HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dolphin, A. C. Articles by Perez-Reyes, E. Search for Related Content PubMed PubMed Citation Articles by Dolphin, A. C. Articles by Perez-Reyes, E.

The effect of 2- and other accessory subunits on expression and properties of the calcium channel 1G

A. C. Dolphin, C. N. Wyatt, J. Richards, R. E. Beattie *, P. Craig *, J.-H. Lee ¹, L. L. Cribbs ¹, S. G. Volsen * and E. Perez-Reyes ¹

MS 9320 Received 1 March 1999; accepted after revision 10 May 1999.

	ABSTRACT

Top Abstract Introduction Methods Results Discussion References

1. The effect has been examined of the accessory 2- and subunits on the properties of 1G currents expressed in monkey COS-7 cells and Xenopus oocytes.

2. In immunocytochemical experiments, the co-expression of 2- increased plasma membrane localization of expressed 1G and conversely, the heterologous expression of 1G increased immunostaining for endogenous 2-, suggesting an interaction between the two subunits.

3. Heterologous expression of 2- together with 1G in COS-7 cells increased the amplitude of expressed 1G currents by about 2-fold. This finding was confirmed in the Xenopus oocyte expression system. The truncated construct did not increase 1G current amplitude, or increase its plasma membrane expression. This indicates that it is the exofacial 2 domain that is involved in the enhancement by 2-.

4. 1b also produced an increase of functional expression of 1G, either in the absence or the presence of heterologously expressed 2-, whereas the other subunits had much smaller effects.

5. None of the accessory subunits had any marked influence on the voltage dependence or kinetics of the expressed 1G currents. These results therefore suggest that 2- and 1b interact with 1G to increase trafficking of, or stabilize, functional 1G channels expressed at the plasma membrane.

	INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

Voltage-dependent calcium channels and currents in native neurons and other cells have been divided into high voltage activated (HVA) and low voltage activated (LVA) (Carbone & Lux, 1984; Nowycky et al. 1985). LVA currents can be distinguished by their activation at smaller depolarizations, near to the resting potential, and by their rapid inactivation (Huguenard, 1996). At the single channel level, channels with a small unitary conductance activate over the same voltage range (Carbone & Lux, 1984). Native T-type channels are heterogeneous (Kobrinsky et al. 1994; Huguenard, 1996), suggesting that they comprise more than one subtype of channel. A new subfamily of voltage-dependent calcium channel 1 subunit genes (comprising 1G, 1H and 1I) has recently been cloned, whose structure is superficially similar to the previously cloned HVA 1 subunits A, B, C, D, E and S (Perez-Reyes et al. 1998; Cribbs et al. 1998; Lee et al. 1999), having four domains, each with a voltage sensor and a pore-forming P loop. However, there are a number of regions where the homology is very low, particularly in the intracellular linkers and the N and C termini. These novel channels, when expressed, form rapidly inactivating LVA currents that also have a small single channel conductance and slowly deactivating tail currents like native T-type currents (Carbone & Lux, 1984; Armstrong & Matteson, 1985). Recently, using an antisense approach, evidence has been obtained that T-type currents in primary sensory neurons are generated by the 1G, H and I family (Lambert et al. 1998).

The HVA channels are all thought to form heteromeric channels with the accessory subunits 2-, and possibly . The accessory subunits, particularly subunits, have marked effects on the assembly of functional channels at the plasma membrane. In expression systems, the subunits increase the number of plasma membrane channels (Chien et al. 1995; Shistik et al. 1995; Brice et al. 1997) and also affect the voltage dependence and kinetics of activation and inactivation (Jones et al. 1998). Inactivation kinetics are particularly affected by different subunits in a -dependent manner, with 2a producing a marked slowing of inactivation (De Waard & Campbell, 1995).

It has not yet been examined whether the expression of LVA channel 1 subunits requires any known accessory subunits for trafficking to the plasma membrane, or for functional expression, or whether these accessory subunits influence the biophysical properties of the expressed channels. There are notable structural differences when comparing the 1G, H and I sequence with those of HVA channels, one contrast being that the I-II loop of the LVA channels is very large. Furthermore, they do not contain the full consensus sequence identified to be the binding site for subunits on the I-II loop, the interaction domain (AID). This consensus sequence, QQ-E-D/EL-GY--WI---E, is present in all the HVA channels (Walker & De Waard, 1998). The homologous sequence in 1G is GSCYEE LLKYLVYILRKA, with identical residues underlined in bold, and a conserved charge in italics. However, in the C terminal part of the consensus sequence, the W is Y in 1G, a conservative substitution, compared with the WA mutation identifying this residue as essential for subunit binding (De Waard et al. 1996). Thus the degree of conservation of the consensus sequence may be sufficient for interaction.

The consensus site(s) on the exofacial loops of HVA 1 subunits to which the 2- subunit binds have not been identified, although repeat III of 1S has been found to associate with 2 (Gurnett et al. 1997). Furthermore, the extracellular region of is also involved in the production of certain functional effects, although the region of 1 with which it interacts is not known (Felix et al. 1997). Thus it is not possible to determine a priori whether 1G has the capacity to bind to 2-. This study was therefore designed to examine whether 1G is influenced by any accessory subunits.

	METHODS

Top Abstract Introduction Methods Results Discussion References

Materials

The rat 2-_b cDNA (accession number M86621) was obtained from either Dr H. Chin (NIH, Bethesda, MD, USA) or Dr T. Snutch (UBC, Vancouver, Canada), rat 1b (X11394) from Dr T. Snutch and mut-3 GFP (green fluorescent protein) from Dr T. Hughes (Yale, New Haven, CT, USA). Rat 2a (M80545), 3 (M88751) and 4 (M80545) cDNAs were also used.

Molecular biology

The 1G cDNA (Perez-Reyes et al. 1998) was subcloned into the vertebrate expression vector pMT2 (Genetics Institute, Cambridge, MA, USA) (Swick et al. 1992), using standard molecular biological techniques, and the correct orientation of the insert was verified by multiple restriction digests. All other cDNAs were expressed from the same vector for expression in monkey COS-7 cells. The subunit (Gurnett et al. 1996) was constructed by deletion of the 2 cDNA, using the plasmid pMT2-2- as a template. The forward primer was ATGGAAGAGGATGACTTCACAGCT, which binds at the beginning of the sequence, position 2995. The reverse primer was AGGGAAGGGCTCCTCGCTCGA, which binds at position 238, including only the signal sequence of 2. The PCR product of 6·1 kb was amplified using Pfu polymerase for 14 cycles, with the annealing temperature of 50°C for 30 s, and an extension temperature of 75°C for 13 min. This product was then treated with polynucleotide kinase and ligated to form the pMT2- construct, attached to the signal sequence of 2-, as described previously (Felix et al. 1997). The construct was sequenced for confirmation of its identity.

COS-7 cell expression

Cells were cultured and transfected by electroporation, essentially as described previously (Campbell et al. 1995a). The 1G, 2- or , and GFP cDNAs in the vector pMT2 were used at 15, 5, 5 and 1 µg per transfection, respectively. Blank pMT2 vector was included where necessary to maintain the total cDNA at 31 µg per transfection. In some experiments in which 1G was expressed alone, the additional pMT2 vector was omitted, with no effect on the current properties. Following transfection, cells were maintained at 37°C for about 60 h, and then replated using non-enzymatic cell dissociation medium (Sigma), and maintained at 25°C for between 2 and 8 h prior to electrophysiological recording, or for 1-2 h prior to fixation for immunocytochemistry.

Ba²⁺ currents were recorded using the whole cell patch-clamp technique. The internal and external solutions were similar to those described previously (Campbell et al. 1995b). The patch pipette solution contained (mM): caesium aspartate, 140; EGTA, 5; MgCl₂, 2; CaCl₂, 0·1; K₂ATP, 2; Hepes, 10; pH 7·2, 310 mosmol kg^-1 with sucrose. The external solution contained (mM): tetraethylammonium (TEA) bromide, 160; KCl, 3; NaHCO₃, 1·0; MgCl₂, 1·0; Hepes, 10; glucose, 4; BaCl₂, 1; pH 7·4, 320 mosmol kg^-1 with sucrose. Whole cell currents were elicited from a holding potential (V_h) of -100 mV and recorded using an Axopatch-1D amplifier. Data were filtered at 2-5 kHz and digitized at 10-20 kHz. The junction potential between external and internal solutions was 6 mV; the values given in the figures and text have not been corrected for this. Current records are shown following leak and residual capacitance current subtraction (P/8 protocol) and series resistance compensation up to 80 %. All experiments were performed at room temperature (20-24°C). Analysis was performed using pCLAMP 6 (Axon Instruments) and Origin 5 software (Microcal Software Inc., Northampton, MA, USA).

Xenopus oocyte expression

Oocytes were obtained from X. laevis (Xenopus One) using standard techniques (Leonard & Snutch, 1991), which have been approved by the Loyola University Animal Care Committee. Frogs were anaesthetized using 1 g l^-1 of tricaine, then oocytes were collected by making a 1 cm incision in the ventral abdomen and removing a portion of the ovary. The frog was sutured both on the rectus abdominus muscle sheath, and then on the skin. It was allowed to recover for 4 h before returning it to the home tank. Oocytes were prepared for microinjection as previously described (Leonard & Snutch, 1991).

Capped cRNA was synthesized using T7 RNA polymerase (Ambion). The rat 1G (Perez-Reyes et al. 1998) was contained in the vector pGEM-HEA. The rat brain 2-_b was contained in the vector pAGA. Each oocyte was injected with 5 ng of either 1G alone or plus 5 ng 2- cRNA in a volume of 50 nl. Oocytes were voltage clamped using a two-microelectrode voltage clamp amplifier (OC-725B, Warner Instrument Corp.). Voltage and current electrodes (1·5-1·8 M tip resistance) were filled with a cushion of 1 % agarose and 3 M KCl (Schreibmayer et al. 1994). The bath solution contained the following (mM): 10 BaCl₂, 36 tetraethyl ammonium, 2 CsCl₂ and 5 Hepes, adjusted to pH 7·4 with methanesulfonic acid. Data were filtered at 1 kHz and acquired at 4 kHz using the pCLAMP system (Digidata 1200 and pCLAMP 6.0). All data are expressed as the means ± S.E.M. and statistical analysis was performed using Student's t test.

Immunocytochemistry

COS-7 cells were washed twice in Tris-buffered saline (TBS; 154 mM NaCl, 20 mM Tris, pH 7·4), then fixed in 4 % paraformaldehyde in TBS as described (Brice et al. 1997). The cells were permeabilized in 0·02 % Triton X-100 in TBS, and incubated with blocking solution (20 % (v/v) goat serum, 4 % (w/v) bovine serum albumin (BSA), 0·1 % (w/v) dl-lysine in TBS). The cells were incubated for 14 h at 4°C with the appropriate primary antibody diluted 1: 500 in 10 % goat serum, 2 % BSA, 0·05 % dl-lysine. The VDCC 2 antibody used in this study was raised in rabbits against a specific peptide derived from the sequence of 2. Its specificity has been described previously (Brickley et al. 1995; Brice et al. 1997). The 1G antibody was raised in rabbits against a glutathione S transferase (GST) fusion protein derived from the cytoplasmic loop between IS6 and IIS1of 1G, as described in Craig et al. (1999), in which the antibody specificity is also described. The anti-GST component of the serum was removed by adsorption on GST Sepharose 4B, and it was then affinity purified on 1G-GST Sepharose 4B. The stock concentration of affinity-purified 1G antibody was 98 µg ml^-1. The primary antibodies were detected using biotin-conjugated goat anti-rabbit IgG (1: 200) (Sigma), then streptavidin FITC (1:100) (Molecular Probes, Eugene, OR, USA). Cells were examined on an MRC 1024 laser scanning confocal microscope (Bio-Rad, Hemel Hempstead, UK), with all parameters (gain, aperture) identical between experiments. Images represent 2 µm optical sections midway through the cell. Quantification was performed using Imagequant software (Molecular Dynamics, Sunnyvale, CA, USA), and results are given, following background subtraction, as arbitrary units (a.u.) of pixel density.

	RESULTS

Top Abstract Introduction Methods Results Discussion References

The effect of co-expression of 2- on the immunolocalization of 1G

COS-7 cells represent an expression system with a very low background in terms of expressed currents. No Ba²⁺ currents were detected in the absence of expressed 1 subunits (Berrow et al. 1997; Brice et al. 1997; Meir & Dolphin, 1998). However, by RT-PCR using primers conserved across all species whose sequences have been reported, we found evidence for a low level of mRNA for 1G/H/I, 2- and 3 (J. Richards and A. C. Dolphin, unpublished results), but immunocytochemistry and Western blotting showed no subunit protein in untransfected cells (Campbell et al. 1995a; Berrow et al. 1997; Brice et al. 1997; Stephens et al. 1997). A very low level of 1G immunostaining was observed in untransfected control cells, but this was not localized to the plasma membrane (Fig. 1A; pixel density throughout cell, 5·5 ± 0·8 a.u., of which none was membrane associated, n = 10). Expression of 1G resulted in much greater immunostaining for 1G, largely at the plasma membrane (Fig. 1B; pixel density at plasma membrane, 30·8 ± 4·4 a.u., n = 10). Co-expression of 2- with 1G resulted in a further increase in staining intensity at the plasma membrane (Fig. 1C; pixel density at plasma membrane, 42·0 ± 5·1 a.u., n = 10, a 36·4 % increase). No staining was observed in the absence of the primary antibody (Fig. 1D). These results suggest that heterologously expressed 2- is either increasing translation of 1G, increasing its trafficking to the plasma membrane, or increasing its stability. This raises the possibility that since endogenous 2- is present in cells, it may be involved in trafficking heterologously expressed 1G when 1G is expressed alone.

		View larger version [in this window] [in a new window]
Figure 1. Effect of co-expression of 2- on immunolocalization of expressed 1G in COS-7 cells A, 1G immunolocalization in untransfected COS-7 cells; B, 1G immunolocalization in cells transfected with 1G; C, 1G immunolocalization in cells transfected with 1G + 2-. D, lack of immunofluorescence in the absence of the primary antibody. Experiments were performed under identical conditions in parallel cultures, and repeated 3 times with similar results. Scale bar, 20 µm.

Properties of 1G expressed in COS-7 cells

The heterologous expression of 1G alone in COS-7 cells resulted in the observation of T-type currents, using 1 mM Ba²⁺ as the charge carrier, in a large proportion (usually > 70 %) of GFP-positive cells (Fig. 2A and Table 1). The peak current was observed between -30 and -20 mV. The inactivation kinetics were voltage dependent at small depolarizations, reaching a voltage-independent minimum at potentials above -30 mV (Fig. 3A and Table 1). Recovery from inactivation occurred with a time constant of 107 ms (Fig. 3B). The voltage for 50 % activation (V₅₀) was -27 mV, and the V₅₀ for inactivation was -73 mV (Fig. 4 and Table 1). Superimposition of the activation and steady-state inactivation relationships showed no clear window current (inset in Fig. 4B).

		View larger version [in this window] [in a new window]
Figure 2. I-V relationships for 1G and the effect of accessory subunits in COS-7 cells A shows 1G ± 2- and B shows 1G/1b ± 2-. The left and centre panels show representative traces of 1G currents without (left) or with (centre) co-expression of 2-. Currents are shown in response to voltage steps (V) from -100 mV to between -70 and -20 mV, in 5 mV steps. The right panels show the corresponding I-V relationships (means ± S.E.M. ) for the numbers of experiments given in parentheses.

		View larger version [in this window] [in a new window]
Figure 3. Inactivation kinetics of 1G currents: effect of accessory 2- subunits in COS-7 cells A, the inactivation phase of individual currents was fitted to a single exponential, and the mean values were plotted for 1G () and 1G/2- (), for the numbers of experiments given in parentheses. B, recovery from inactivation was determined using the protocol shown in the inset, which depicts 13 overlaid traces obtained at 30 s intervals. The Vh was -100 mV. A 50 ms test step was given to -20 mV (Imax), followed by a 50 ms step to +100 mV to produce complete inactivation, followed by a variable interpulse interval (t), and a subsequent identical test step (It). The recovery from inactivation was plotted for 1G () and 1G/2- (), for the numbers of experiments given in parentheses. The data points were fitted to single exponentials (dotted lines), with values of 122·6 ms for 1G and 125·1 ms for 1G/2-.

Table 1. Biophysical properties of 1G, expressed with different accessory subunit combinations in COS-7 cells

Transfected subunits	IBa at -0 mV (pA pF-1)	Gmax (nS pF-1)	inact at -20 mV (ms)	V50 for activation (mV)	V50 for steady-state inactivation (mV)
1G	-19·2 ± 3·1 (15)	0·55 ± 0·07 (15)	13·8 ± 1·3 (7)	-27·1 ± 2·7 (10)	-72·9 ± 1·3 (8)
1G/2-	-40·3 ± 6·2 ** (17)	0·75 ± 0·08 * (17)	13·1 ± 0·3 (6)	-27·3 ± 1·8 (8)	-69·7 ± 1·1 (6)
1G/1b	-39·8 ± 3·8 ** (5)	0·87 ± 0·07 ** (5)	14·2 ± 1·0 (5)	-22·3 ± 4·5 (5)	-68·7 ± 5·6 (4)
1G/2-/1b	-39·5 ± 4·9 ** (9)	0·79 ± 0·09 ** (9)	13·6 ± 0·4 (4)	-27·4 ± 3·8 (3)	-72·0 ± 2·6 (5)
1G/2a	-27·3 ± 5·6 (9)	0·67 ± 0·09 * (9)	11·7 ± 0·6 (3)	-22·3 ± 1·0 (3)	-69·4 ± 2·0 (5)
1G/3	-30·7 ± 3·2 * (11)	0·65 ± 0·06 (11)	20·3 ± 2·1 (11)	-17·0 ± 2·2 * (8)	-65·5 ± 3·0 * (8)
1G/4	-23·8 ± 2·2 (6)	0·62 ± 0·04 (6)	12·9 ± 1·8 (5)	-20·7 ± 1·2 * (5)	-67·3 ± 2·5 ** (4)

		View larger version [in this window] [in a new window]
Figure 4. Voltage dependence of activation and inactivation of 1G currents in COS-7 cells: effect of accessory subunits A, the current activation plots were determined from tail current amplitudes using the protocol shown in the inset, and normalized to the maximum current. Although this protocol, with a step length of 7·5 ms, gives a small error at low depolarizations because the current is not completely activated, this did not affect the V50 values. Mean ± S.E.M. values are shown for 1G (), 1G/2- (), 1G/4 (), with the numbers of experiments shown in the key. For both A and B, the curves are fits to the Boltzmann equation described in the legend to Table 1. B, steady-state inactivation curves were determined by measurement of peak current amplitude at -20 mV, following a 10 s conditioning prepulse to the potentials shown. Data were normalized before averaging the number of experiments given in the key. The symbols are the same as for A. The inset graph shows the region of overlap between the 1G and 1G/2- activation and steady-state inactivation curves.

The effect of co-expression of 2- on the properties of 1G currents in COS-7 cells

Co-expression with 2- significantly increased the 1G current density at -20 mV by 2·1-fold, and increased the maximum conductance, compared with that for 1G alone (Fig. 2A and Table 1), while not significantly affecting any of the kinetic parameters measured (Figs 2A and 3A and Table 1). The kinetics of inactivation were very similar for 1G and 1G/2-, reaching identical voltage-independent minima above -30 mV (Fig. 3A and Table 1). The recovery from inactivation also followed an identical time course (Fig. 3B). Furthermore, the reversal potential (Fig. 2A) was not significantly increased by 2- (+29·0 ± 2·3 mV, n = 15, for 1G compared with +34·3 ± 2·7 mV, n = 19, for 1G/2-). The voltage dependence of activation (Fig. 4A) and the steady-state inactivation (Fig. 4B) of 1G were also not significantly affected by co-expression of 2- (Table 1). However, there was a small change in the value of the slope factor, k, of the Boltzmann fits to the activation data (evident from Fig. 4A), which was 9·1 ± 0·5 mV (n = 10) for 1G and 7·5 ± 0·5 mV (n = 8) for 1G/2-.

In control experiments no calcium channel currents were observed in cells transfected with 2- alone, or with 2- plus a subunit (results not shown), indicating that these accessory subunits are not recruiting an endogenous 1 subunit, as we also concluded in a previous work (Meir & Dolphin, 1998).

The effect of co-expression of 2- on the properties of 1G currents expressed in Xenopus oocytes

Co-injection of 2- with 1G cRNA in Xenopus oocytes increased the peak currents at -20 mV from -493 ± 60 nA for 1G alone to -784 ± 79 nA for 1G/2- (P < 0·05, n = 40 from 4 separate experiments; Fig. 5). The average enhancement of the 1G current by 2- from these four experiments was 1·7 ± 0·2-fold. The shape of the current- voltage (I-V) relationship was not affected by co-injection with 2-, as determined following normalization of the peak currents. There was also no effect on the voltage dependence of current activation, determined from I-V relationships (for 1G the V₅₀ for activation was -31·6 ± 0·6 mV, n = 40, and for 1G/2- it was -32·2 ± 0·3 mV, n = 40). Activation kinetics were not affected ( at -20 mV was 1·9 ms for both), and neither were inactivation kinetics (_inact at -20 mV was 11·1 ± 0·3 ms, n = 8, for 1G and 10·0 ± 0·4 ms, n = 9, for 1G/2-). Furthermore, injection of 2- had no significant effect on the voltage dependence of steady-state inactivation as measured with 10 s conditioning prepulses (the V₅₀ for steady-state inactivation was -63·8 ± 0·3 mV, n = 10, for 1G and -62·6 ± 0·5 mV, n = 14, for 1G/2-). All the data in oocytes were therefore in full agreement with the results from COS-7 cells.

		View larger version [in this window] [in a new window]
Figure 5. Effect of 2- on 1G expression in Xenopus oocytes The left and centre panels show representative families of 1G currents recorded at between -60 and -10 mV in Xenopus oocytes in the absence (left) and presence (centre) of heterologously expressed 2-. The I-V relationships on the right represent the mean ± S.E.M. values from 40 experiments (10 oocytes from 4 different experiments) for 1G (), and 1G + 2 ().

Does heterologously expressed 1G associate with endogenous 2-?

Since 2- co-expression with 1G results in an increase in 1G immunostaining at the plasma membrane and an increase in functional expression, it is possible that 1G, when expressed alone, associates with endogenous 2-. We have observed a low level of endogenous 2 immunostaining in untransfected control cells (Fig. 6A; total pixel density of 38·2 ± 6·3 a.u., n = 14, from 3 separate transfection experiments), and this was not associated with the plasma membrane in most cells. The total staining for endogenous 2 was significantly increased when 1G cDNA was transfected into the cells (Fig. 6B; pixel density 82·7 ± 11·9 a.u., n = 19, P < 0·01 compared with untransfected cells), and the staining always showed some membrane association, indicating an association between the two proteins. These results suggest that expression of 1G is able to increase expression or stabilize endogenous 2-, and also increase membrane association of endogenous 2-.

		View larger version [in this window] [in a new window]
Figure 6. Effect of 1G on immunolocalization of endogenous 2- in COS-7 cells A, immunolocalization of endogenous 2 in untransfected COS-7 cells; B, immunolocalization of endogenous 2 in cells transfected with 1G. Experiments were performed under identical conditions in parallel cultures, and transfections were repeated 3 times with similar results.

Since these immunocytochemical results suggested that transfected 1G was associating with endogenous 2-, co-expression experiments were also performed with the construct, which has been found to influence some properties of 1C and 1A, but unlike 2- does not increase the current amplitude (Gurnett et al. 1996; Felix et al. 1997). When the -construct was expressed in COS-7 cells, clear immunostaining was observed at the plasma membrane (results not shown), using an antibody directed against an extracellular epitope in (Brickley et al. 1995). Co-expression of 1G with reduced the plasma membrane expression of 1G by 25 %, from immunocytochemical experiments (pixel density 22·8 ± 1·8 a.u., n = 10, for 1G/ compared with 30·8 ± 4·4 a.u. (n = 10) for 1G expressed alone in parallel experiments). The expression level for 1G when co-expressed with represents a 45·5 % reduction compared with co-expression of 1G with full-length 2-. In agreement with this, in electrophysiological experiments, co-expression of with 1G did not produce any increase in the expression of 1G currents, unlike 2-. The current density for 1G/ was 22·1 ± 3·2 pA pF^-1 at -20 mV, and the conductance was 0·49 ± 0·04 nS pF^-1 (n = 8). This result indicates that it is the 2 moiety of 2- that is responsible for the 1G current enhancement, in agreement with the results for 1C (Gurnett et al. 1996).

Effect of co-expression of subunits on the properties of 1G currents in COS-7 cells

Co-expression of 1G with the subunit 1b (Fig. 2B and Table 1) increased the 1G current density without significant effect on the reversal potential, which was +31·1 ± 1·9 mV (n = 5). In contrast, for co-expression of 2a, 3 or 4 with 1G, only a small current enhancement was observed (Table 1). Additional co-expression of 2- produced no further increment of current density for 1b (Table 1). There was no systematic effect of subunits on the inactivation kinetics of 1G currents, the limiting _inact at -20 mV being similar for all subunit combinations (Table 1). There was also no effect of any subunit on recovery from inactivation (results not shown). Co-expression with any one of the subunits produced a small depolarization of the voltage dependence of activation of 1G, determined from tail current amplitudes (see Fig. 4A for 4). The voltage for 50 % activation (V₅₀) was only depolarized significantly by 3 and 4 (Table 1). Similarly, the steady-state inactivation of 1G, measured after a 10 s conditioning potential step, was shifted to more depolarized potentials by co-expression of the subunits 3 and 4 (Table 1 and, for 4, Fig. 4B). In control experiments, 1b did not induce calcium channel currents when expressed alone in COS-7 cells (results not shown).

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

Effect of co-expression of accessory 2- subunits on 1G expression

From the literature, diverse effects of 2- have been reported on the properties of cloned HVA channels. Many studies of the effects of accessory subunits have been performed using oocytes, before it was realized that they contain endogenous calcium channel subunits, including a Xenopus 3 subunit (Tareilus et al. 1997). Therefore, although the effect of 2- has been reported to increase the membrane expression of HVA 1 subunits, and to increase their open probability (Shistik et al. 1995; Gurnett et al. 1996) as well as shifting the voltage dependence of activation to more positive potentials (Qin et al. 1998), these effects may have been dependent on the presence of endogenous subunits (Tareilus et al. 1997), and for 1A the effect of 2- is small in the absence of co-expressed subunits. In HEK293 cells 2- produced a small increase in the density of 1E currents, but had no effect on the biophysical properties (Jones et al. 1998), whereas in COS-7 cells we observed 2-, in the absence of , to shift activation of 1E to more positive potentials, while having very little effect on current density (Stephens et al. 1997). In both cell types, 2- was ineffective alone in targeting 1C or 1A to the plasma membrane (Brice et al. 1997; Gao et al. 1999). A recent report has shown that a novel 2- (2-3) produces a similar enhancement of 1C and 1E current amplitudes to 2-1 (the 2- used in the current study), but these effects are only evident in the additional presence of a subunit (Klugbauer et al. 1999).

We have previously reported that we could not detect mRNA for 2- in COS-7 cells (Berrow et al. 1997), but since these experiments were performed, additional 2- sequences have been reported, and using PCR primers conserved across species, we have now observed a faint PCR product in COS-7 cells of the size expected for 2- (results not shown). Consistent with this, we have also observed a low level of immunostaining for endogenous 2-, which, however, was not specifically plasma membrane associated (Fig. 6A). We have examined the effect of co-expression of 2- on immunostaining for heterologously expressed 1G, and observed a clear increase in 1G immunostaining at the plasma membrane (Fig. 1). Furthermore, the effect of heterologous expression of 1G on immunostaining for endogenous 2- was also studied, since we found previously that 2- was trafficked to the plasma membrane by HVA calcium channel 1/ combinations (Brice et al. 1997). We consistently found that immunostaining for endogenous 2- was greater in cells transfected with 1G than in untransfected cells, and that the staining was more plasma membrane associated, suggesting that 1G may be associating with, and stabilizing, endogenous 2- and also trafficking it to the plasma membrane. We still observed 1G currents when 1G was co-expressed with a truncated construct, lacking the 2 domain, but the current amplitude was not enhanced as it was with 2-, indicating that the extracellular 2 domain is required for current enhancement, in accord with previous results for 1C (Gurnett et al. 1996). In further agreement with this, 1G immunostaining was slightly reduced by , in contrast to the enhancement produced by 2-, again indicating the importance of the 2 moiety in this effect. The subunit acted as a 'dominant negative' in previous studies, reducing the effect of 2- on 1A expression (Gurnett et al. 1996). However, in the present study co-expression of with 1G did not prevent the expression of 1G currents, indicating either that it was not able to disrupt 1G interaction with endogenous 2-, or that such an interaction was not essential for functional expression of 1G currents. It therefore remains unclear whether the presence of endogenous 2- is essential for the expression of functional 1G channels, and in the future an antisense approach might be taken to deplete endogenous 2-, in order to answer this point.

In the present study, overexpression of exogenous 2- produced an approximately 2-fold increase in the amplitude of 1G currents in COS-7 cells, and a 1·7-fold increase in Xenopus oocytes, but had no effect on their kinetics or voltage dependence of activation or inactivation, or on recovery from inactivation in either system. This argues either for an effect of 2- on trafficking of the nascent 1G channels from the endoplasmic reticulum to the plasma membrane, or an effect to stabilize the plasma membrane channels in a functional conformation. Further studies at the single channel level will be necessary to determine whether there are effects on the open probability of the channels.

In a previous study, we have shown that overexpression of 2-, in undifferentiated NG108-15 cells, induced the appearance of an HVA sustained current. It is likely that this current component represented L-type current that had a very low open probability in the absence of 2-, as a similar component could also be induced by the L-type channel agonist Bay K8644 (Wyatt et al. 1998), and the induced HVA current was blocked by the L-type channel antagonist, nicardipine (C. N. Wyatt and A. C. Dolphin, unpublished results). There were no marked effects of 2- on the biophysical properties of the T-type current component itself, in terms of kinetics or voltage dependence (Wyatt et al. 1998), consistent with the observation made here. However, it should be noted that NG108-15 cells express substantial endogenous 2- at the plasma membrane.

Effect of co-expression of accessory subunits on 1G expression

In the present study we have shown that co-expression of the subunit, 1b, also has clear effects on expression of functional 1G current (Brice et al. 1997). In contrast, a recent antisense study in nodose ganglia concluded that native T-type channels were not associated with subunits (Lambert et al. 1997), although in these cells the main subunits observed were 2 and 3, with no 1 apparently present. However an antisense study in cardiac atrial cells has suggested that loss of subunits may affect expression of T-type currents (Chen & Best, 1998). The consensus binding site for subunits, which has been identified on the I-II loop of HVA 1 subunits, is not completely conserved in 1G (Perez-Reyes et al. 1998). While it has been suggested that there is another region on the C terminus, at least of 1E and 1A (Tareilus et al. 1997; Walker et al. 1998), to which certain subunits may bind, it has been disputed whether this has any functional consequences for the biophysical properties (Jones et al. 1998). It is therefore possible that 1G may interact transiently with the 1b subunit, which may serve a chaperone function to traffic the 1G channel protein to the plasma membrane, or to stabilize the 1G once in the membrane, thus increasing current density, while having only minor effects on the biophysical characteristics of the channels. The finding that the effects of 1b and 2- were not additive in COS-7 cells suggests that they may be acting by a similar chaperone or stabilizing mechanism. We have observed that all subunits increase the membrane expression of 1A (Brice et al. 1997), whereas it has been found that 1b was the only subunit that increased the heterologous expression of 1S in Xenopus oocytes (Ren & Hall, 1997). We were unable to perform experiments on 1G/ interactions in Xenopus oocytes because subunits stimulate the expression of endogenous oocyte calcium channels (Lacerda et al. 1994), making the results uninterpretable. This problem does not arise in COS-7 cells, as endogenous currents were not detected in these cells. It is of interest that a jellyfish 1 subunit has recently been cloned which also has only a rudimentary binding motif (HMLDDAVKGYLDWINQAS, again with conserved residues in bold, and conserved charges in italics). This channel is also able to express in the absence of subunits, and co-expression of a subunit has also been reported to increase expression (Jeziorski et al. 1998).

For the HVA channels, all subunits shift the voltage dependence of activation of the currents to more hyperpolarized potentials, with 4 producing the greatest effect for 1A, and all subunits producing a similar effect for 1E (De Waard & Campbell, 1995; Jones et al. 1998). In contrast, the trend in the present study was for subunits to shift the voltage dependence of activation of 1G to more depolarized potentials, although the depolarization of the V₅₀ for activation was only statistically significant for 3 and 4. It remains to be determined whether these subtle effects on the biophysical properties of 1G are due to direct interaction with the 1G protein.

The effect of all subunits, except 2a, is to cause an increase in the inactivation rate of HVA channels, and to shift the steady-state inactivation to more hyperpolarized potentials (Stephens et al. 1997; Walker & De Waard, 1998), the effect being particularly marked for 3 (Jones et al. 1998). In contrast, rat 2a, which is palmitoylated, produces an attenuation of inactivation of HVA currents and a shift of steady-state inactivation to more depolarized potentials (De Waard & Campbell, 1995; Costantin et al. 1998; Jones et al. 1998). No such effects were observed for 2a on 1G currents. This is in agreement with our previous study in which we investigated the effect of overexpression of subunits on the properties of native T-type currents, expressed in isolation in undifferentiated NG108-15 cells (Wyatt et al. 1998). 2a, but not 1b, induced the appearance of a slowly inactivating HVA component of current, but neither had any effect on the biophysical properties of the T-type component. Similarly, it has recently been shown that antisense depletion of subunits in nodose ganglia had no effect on the biophysical properties of the native T-type currents in these cells (Lambert et al. 1997). However, overexpression in Xenopus oocytes of either 2 or 4 slowed inactivation of an endogenous T-type current which had a single channel conductance of 9 pS (Lacerda et al. 1994). Part of the effect of 2 was attributed in this paper to an effect on channel assembly, stability or trafficking, in agreement with the role suggested here. It is also possible that the single channels observed by Lacerda et al. (1994) represent a small conductance mode of HVA channels, with properties very similar to T-type channels (Meir & Dolphin, 1998).

Conclusion

We have observed a clear effect of 2- on the amount of 1G channel protein expressed at the plasma membrane, and on the amplitude of the 1G current expressed in COS-7 cells and Xenopus oocytes. In reciprocal experiments we have also observed that 1G increased endogenous 2- plasma membrane expression in COS-7 cells. This provides several lines of evidence that 1G can interact with 2-. Nevertheless, from our results and those of others, it appears that 1G is able to form functional channels in the absence of co-expressed accessory subunits. However, as Xenopus oocytes (Singer-Lahat et al. 1992) and most cell lines used for expression studies, including COS-7 cells (present work) and HEK-293 cells (J. Richards and A. C. Dolphin, unpublished results), contain endogenous 2- subunits, this requires further study before it can be considered definitive.

	REFERENCES

Top Abstract Introduction Methods Results Discussion References

Armstrong, C. M. & Matteson, D. R. (1985). Two distinct populations of calcium channels in a clonal line of pituitary cells. Science 227, 65-67	[Medline]
Berrow, N. S., Brice, N. L., Tedder, I., Page, K. & Dolphin, A. C. (1997). Properties of cloned rat 1A calcium channels transiently expressed in the COS-7 cell line. European Journal of Neuroscience 9, 739-748	[Medline]
Brice, N. L., Berrow, N. S., Campbell, V., Page, K. M., Brickley, K., Tedder, I. & Dolphin, A. C. (1997). Importance of the different subunits in the membrane expression of the 1A and 2 calcium channel subunits: studies using a depolarisation-sensitive 1A antibody. European Journal of Neuroscience 9, 749-759	[Medline]
Brickley, K., Campbell, V., Berrow, N., Leach, R., Norman, R. I., Wray, D., Dolphin, A. C. & Baldwin, S. (1995). Use of site-directed antibodies to probe the topography of the 2 subunit of voltage-gated Ca2+ channels. FEBS Letters 364, 129-133	[Medline]
Campbell, V., Berrow, N., Brickley, K., Page, K., Wade, R. & Dolphin, A. C. (1995a). Voltage-dependent calcium channel -subunits in combination with 1 subunits have a GTPase activating effect to promote hydrolysis of GTP by Go in rat frontal cortex. FEBS Letters 370, 135-140	[Medline]
Campbell, V., Berrow, N. S., Fitzgerald, E. M., Brickley, K. & Dolphin, A. C. (1995b). Inhibition of the interaction of G protein Go with calcium channels by the calcium channel -subunit in rat neurones. The Journal of Physiology 485, 365-372	[Abstract]
Carbone, E. & Lux, H. D. (1984). A low voltage-activated fully inactivating Ca channel in vertebrate sensory neurones. Nature 310, 501-502	[Medline]
Chen, C. C. & Best, P. M. (1998). An antisense oligonucleotide targeting four subunit genes inhibits the expression of both T and L type calcium currents in cultured atrial myocytes. Biophysical Journal 74, M-Pos350 (abstract).
Chien, A. J., Zhao, X. L., Shirokov, R. E., Puri, T. S., Chang, C. F., Sun, D., Rios, E. & Hosey, M. M. (1995). Roles of a membrane-localized subunit in the formation and targeting of functional L-type Ca2+ channels. Journal of Biological Chemistry 270, 30036-30044	[Abstract/Full Text]
Costantin, J., Noceti, F., Qin, N., Wei, X. Y., Birnbaumer, L. & Stefani, E. (1998). Facilitation by the 2a subunit of pore openings in cardiac Ca2+ channels. The Journal of Physiology 507, 93-103	[Abstract/Full Text]
Craig, P. J., Beattie, R. E., Folly, E. A., Banerjee, M. D., Reeves, M. B., Priestley, J. V., Carney, S. L., Sher, E., Perez-Reyes, E. & Volsen, S. G. (1999). Distribution of the voltage-dependent calcium channel 1G subunit mRNA and protein throughout the mature rat brain. European Journal of Neuroscience (in the Press).
Cribbs, L. L., Lee, J.-H., Yang, J., Satin, J., Zhang, Y., Daud, A., Barclay, J., Williamson, M. P., Fox, M., Rees, M. & Perez-Reyes, E. (1998). Cloning and characterization of 1H from human heart, a member of the T type Ca2+ channel gene family. Circulation Research 83, 103-109	[Abstract/Full Text]
de Waard, M. & Campbell, K. P. (1995). Subunit regulation of the neuronal 1A Ca2+ channel expressed in Xenopus oocytes. The Journal of Physiology 485, 619-634	[Abstract]
de Waard, M., Scott, V. E. S., Pragnell, M. & Campbell, K. P. (1996). Identification of critical amino acids involved in 1- interaction in voltage-dependent Ca2+ channels. FEBS Letters 380, 272-276	[Medline]
Felix, R., Gurnett, C. A., De Waard, M. & Campbell, K. P. (1997). Dissection of functional domains of the voltage-dependent Ca2+ channel 2 subunit. Journal of Neuroscience 17, 6884-6891	[Abstract/Full Text]
Gao, T. Y., Chien, A. J. & Hosey, M. M. (1999). Complexes of the 1C and subunits generate the necessary signal for membrane targeting of class C L-type calcium channels. Journal of Biological Chemistry 274, 2137-2144	[Abstract/Full Text]
Gurnett, C. A., de Waard, M. & Campbell, K. P. (1996). Dual function of the voltage-dependent Ca2+ channel 2 subunit in current stimulation and subunit interaction. Neuron 16, 431-440	[Medline]
Gurnett, C. A., Felix, R. & Campbell, K. P. (1997). Extracellular interaction of the voltage-dependent Ca2+ channel 2 and 1 subunits. Journal of Biological Chemistry 272, 18508-18512	[Abstract/Full Text]
Huguenard, J. R. (1996). Low-threshold calcium currents in central nervous system neurons. Annual Review of Physiology 58, 329-348	[Abstract]
Jeziorski, M. C., Greenberg, R. M., Clark, K. S. & Anderson, P. A. V. (1998). Cloning and functional expression of a voltage-gated calcium channel 1 subunit from jellyfish. Journal of Biological Chemistry 273, 22792-22799	[Abstract/Full Text]
Jones, L. P., Wei, S. K. & Yue, D. T. (1998). Mechanism of auxiliary subunit modulation of neuronal 1E calcium channels. Journal of General Physiology 112, 125-143	[Abstract/Full Text]
Klugbauer, N., Lacinova, L., Marais, E., Hobom, M. & Hofmann, F. (1999). Molecular diversity of the calcium channel 2- subunit. Journal of Neuroscience 19, 684-691	[Abstract/Full Text]
Kobrinsky, E. M., Pearson, H. A. & Dolphin, A. C. (1994). Low- and high-voltage-activated calcium channel currents and their modulation in the dorsal root ganglion cell line ND7-23. Neuroscience 58, 539-552	[Medline]
Lacerda, A. E., Perez-Reyes, E., Wei, X., Castellano, A. & Brown, A. M. (1994). T-type and N-type calcium channels of Xenopus oocytes: Evidence for specific interactions with subunits. Biophysical Journal 66, 1833-1843	[Abstract]
Lambert, R. C., McKenna, F., Maulet, Y., Talley, E. M., Bayliss, D. A., Cribbs, L. L., Lee, J.-H., Perez-Reyes, E. & Feltz, A. (1998). Low-voltage-activated Ca2+ currents are generated by members of the CaVT subunit family (1G/H) in rat primary sensory neurons. Journal of Neuroscience 18, 8605-8613	[Abstract/Full Text]
Lambert, R. C., Maulet, Y., Mouton, J., Beattie, R., Volsen, S., De Waard, M. & Feltz, A. (1997). T-type Ca2+ current properties are not modified by Ca2+ channel subunit depletion in nodosus ganglion neurons. Journal of Neuroscience 17, 6621-6628	[Abstract/Full Text]
Lee, J.-H., Daud, A. N., Cribbs, L. L., Lacerda, A. E., Pereverzev, A., Klockner, U., Schneider, T. & Perez-Reyes, E. (1999). Cloning and expression of a novel member of the low voltage activated T type calcium channel family. Journal of Neuroscience 19, 1912-1921	[Abstract/Full Text]
Leonard, J. P. & Snutch, T. P. (1991). The expression of neurotransmitter receptors and ion channels in Xenopus oocytes. IRL Press, Oxford.
Meir, A. & Dolphin, A. C. (1998). Known calcium channel 1 subunits can form low threshold, small conductance channels, with similarities to native T type channels. Neuron 20, 341-351	[Medline]
Nowycky, M. C., Fox, A. P. & Tsien, R. W. (1985). Three types of neuronal calcium channel with different calcium agonist sensitivity. Nature 316, 440-446	[Medline]
Perez-Reyes, E., Cribbs, L. L., Daud, A., Lacerda, A. E., Barclay, J., Williamson, M. P., Fox, M., Rees, M. & Lee, J.-H. (1998). Molecular characterization of a neuronal low-voltage-activated T type calcium channel. Nature 391, 896-900	[Medline]
Qin, N., Olcese, R., Stefani, E. & Birnbaumer, L. (1998). Modulation of human neuronal 1E-type calcium channel by 2-subunit. American Journal of Physiology 274, C1324-133	[Medline]
Ren, D. & Hall, L. M. (1997). Functional expression and characterization of skeletal muscle dihydropyridine receptors in Xenopus oocytes. Journal of Biological Chemistry 272, 22393-22396	[Abstract/Full Text]
Schreibmayer, W., Lester, H. A. & Dascal, N. (1994). Voltage clamping of Xenopus laevis oocytes utilizing agarose cushion electrodes. Pflügers Archiv 426, 453-458	[Medline]
Shistik, E., Ivanina, T., Puri, T., Hosey, M. & Dascal, N. (1995). Ca2+ current enhancement by 2/ and subunits in Xenopus oocytes: Contribution of changes in channel gating and 1 protein level. The Journal of Physiology 489, 55-62	[Abstract]
Singer-Lahat, D., Lotan, I., Itagaki, K., Schwartz, A. & Dascal, N. (1992). Evidence for the existence of RNA of Ca2+-channel 2/ subunit in Xenopus oocytes. Biochimica et Biophysica Acta 1137, 39-44	[Medline]
Stephens, G. J., Page, K. M., Burley, J. R., Berrow, N. S. & Dolphin, A. C. (1997). Functional expression of rat brain cloned 1E calcium channels in COS-7 cells. Pflügers Archiv 433, 523-532	[Medline]
Swick, A. G., Janicot, M., Cheneval-Kastelic, T., McLenithan, J. C. & Lane, D. M. (1992). Promoter-cDNA-directed heterologous protein expression in Xenopus laevis oocytes. Proceedings of the National Academy of Sciences of the USA 89, 1812-1816	[Abstract]
Tareilus, E., Roux, M., Qin, N., Olcese, R., Zhou, J. M., Stefani, E. & Birnbaumer, L. (1997). A Xenopus oocyte subunit: Evidence for a role in the assembly/expression of voltage-gated calcium channels that is separate from its role as a regulatory subunit. Proceedings of the National Academy of Sciences of the USA 94, 1703-1708	[Abstract/Full Text]
Walker, D., Bichet, D., Campbell, K. P. & de Waard, M. (1998). A 4 isoform-specific interaction site in the carboxyl-terminal region of the voltage-dependent Ca2+ channel 1A subunit. Journal of Biological Chemistry 273, 2361-2367	[Abstract/Full Text]
Walker, D. & De Waard, M. (1998). Subunit interaction sites in voltage-dependent Ca2+ channels. Trends in Neurosciences 21, 148-154	[Medline]
Wyatt, C. N., Page, K. M., Berrow, N. S., Brice, N. L. & Dolphin, A. C. (1998). The effect of overexpression of auxiliary calcium channel subunits on native Ca2+ channel currents in undifferentiated NG108-15 cells. The Journal of Physiology 510, 347-360

Acknowledgements

We thank Professor C. Hopkins of the Laboratory of Molecular Cell Biology, University College London for access to the confocal microscope. This work was supported by a Wellcome Trust grant to A. C. D. and an NIH grant (HL57828) to E. P. R. We thank N. Balaguero for technical support.

Corresponding author

A. C. Dolphin: Department of Pharmacology, University College London, Gower Street, WC1E 6BT, UK.

Email: a.dolphin{at}ucl.ac.uk

Authors' present addresses

J. Richards: Department of Biochemistry, Imperial College, London, UK.

C. N. Wyatt: Department of Physiology, Oxford University, UK.

This article has been cited by other articles:

				H. W. Tedford and G. W. Zamponi Direct G Protein Modulation of Cav2 Calcium Channels Pharmacol. Rev., December 1, 2006; 58(4): 837 - 862. [Abstract] [Full Text] [PDF]

				S.-N. Yang and P.-O. Berggren The Role of Voltage-Gated Calcium Channels in Pancreatic {beta}-Cell Physiology and Pathophysiology Endocr. Rev., October 1, 2006; 27(6): 621 - 676. [Abstract] [Full Text] [PDF]

				H. Khosravani and G. W. Zamponi Voltage-gated calcium channels and idiopathic generalized epilepsies. Physiol Rev, July 1, 2006; 86(3): 941 - 966. [Abstract] [Full Text] [PDF]

				S. J. Dubel, C. Altier, S. Chaumont, P. Lory, E. Bourinet, and J. Nargeot Plasma Membrane Expression of T-type Calcium Channel {alpha}1 Subunits Is Modulated by High Voltage-activated Auxiliary Subunits J. Biol. Chem., July 9, 2004; 279(28): 29263 - 29269. [Abstract] [Full Text] [PDF]

				J. Li, L. Stevens, N. Klugbauer, and D. Wray Roles of Molecular Regions in Determining Differences between Voltage Dependence of Activation of CaV3.1 and CaV1.2 Calcium Channels J. Biol. Chem., June 25, 2004; 279(26): 26858 - 26867. [Abstract] [Full Text] [PDF]

				Y. Zhang, A. P. Vilaythong, D. Yoshor, and J. L. Noebels Elevated Thalamic Low-Voltage-Activated Currents Precede the Onset of Absence Epilepsy in the SNAP25-Deficient Mouse Mutant Coloboma J. Neurosci., June 2, 2004; 24(22): 5239 - 5248. [Abstract] [Full Text] [PDF]

				A. SPAT and L. HUNYADY Control of Aldosterone Secretion: A Model for Convergence in Cellular Signaling Pathways Physiol Rev, April 1, 2004; 84(2): 489 - 539. [Abstract] [Full Text] [PDF]

				J. Brill, R. Klocke, D. Paul, D. Boison, N. Gouder, N. Klugbauer, F. Hofmann, C.-M. Becker, and K. Becker entla, a Novel Epileptic and Ataxic Cacna2d2 Mutant of the Mouse J. Biol. Chem., February 20, 2004; 279(8): 7322 - 7330. [Abstract] [Full Text] [PDF]