number of channels in each patch, N, from these NP_o values we used two different approaches: (1) a mathematical procedure, which is based on theoretical considerations about the distribution of NP_o values for a set of patches with different unknown N values, and (2) an experimental approach, in which the highest conductance level in each patch observed after the addition of the calcium channel agonist (±)-Bay K 8644 to the bath solution was taken as an estimate for the number of channels in the patch (for details, see Results).

	RESULTS

Top Abstract Introduction Methods Results Discussion References

Differential localization of individually expressed _1C and subunits

tsA201 cells were transiently transfected with GFP-_1C, _1a-GFP, _2a or ₃ and the subunit localization was determined with either GFP fluorescence or immunofluorescence (Fig. 1). In 79 % of 543 examined cells (Table 3) _1C was localized in a dense network of a tubular membrane compartment that extended throughout the entire cytoplasm. The tubular/reticular network was very dense in the perinuclear region but could be resolved in thin regions of the cells (Fig. 1a). Occasionally the nuclear envelope was also labelled. Based on these structural characteristics the _1C-containing compartment was identified as the endoplasmic reticulum. In 15 % of the cells _1C was also localized in clusters in the plasma membrane (not shown). There were no differences in the distribution patterns between the wild-type _1C and the mutant _1CY467S. The distribution patterns of the subunits differed from that of _1C and were different among themselves. When expressed alone, _1a and ₃ were both distributed diffusely throughout the cytoplasm of tsA201 cells (Table 4; Fig. 1d and o). In contrast, _2a showed a continuous plasma membrane stain and the cytoplasm was essentially free of immunolabel (Table 4; Fig. 1i).

		View larger version [in this window] [in a new window]
Figure 1. Changes in subcellular distribution patterns of calcium channel 1a, 2a and 3 subunits coexpressed with 1C or 1CY467S tsA201 cells were transfected with 1C (wild-type or mutant) and isoforms alone or in different subunit combinations and the subunits were localized with immunofluorescence or GFP labelling. Left column: when expressed alone 1C (a) is localized in a tubular network - presumably the endoplasmic reticulum - that is very dense in the perinuclear region (saturated fluorescence) but can be resolved in the cell periphery (arrows); 1a (d) and 3 (o) are diffusely localized in the cytoplasm; and 2a is localized in the plasma membrane (i; arrowhead). Centre column: when wild-type 1C and 1a are coexpressed, the two colocalize in clusters in the plasma membrane (b and e; examples indicated by arrows); 1C and 2a (g and j) are colocalized throughout the plasma membrane, diffusely (arrowheads) and in clusters (arrows); and 1C and 3 are either colocalized in clusters (l and p; arrows) or 3 remains diffusely distributed in the cytoplasm (m and q). The 1C + pairs were double labelled by using GFP-1C (b, g, l and m) and anti-com (e, j, p and q). Right column: when coexpressed with the mutant 1CY467S, translocation and colocalization fail and all subunits remain in the same compartments as when expressed individually; 1CY467S in the endoplasmic reticulum (c, h and n; arrows); 1a (f) and 3 (r) in the cytoplasm; and 2a in the plasma membrane (k; arrowhead). N, nucleus; scale bar, 20 µm.

Table 3. Subcellular distribution of the calcium channel _1C subunits expressed alone or with subunit isoforms

	1C		1CY467S
	ER	PM	ER	PM
Without	79	15	87	7
1a	14	83	87	7
2a	32	64	93	0
3	49	47	88	6

Table 4. Subcellular distribution of the calcium channel subunits expressed alone or with _1C

	Without 1C		1C			1CY467S
	Cytoplasm	PM	Cytoplasm	ER *	PM	Cytoplasm	PM
1a	98	0	12	19	69	96	0
2a	0	94	0	0	99	0	98
3	99	0	44	28	28	98	0

Colocalization of coexpressed _1C and subunits in the plasma membrane

_1C was coexpressed with _1a, _2a or ₃ in tsA201 cells and the subcellular distribution of both subunits was determined with GFP fluorescence or immunofluorescence. Upon coexpression with any of the subunits the localization of _1C changed significantly from that observed when _1C was expressed alone. In all cases the number of cells with an endoplasmic reticulum localization of _1C was strongly reduced, whereas the number of cells with a plasma membrane localization was strongly increased compared with cells in which _1C was expressed alone (Table 3). In parallel, _1a and ₃ were no longer found in the cytoplasm but were localized in clusters in the plasma membrane (Fig. 1e and p) and to some extent in the endoplasmic reticulum (Table 4). In both locations _1C and the subunits were colocalized (Fig. 1b, e, l and p). The degree to which _1C and were translocated to the plasma membrane was considerably higher for _1a than for ₃. Fewer than half of the cells coexpressing _1C and ₃ showed a colocalization of the two subunits in plasma membrane clusters, and in the rest of the cells _1C and ₃ remained in the endoplasmic reticulum and the cytoplasm, respectively (Fig. 1l, m, p and q; Tables 3 and 4). In contrast to the cytoplasmic _1a and ₃ subunits, the plasma membrane-associated _2a subunit showed little change in its distribution pattern when coexpressed with _1C. _2a remained evenly distributed throughout the plasma membrane, where it now was colocalized with _1C (Fig. 1g and j). In addition to the even plasma membrane distribution, the two subunits were frequently colocalized in plasma membrane clusters. The observed changes in the subcellular distribution of the _1C and subunits upon coexpression indicate that all three examined subunit isoforms bind to _1C and that the _1C- complexes become inserted into the plasma membrane.

Translocation and colocalization of _1C and subunits fails when the subunit binding domain in the cytoplasmic I-II linker of _1C is mutated

To investigate the mechanism of the direct _1C- interactions that underlie the observed changes in the subcellular distribution of the channel subunits, we replaced tyrosine in position 467 of the subunit interaction domain of _1C with serine. The corresponding point mutations in _1A and _1S have been shown to disrupt _1b and _1a binding, respectively (Pragnell et al. 1994; Neuhuber et al. 1998b). Indeed, when _1CY467S was coexpressed with any one of the subunit isoforms, _1CY467S and all subunits remained localized in the same subcellular compartment as when expressed alone (Fig. 1). The subunits were not colocalized with one another in the plasma membrane or anywhere else in the cells and no increased expression of _1CY467S clusters occurred. This shows that the translocation of the subunits to the plasma membrane that was observed with GFP fluorescence and immunofluorescence when any one of the subunits was coexpressed with wild-type _1C depends on an intact subunit interaction domain in the cytoplasmic I-II linker of _1C.

subunits modulate current activation in wild-type and mutant _1C channels

To investigate whether the observed structural interactions between _1C and the subunits are reflected in a modulation of calcium current properties, we performed whole-cell patch-clamp recordings. tsA201 cells were transfected with _1C or _1CY467S with or without one of the subunit isoforms, plus a plasmid encoding GFP as an expression marker. In the case of _1a, the fusion protein _1a-GFP was used instead of a combination of the two separate plasmids. The fraction of GFP-expressing cells in which high voltage-activated calcium currents could be recorded was 50 % for cells transfected with _1C alone and 42 % for cells transfected with _1CY467S alone. The percentage of cells exhibiting high voltage-activated calcium currents was about equal or higher when _1C or _1CY467S was coexpressed with a subunit.

To measure the voltage dependence of activation, 400 ms voltage steps were applied from a holding potential of -80 mV to various test potentials between -40 and +80 mV (Fig. 2). I-V curves were obtained from these measurements by plotting the peak current density against the test potential (Fig. 3A). Coexpression with any one of the subunits increased the peak current density severalfold. When _1C or _1CY467S was expressed alone the largest peak current was observed at a test potential of +40 mV. Upon coexpression with _2a the test potential at which the largest current was observed shifted to +30 mV. The Y467S point mutation had no effect on the intrinsic current properties of _1C or on the characteristic modulation by the subunit isoforms. The increase in current density observed with all subunit isoforms and the shift in the peak of the I-V curve observed with _2a were the same with _1C and _1CY467S. I-V curves were further analysed by fitting them with a modified Boltzmann function (see Methods; Fig. 3B). This analysis revealed that all subunits increased the specific conductance, g, and that the strongest shift occurred with _1a. The potential of half-maximal activation, V₅₀, and the slope factor, k, were both decreased by coexpression of the subunits, with _2a showing the strongest effect (with P < 0·001, t test). The value of k was significantly decreased with P < 0·05 by all subunits. The reversal potential, V_rev, was not significantly altered by coexpression of the subunits. Interestingly, none of these parameters showed a significant difference between _1C and _1CY467S in any of the examined subunit combinations, suggesting that despite the deficiency in complex formation _1CY467S was still sensitive to modulation by subunits.

		View larger version [in this window] [in a new window]
Figure 2. Comparison of the time course of current traces for 1C and 1CY467S expressed without or with 1a, 2a or 3 in tsA201 cells The membrane potential was stepped for 400 ms from a holding potential of -80 mV to 0, +20 or +40 mV (upper, middle and lower traces, respectively). The magnitude of currents varied greatly between individual cells (see also error bars in Fig. 3A and B). Current inactivation was slowed down on coexpression of 1C or 1CY467S with 2a. There was no apparent difference between currents recorded from 1C- or 1CY467S-transfected cells.

		View larger version [in this window] [in a new window]
Figure 3. Voltage dependence of current activation for wild-type and mutant 1C expressed with and without subunits A, I-V curves obtained by plotting the peak current density from voltage step measurements as shown in Fig. 2 against the test potential. Coexpression of 1C () and 1CY467S () with any one of the subunits increased the current amplitude severalfold (means and S.E.M.). B, I-V curves for each individual recording were fitted by a modified Boltzmann function (see Methods) and the obtained parameters were subsequently averaged. , 1C; , 1CY467S; error bars are S.E.M., and the number of cells recorded is shown. The specific conductance, g, was increased on subunit coexpression whereas V50 and k were decreased by subunit coexpression. The decrease in k on coexpression with each of the subunits compared with 1C or 1CY467S expression alone was significant with P < 0·05. The reversal potential, Vrev, was not significantly altered by the subunits.

Current kinetics are modulated by the subunits

As a measure of the activation kinetics the time from the onset of the voltage step to 70 % of the total rise in current amplitude, _{70 %}, was determined (Fig. 4A). Whereas ₃ had no effect, _1a decreased the speed of activation and _2a slightly accelerated activation. The activation kinetics of _1CY467S were always somewhat faster than those of wild-type _1C, regardless of whether they were expressed alone or together with a subunit. This suggests that tyrosine in position 467 of _1C is involved in determining the channel activation kinetics. The acceleration of activation kinetics by the mutation was statistically significant (P < 0·05) for coexpression with _1a and _2a, but not for ₃ and expression of _1C alone.

		View larger version [in this window] [in a new window]
Figure 4. Calcium current kinetics in tsA201 cells transfected with 1C or 1CY467S with and without subunits , 1C; , 1CY467S. A, activation kinetics of calcium currents are expressed as the time from the onset of a voltage step to +40 mV (holding potential, -80 mV) to 70 % of the total rise in current amplitude, 70 %. 1a slowed down current activation, 2a accelerated it and 3 did not affect activation kinetics. In all cases 1CY467S was slightly faster than the wild-type 1C. B, inactivation kinetics were determined by fitting a single exponential function with a time constant inact to the decay phase of the current during a voltage step to +40 mV from a holding potential of -80 mV. For 1C and 1CY467S coexpressed with 2a, test pulse duration was 4 s; for all other conditions test pulse duration was 400 ms. Only 2a severely slowed down current inactivation, by a factor of ~10.

The most dramatic modulatory effect of a subunit appeared in the inactivation kinetics (Fig. 4B). Current inactivation was determined by fitting a single exponential function to the decaying phase of the current (for cells cotransfected with _2a, 4 s-long test pulses were used instead of 400 ms pulses). Figure 4B shows the inactivation time constants for test pulses to +40 mV. Whereas coexpression with _1a or ₃ had only small effects (P > 0·04), _2a slowed current inactivation by a factor of approximately 10 (P < 0·0001). The inactivation kinetics of the mutant _1CY467S were indistinguishable from those of wild-type _1C.

Steady-state inactivation is not significantly modulated by the subunits

Steady-state inactivation was determined by measuring the current amplitude at a test potential of +40 mV (holding potential, -100 mV) after 10 s prepulses of different potentials (2 ms interpulse interval). Figure 5A shows the normalized current amplitudes as a function of the prepulse potential. The data were fitted by a Boltzmann function, the parameters of which are shown in Fig. 5B. The analysis did not indicate any modulatory effects of the subunits on steady-state inactivation, or any significant effects of the point mutation in _1C. Only the potential of half-maximal inactivation, V₅₀, was different, being about 7 mV higher for _1CY467S than for _1C, when the subunits were not coexpressed with a subunit, but this effect was not significant (P > 0·05). Although coexpression with the subunits resulted in small changes of V₅₀, statistically there was no significant difference from the V₅₀ values for _1C and _1CY467S expressed alone. The slope factor, k, was the same for all subunit combinations tested. Thus, steady-state inactivation of _1C was not subject to modulation by any one of the examined subunit isoforms.

		View larger version [in this window] [in a new window]
Figure 5. Steady-state inactivation in tsA201 cells transfected with 1C or 1CY467S with and without subunits A, normalized current amplitude during a voltage step from -100 to +40 mV after 10 s prepulses to various potentials with an interpulse interval of 2 ms (, 1C; , 1CY467S; means and S.E.M. of individual recordings are shown). There were only minor differences in steady-state inactivation between the different subunit combinations. B, steady-state inactivation curves for each individual recording were fitted by a Boltzmann function: i = 1/(1 + exp((V - V50)/k)), where i is the test pulse current amplitude, V is the prepulse potential, V50 is the prepulse potential of half-maximal inactivation and k is the slope factor, and the obtained parameters were subsequently averaged (, 1C; , 1CY467S; error bars are S.E.M.). The apparent difference in the slopes of the averaged curves shown in the upper left figure in A is not reflected in the slope factor, k, shown in the right panel of B, due to the large variability of V50 for 1C expression (see error bar in left panel of B). This analysis does not indicate statistically significant differences in steady-state inactivation parameters between cells transfected with different subunit combinations.

Single-channel open probability of _1C is increased by _1a

The data presented above suggest that the increase in whole-cell current density observed when _1C or _1CY467S was coexpressed with a subunit was not necessarily linked to an increase in plasma membrane localization of the subunit, because the latter was not observed with _1CY467S. Thus, the possibility that the subunit-induced increase in current density is due to changes of single-channel properties, such as a higher open probability or single-channel conductance, needed to be addressed directly. Therefore we performed single-channel recordings of _1C or _1CY467S alone, and _1C or _1CY467S coexpressed with _1a (Figs 6 and 7), the isoform that induced the largest current increase in whole-cell recordings. The amplitude of single-channel opening events, i, was about the same in all examined subunit combinations, showing that the single-channel conductance was not modulated by _1a (i = 0·90 ± 0·05 pA for _1C, 1·00 ± 0·04 pA for _1C + _1a, 1·00 ± 0·16 pA for _1CY467S, and 0·80 ± 0·03 pA for _1CY467S + _1a (means ± S.E.M.)). In contrast, the frequency and the duration of channel openings increased significantly when _1C or _1CY467S was coexpressed with _1a (Fig. 6). The open-state dwell time histograms (Fig. 6) show that coexpression of _1a increased the mean open time 2-fold. The observation that the mutation itself did not change single-channel properties, together with the results from the whole-cell experiments, shows that the Y467S substitution does not mimic the effects of subunit coexpression. The fraction of null sweeps was highly variable from cell to cell but on average no significant differences between _1C + _1a (51 %) and _1CY467S + _1a (55 %) were observed.

		View larger version [in this window] [in a new window]
Figure 6. Single-channel recordings from tsA201 cells transfected with 1C (A), 1C + 1a (B), 1CY467S (C) and 1CY467S + 1a (D) Voltage pulses of 200 ms duration from a holding potential of -70 mV to a test potential of 0 mV were applied every 3 s. Coexpression of 1C or 1CY467S with the 1a subunit resulted in an increased frequency of channel openings. The right panel shows open-state dwell time histograms. The mean open times, , obtained by fitting single exponential functions to the histograms, were increased by a factor of about 2 by 1a coexpression.

In order to determine the single-channel open probability, P_o, it was necessary to determine the number of channels, N, in each patch. The usual approach is to estimate N from the maximum number of conductance levels observed. This is reasonable only when P_o is sufficiently high and the mean open time is sufficiently long to observe simultaneous openings of multiple channels. Due to the rare occurrence and short mean open time of events under the conditions used here, simultaneous openings of multiple channels are extremely unlikely and were almost never observed. Therefore we applied two different approaches to estimate N for each patch. In the first approach, we added the calcium channel agonist (±)-Bay K 8644 to the bath solution to a final concentration of 5 µM after we had recorded several hundred sweeps without (±)-Bay K 8644 for the analysis of NP_o. With (±)-Bay K 8644 in the bath solution and depolarizations to +10 mV, channel openings lasting up to several hundred milliseconds occurred, allowing the observation of simultaneous openings of multiple channels in the patch (Fig. 7C). An all-points amplitude histogram of these recordings gives the number of conductance levels and thus the number of channels in the patch (Fig. 7D). With the value determined for N it was then possible to calculate P_o (open symbols in Fig. 7A and open bars in Fig. 7B). The second approach to estimate the unknown N for each NP_o value was a procedure based on theoretical considerations. This method does not require the application of the calcium channel agonist, allowing us to include recordings in the analysis that had not been tested for the number of channels with (±)-Bay K 8644, e.g. when the patch was not stable for long enough. The fitting procedure is based on the supposition that under the same experimental conditions the differences between the NP_o values from different patches can only be due to different numbers of channels in the patches. Thus, the NP_o values should always be an integer multiple (N) of the smallest possible value P_o. In other words, when plotting NP_o against N all data points should lie on a straight line crossing the abscissa at zero. According to this supposition, we estimated the unknown value N by assigning those values of N to each patch that resulted in the best linear regression through all data points and zero (Fig. 7A). The values for the single-channel open probability estimated with this method gave the same results as those obtained by the experimental approach (cf. open and filled bars in Fig. 7B). This indicates that the fitting method is a useful approach to estimate the number of channels in a patch, and thus to determine the single-channel open probability, when simultaneous openings of events are too rare to be detected or when the mean open time cannot be increased sufficiently by application of a channel agonist.

		View larger version [in this window] [in a new window]
Figure 7. Determination of the number of channels in a patch, N, and the single-channel open probability, Po Open probabilities for individual patches, NPo, were calculated from recordings from tsA201 cells transfected with 1C (), 1C + 1a (), or 1CY467S + 1a () and plotted against the number of channels in each patch, N. N values were determined by two different approaches. (i) Open symbols in A represent recordings in which at the end of an experiment 5 µM (±)-Bay K 8644 was added to the bath solution to visualize simultaneous openings of multiple channels in the patch. C shows an example of the short and long openings before and after addition of (±)-Bay K 8644, respectively, in a cell transfected with 1CY467S and 1a (upper trace, test pulse duration 200 ms at 0 mV; lower trace, test pulse duration 400 ms at +10 mV). The all-points amplitude histogram in D corresponding to the lower trace in C shows the number of conductance levels. (ii) Filled symbols in A represent recordings for which N values were estimated by finding the best fit of all NPo values in one experimental group to a linear regression crossing the abscissa at zero. Multiple data points with the same or similar NPo marked with 1 (, , ) and 2 (, ). The slope corresponds to the mean single-channel open probability. B, the Po values determined experimentally with (±)-Bay K 8644 () closely match the values from the fitting procedure (; error bars give standard deviation). Coexpression of 1a resulted in a 7- to 8-fold increase of Po.

Open probabilities determined for each condition according to these procedures were approximately 7- to 8-fold higher in cells coexpressing _1C or _1CY467S with _1a than for cells expressing the subunit alone. These single-channel data show that the _1a-induced 4- to 5-fold increase in the specific conductance, g, seen in whole-cell recordings (Fig. 3B) can be fully explained by the increase in single-channel open probability without the need for an increased number of functional channels in the plasma membrane.

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

In the present study we used heterologous expression of _1C with three different subunit isoforms in tsA201 cells to describe isoform-specific effects of the subunit on the subcellular distribution of the calcium channel subunits and on the modulation of current properties. The role of the subunit interaction domain in the cytoplasmic I-II linker of _1C was analysed by comparing the properties of wild-type _1C with those of an _1C construct in which tyrosine in position 467 was replaced with serine. Immunofluorescence and GFP fluorescence were used to determine the subcellular distribution patterns of the _1C and subunits, and current properties were studied with whole-cell and single-channel patch-clamp recordings. The combination of structural and functional analyses revealed isoform-specific effects on the targeting of both channel subunits and the modulation of calcium currents, but also showed that the two effects of the subunit are not causally linked.

Isoform-specific effects of _1a, _2a and ₃ on targeting of _1C and on current properties

Coexpression of _1C with one of the subunit isoforms resulted in changes of the subcellular distribution of both subunits and in changes in the current properties. Both structural and functional effects of the subunit on _1C showed differences depending on the isoform. When expressed alone, only _2a was localized in the plasma membrane, whereas _1a and ₃ were diffusely distributed in the cytoplasm. This is consistent with previous studies (Chien et al. 1995; Brice et al. 1997; Neuhuber et al. 1998b) and can be explained by the intrinsic ability of _2a to associate with the plasma membrane via a palmitoylation site in its N-terminus. Without a subunit, _1C accumulated in the endoplasmic reticulum of tsA201 cells. In only a small fraction of transfected cells could clusters of _1C be visualized in the plasma membrane, even though calcium currents revealed the presence of functional channels in the majority of transfected cells. Apparently, without coexpression of the subunit the density of functionally expressed channels in the plasma membrane is too low to be detected with immunocytochemistry or GFP labelling. A rough estimate of the density of functional _1C subunits in the plasma membrane based on the single-channel properties and the whole-cell data yielded a channel density of 21 µm^-2 (channel density = I_peakC/iP_o = (0·72 × 0·01)/(0·9 × 0·00039) where I_peak (at 0 mV) is in pA pF^-1, i is in pA, and the specific membrane capacity (C) is in pF µm^-2, assuming a value of C of 1 µF cm^-2 = 0·01 pF µm^-2). This value is far below the density of approximately 2200 channels µm^-2 found in skeletal muscle triads where calcium channels can be reliably detected with immunocytochemistry.

When _1C was coexpressed with any one of the tested isoforms, _1C became detectable with immunocytochemistry and GFP labelling in the plasma membrane, where it was now colocalized with the subunit. This was accompanied by an increase in current density for all subunit combinations, indicating that _1C and formed complexes that facilitated the incorporation of channels into the plasma membrane. However, the results of the single-channel recordings show that the current increase observed with the subunits can be explained by changes of the single-channel properties, i.e. an increase in open channel probability. Thus the number of functional channels in the plasma membrane did not change during coexpression of _1C with . Neely et al. (1993) reached the same conclusion for experiments in which subunit coexpression led to an increase in whole-cell currents without a parallel increase in gating charges. However, other studies suggested that the increase in whole-cell currents was entirely or in part due to an increase in the number of channels in the plasma membrane (Wakamori et al. 1993; Kamp et al. 1996; Josephson & Varadi, 1996). Our observation that the massive incorporation of _1C- complexes into the plasma membrane was not accompanied by an increased number of functional channels suggests that some additional factor is limiting the expression of functional channels. If such a factor is saturated to different degrees in different experimental systems, it could explain why some investigators observed a subunit-induced increase in channel density while others did not.

The ability of the different isoforms to facilitate incorporation of _1C- complexes into the plasma membrane differed qualitatively and quantitatively. Coexpression of the plasma membrane-associated _2a isoform resulted in an even distribution of _1C throughout the plasma membrane, suggesting that the intrinsic distribution of _2a also determined the distribution of _1C. In addition, clusters of both subunits in the plasma membrane could be observed. The cytoplasmic _1a and ₃ subunits were not homogeneously expressed throughout the plasma membrane when coexpressed with the ₁ subunit, but instead were only found colocalized with _1C in distinct clusters. This indicates that their own translocation from the cytoplasm to the plasma membrane is dependent on association with _1C and that an intrinsic predisposition of _1C to aggregate in clusters may determine the distribution of the _1C- complexes in the plasma membrane. Our observation that only about half of the cells coexpressing ₃ and _1C showed _1C- complexes in the plasma membrane, and in the other cells _1C and ₃ remained individually localized in the endoplasmic reticulum and the cytoplasm, respectively, suggests that ₃ binds to _1C with a somewhat lower affinity than _1a and _2a. This is consistent with data from De Waard et al. (1995) who showed that ₃ bound to _1A with lower affinity than _1b, _2a or ₄.

The isoform-specific modes of membrane targeting of the calcium channel _1C and subunits were paralleled by the isoform-specific modulation of whole-cell calcium currents. Whereas all three isoforms caused an increase of current density due to an increased specific conductance, a shift in the voltage dependence of activation was most pronounced with _2a, and only _2a caused a dramatic decrease in the rate of inactivation. A specific effect of _2a on current inactivation has previously been shown for _1A and _1E when expressed in oocytes (Sather et al. 1993; Qin et al. 1996; Parent et al. 1997), indicating that the distinct effects of _2a shown in the present study are not the result of combining the two native subunit partners of cardiac muscles; instead this property must reside on _2a itself. The observation that _2a differs from _1a and ₃ in its targeting properties as well as in its modulatory ability suggests that these properties may be related. This interpretation is supported by a recent finding by Qin et al. (1998) showing that removal of the palmitoylation site in _2a reversed several _2a-specific modulatory effects on _1C and _1E. Thus, the subcellular organization of isolated calcium channel complexes has a profound influence on the functional characteristics of the channel.

Dissociation of effects of the subunit on targeting of _1C and on calcium currents

The substitution of a single residue (Y467S) in the subunit interaction domain of _1C disrupted the formation and incorporation of _1C- complexes into the plasma membrane but not the modulatory effects of on calcium currents. Pragnell et al. (1994) identified a motif of nine conserved amino acids that is critical for binding the subunit, in the cytoplasmic loop between repeats I and II of the ₁ subunit. Mutations within this motif of _1A perturbed subunit binding (Pragnell et al. 1994). Here we have shown that _1CY467S and a coexpressed subunit did not colocalize in the plasma membrane but remained localized in distinct subcellular compartments. _1CY467S was concentrated in the endoplasmic reticulum, _1a and ₃ were diffusely distributed in the cytoplasm, and _2a was evenly distributed in the plasma membrane - all as when wild-type _1C and the subunits were expressed individually. Therefore we conclude that the stable association of _1CY467S and failed and that this had a dramatic effect on the incorporation of all subunits except _2a into the plasma membrane. Previously we have shown that the stable association of the skeletal _1S isoform and _1a can occur in the endoplasmic reticulum upon coexpression, as seen by translocation of _1a from the cytoplasm to the endoplasmic reticulum, and that this translocation fails when the subunit interaction domain in _1S is mutated at the corresponding tyrosine residue (Y366S) (Neuhuber et al. 1998b). Here we observed in some cells the colocalization of the cytoplasmic subunits with _1C (but not with _1CY467S) in the endoplasmic reticulum, indicating that in these cells the two subunits formed a complex but were not efficiently transported to the plasma membrane. Therefore, if the mutation in the cardiac _1CY467S subunit had not perturbed binding, we would expect to see the colocalization of _1CY467S and in the endoplasmic reticulum, even if the export of _1CY467S from the endoplasmic reticulum had failed for a reason other than the lack of _1C- complex formation; but instead _1CY467S and the subunits remained in distinct compartments. Moreover, _1CY467S expressed alone generated calcium currents of the same magnitude as wild-type _1C, indicating that _1CY467S is a fully functional channel. Thus, the lack of colocalization of _1CY467S and the subunits indicates that none of the three examined isoforms form stable complexes with the mutated _1CY467S subunit.

Nevertheless, the increase in current density, the modulation of current kinetics, and the increase in single-channel open probability upon coexpression of were equally observed with wild-type _1C and the mutant _1CY467S. This shows first that the increased plasma membrane localization of _1C, observed when _1C was coexpressed with , is not a prerequisite for the increased current density, and second that the stable association of ₁ with a subunit is not required for their functional interaction. Apparently, the majority of visible channels in the plasma membrane are not functional and unfortunately it cannot be unambiguously verified that the population of functional channels does not form complexes with the subunit as well. However, if the large visible fraction of _1CY467S channels fails to associate with subunits one can expect that the functional fraction will equally fail to do so and, consequently, their functional modulation by subunits most probably does not depend on the stable association of _1CY467S with a subunit. Our finding that upregulation of current density by is due to a mechanism other than the increased channel density, such as an increased channel open probability, is in agreement with several previous studies in which subunit-induced effects on single-channel properties have been reported (Neely et al. 1993; Wakamori et al. 1993; Shistik et al. 1995). In the present study we have shown an increase in dwell time and open probability of _1C and _1CY467S upon coexpression with _1a. Whereas the analysis of the number of functional channels per patch gave no indication of a strong increase on coexpression with , single-channel open probability increased about 7- to 8-fold - more than enough to explain the increase in whole-cell current density. Consequently, the simultaneously occurring increase of detectable channels in the plasma membrane must be a parallel but not causally linked effect of the subunit; only in this way can one fail without affecting the other. In a recent study in Xenopus oocytes, Yamaguchi et al. (1998) showed similar separate effects of ₃ on the functional modulation of _1C and on increased membrane incorporation. They achieved a temporal dissociation of the two effects by injecting a ₃ fusion protein into _1C-expressing oocytes and were able to block membrane incorporation without affecting subunit-induced modulation of current kinetics and voltage dependence. Together, the study by Yamaguchi et al. (1998) and the present study provide strong evidence for dual and independent roles of the accessory subunit in targeting and modulation of the ₁ subunit.

To what extent these functions contribute to the normal incorporation and function of the channels in the excitation-contraction coupling apparatus in muscle is not clear. Expression of the skeletal _1S isoform with the analogous mutation in the subunit interaction domain in skeletal myotubes of the dysgenic mouse also resulted in the disruption of _1S-_1a complexes, although without perturbing the specific targeting of _1S into the triads and the reconstitution of normal function (Neuhuber et al. 1998a). This is consistent with the interpretation of the results presented here that subunits can exert their functions without forming stable ₁- complexes. However, because in the muscle expression system calcium currents and excitation-contraction coupling could not be analysed in the absence of the endogenous subunit, functional modulation of calcium currents by could not be directly tested with _1S. Our present result that specific modulatory effects of three different subunits can all be observed with a mutated ₁ subunit (_1CY467S), which fails to colocalize with the isoforms, provides strong evidence that the formation of _1C- complexes is not required for functional interactions between the two calcium channel subunits.

Dual mode of _1C- interactions

We observed two effects of the subunit on _1C: an increased incorporation of _1C into the plasma membrane which is dependent on the formation of stable _1C- complexes, and the modulation of current properties which is independent of the formation of stable _1C- complexes. The subunit interaction domain in the cytoplasmic loop between repeats I and II of _1C is clearly responsible for the stable association of _1C and , and for the increased incorporation of the complex into the plasma membrane. In contrast, it may or may not be the site of functional _1C- interactions. Either the point mutation lowered the affinity of this subunit interaction domain on _1C or a second, low affinity interaction domain exists apart from that in the I-II linker. In either case high concentrations of free subunit in the cytoplasm or in the plasma membrane could interact with such a low affinity binding site and thus cause functional modulation without forming a stable complex. Distinct domains for the functional modulation of ₁ have been described on the subunit (Olcese et al. 1994; Cens et al. 1998). Furthermore, a second low affinity binding domain in _1E that mediates modulation of inactivation kinetics has been described (Walker et al. 1998). However, these results differ from the present data in that other functional effects of the subunit on _1E, like the increase in current amplitude, were mediated by the I-II linker, whereas in our study the loss of binding to the I-II linker of _1C did not perturb any modulatory effects of on current properties. Finally, it has been suggested that more than one subunit can interact simultaneously with different binding sites on the ₁ subunit. Our results are consistent with such a model in that structural and functional effects of subunit coexpression appeared to be independent. However, one can also envisage a mechanism for _1C- interactions by which binding of a subunit to the subunit interaction domain in the I-II linker brings into a position to interact with the functionally important residues on _1C, but that this binding is not necessarily required.

In all, the results of this study show that the subunits of calcium channels serve a dual function, firstly in the formation of a complex with _1C and its incorporation into the plasma membrane and secondly in the modulation of single-channel calcium current properties, but it also shows that these two functions of the subunit are independent of each other.

	REFERENCES

Top Abstract Introduction Methods Results Discussion References

Birnbaumer, L., Campbell, K. P., Catterall, W. A., Harpold, M. M., Hofmann, F., Horne, W. A., Mori, Y., Schwartz, A., Snutch, T. P. & Tanabe, T. (1994). The naming of voltage-gated calcium channels. Neuron 13, 505-506	[Medline]
Brice, N. L., Berrow, N. S., Campbell, V., Page, K. M., Brickley, K., Tedder, I. & Dolphin, A. C. (1997). Importance of the different subunits in the membrane expression of the 1A and 2 calcium channel subunits: studies using a depolarization-sensitive 1A antibody. European Journal of Neuroscience 9, 749-759	[Medline]
Castellano, A., Wei, X., Birnbaumer, L. & Perez-Reyes, E. (1993). Cloning and expression of a neuronal calcium channel subunit. Journal of Biological Chemistry 268, 12359-12366	[Abstract]
Cens, T., Restituito, S., Vallentin, A. & Charnet, P. (1998). Promotion and inhibition of L-type Ca2+ channel facilitation by distinct domains of the subunit. Journal of Biological Chemistry 273, 18308-18315	[Abstract/Full Text]
Chien, A. J., Carr, K. M., Shirokov, R. E., Rios, E. & Hosey, M. M. (1996). Identification of palmitoylation sites within the L-type calcium channel 2a subunit and effects on channel function. Journal of Biological Chemistry 271, 26465-26468	[Abstract/Full Text]
Chien, A. J., Zhao, X., Shirokov, R. E., Puri, T. S., Chang, C. F., Sun, D., Rios, E. & Hosey, M. M. (1995). Roles of membrane-localized subunit in the formation and targeting of functional L-type Ca2+ channels. Journal of Biological Chemistry 270, 30036-30044	[Abstract/Full Text]
De Waard, M., Pragnell, M. & Campbell, K. P. (1994). Ca2+-channel regulation by a conserved subunit domain. Neuron 13, 495-503	[Medline]
De Waard, M., Scott, V. E., Pragnell, M. & Campbell, K. P. (1996). Identification of critical amino acids involved in 1- interaction in voltage-dependent Ca2+ channels. FEBS Letters 380, 272-276	[Medline]
De Waard, M., Witcher, D. R., Pragnell, M., Liu, H. & Campbell, K. P. (1995). Properties of the 1- anchoring site in voltage-dependent Ca2+ channels. Journal of Biological Chemistry 270, 12056-12064	[Abstract/Full Text]
Flucher, B. E., Andrews, S. B., Fleischer, S., Marks, A. R., Caswell, A. H. & Powell, J. A. (1993). Triad formation: organization and function of the sarcoplasmic reticulum calcium release channel and triadin in normal and dysgenic muscle in vitro. Journal of Cell Biology 123, 1161-1174.	[Abstract]
Grabner, M., Dirksen, R. T. & Beam, K. G. (1998). Tagging with green fluorescent protein reveals a distinct subcellular distribution of L-type and non-L-type Ca2+ channels expressed in dysgenic myotubes. Proceedings of the National Academy of Sciences of the USA 95, 1903-1908	[Abstract/Full Text]
Gregg, R. G., Messing, A., Strube, C., Beurg, M., Moss, R., Behan, M., Sukhareva, M.,