|
|
||||||||
MS 0586 Received 19 January 2000; accepted after revision 15 September 2000.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The Na+-Ca2+ exchanger is an integral membrane protein and is involved in calcium homeostasis in many cell types. Specifically in cardiac cells, the Na+-Ca2+ exchanger plays a central role in Ca2+ signalling. It is responsible for extruding Ca2+ that enters through Ca2+ channels during systole and may also be involved in triggering the Ca2+ transient during contraction (Leblanc & Hume, 1990; Bers, 1991; Blaustein et al. 1991; Lipp & Niggli, 1994; Mattiello et al. 1998). Additionally, the Na+-Ca2+ exchanger affects the duration of the cardiac action potential (Le Guennec & Noble, 1994; Harrison & Boyett, 1995; Dipla et al. 1999; Gaughan et al. 1999). Recently the abundance and subcellular distribution of the Na+-Ca2+ exchanger has been found to be altered in various cardiac diseases (Barnes et al. 1997; Dilly et al. 1997; Dipla et al. 1999; Gaughan et al. 1999). In dilated cardiomyopathy and in coronary artery diseases in human, the amounts of both the messenger RNA and protein of the Na+-Ca2+ exchanger were increased in heart muscle (Studer et al. 1994) with subcellular re-distribution noted in heart failure (Dilly et al. 1997). The Na+-Ca2+ exchanger appears to play a different but important role in the kidney where it contributes to the control of Ca2+ reabsorption (Gesek & Friedman, 1992, 1993; White et al. 1996). The distinct functions of the cardiac and renal Na+-Ca2+ exchanger are paralleled by different expressed isoforms found in these cells (Kofuji et al. 1993). The Na+-Ca2+ exchanger is found on the surface and in T-tubule membranes on all cardiac myocytes (Dilly et al. 1997). In the kidney, the exchanger is found in the majority of cells in the connecting tubules (Reilly et al. 1993).
The Na+-Ca2+ exchanger proteins are encoded by three genes, NCX1, NCX2 and NCX3 in mammals (Nicoll et al. 1990, 1996; Li et al. 1994). NCX1 was cloned in 1990 (Nicoll et al. 1990) and we and others have shown that the transcripts of this gene are expressed broadly in many tissues (Kofuji et al. 1993, 1994; Quednau et al. 1997). Transcripts for recently cloned genes NCX2 and NCX3 have been found only in skeletal muscle and brain tissue (Quednau et al. 1997). The NCX1 gene transcript in mammals has been shown to undergo alternative splicing of six internal exons: A, B, C, D, E and F. Exons A and B were shown to be mutually exclusive and the other four exons were cassette-type exons (Kofuji et al. 1994). The isoforms produced from the NCX1 gene are distributed in a tissue-specific manner raising the question that there could be functional differences among isoforms (Kofuji et al. 1993; Nakasaki et al. 1993; Lee et al. 1994; Dyck et al. 1999). We and others have demonstrated that heart muscle contains a specific dominant isoform containing exons ACDEF of NCX1 (NCX1.1) (Kofuji et al. 1993, 1994; Quednau et al. 1997). In contrast, the kidney contains a different dominant isoform of NCX1 that contains exons, BD (NCX1.3) (Kofuji et al. 1993). To examine functional differences of NCX1 isoforms using a common system, we studied rat cardiac and renal isoforms by expressing them individually in Xenopus oocytes. The responses of these two Na+-Ca2+ exchanger isoforms to changes in membrane potential, intracellular calcium and protein kinase A activation were studied. A preliminary report of this work has been presented (Ruknudin et al. 1998a).
| METHODS |
|---|
|
|
|---|
Construction of full-length rat NCX1 containing the cardiac isoform
The full-length rat renal Na+-Ca2+ exchanger has been cloned as described previously (He et al. 1998). This clone of the predominant isoform expressed in the kidney (containing alternatively spliced exons B and D) was used to engineer the cardiac isoform for study. Experimental procedures were approved by the Animal Care and Use Committee of Medical School, University of Maryland and conformed to national guidelines. Briefly, the rats were injected with pentobarbital intraperitoneally. After the rats were anaesthetized, the hearts were removed and total RNA was extracted. Total rat cardiac RNA purified by CsCl centrifugation was transcribed with oligo-dT and MMLV reverse transcriptase (Gibco BRL, Grand Island, NY, USA) to make cDNA. The cDNA was amplified with a 5' primer (ACGGATCCTCTGCGATTGCTT GTCTCGG, bold sequence complementary to NCX1, nt 1600-1619) and a 3' primer (GTCGGATCCAATGATCACTTC CAGCTTG, nt 2187-2205). Amplification was performed in Biosycler PCR machine (Bios Corporation, New Haven, CT, USA) as follows: initial denaturation at 94°C for 3 min, followed by 30 cycles at 65°C for 1 min, at 72°C for 1 min, and at 94°C for 45 s. The PCR product and the full-length renal NCX1 clone in pBluescript KSII vector (Stratagene, CA, USA) were individually digested with two restriction enzymes, BstEII and NarI. The large fragment from the digested NCX1 renal clone was purified by agarose electrophoresis and was ligated with the digested PCR products. Sequence analysis confirmed that a full-length clone contained exons A, C, D, E and F in place of the renal exons B and D. This plasmid in KSII containing the full-length cardiac sequence was digested with XhoI and KpnI and subcloned into the pSD64TF vector. Both the cardiac and renal isoforms present in the pSD64TF vector were used to produce RNA for expression in Xenopus laevis oocytes.
Engineering a 3' VSV tag onto the Na+-Ca2+ exchanger molecule
To be able to follow the protein, we added a vesicular stomatis virus (VSV) epitope tag to the Na+-Ca2+ exchanger using a three fragment ligation method. The full-length Na+-Ca2+ exchanger in pSD64TF vector was digested with Bsp120L and KpnI to remove the 3' end of the coding sequence. Using appropriate primers the second fragment was generated by PCR containing the Bsp120L restriction site to the end of the coding region, a five amino acid hinge before the stop codon and a new restriction site, SfiI. The third fragment was recovered from digestion of a human ezrin cDNA clone (Algrain et al. 1993) and contained the VSV epitope between the sites SfiI and KpnI. After ligation of the three fragments and subcloning, sequence analysis confirmed that the clone contains the full-length sequence of the NCX1 with a five amino acid hinge followed by eleven amino acid VSV epitope. cRNA made from this clone did not show any difference in function when expressed in oocytes from the wild-type NCX1 clones.
RNA preparation and injection into oocytes
The two full-length rat NCX1 cDNAs were linearized by digesting with SalI and complementary RNA (cRNA) was synthesized using SP6 mMessage mMachine kit (Ambion, Austin, TX, USA) for both cardiac (containing exons ACDEF) or renal (containing exons BD) NCX1. Oocytes were harvested by partial ovarectomy and isolated using collagenase (Ruknudin et al. 1997). The frogs were anaesthetized using benzocaine (Sigma) for the surgery and were humanely killed after the final collection. The isolated oocytes were maintained in modified L15 media at 16°C. cRNA (10-50 ng) was injected into stage V and VI oocytes using a microinjector (Drummond Scientific Co. Broomall, PA, USA). The oocytes were checked for the removal of the follicle layer before they were used for subsequent experiments 2-5 days after injection.
Measurement of the Na+-Ca2+ exchanger current
The two-electrode voltage-clamp method was employed to measure currents in Xenopus oocytes (Tang et al. 1995). The microelectrodes pulled in horizontal puller P84 (Sutter Instruments) filled with 3 M KCl were used for current passage and voltage recording. The reference electrodes were Ag-AgCl wires immersed in a glass pipette filled with 3 M KCl. The tip of the pipette was plugged with 3 M KCl agar to minimize changes in liquid junction potentials that might occur when changing solutions and placed downstream from the oocyte. Voltage steps were generated by pCLAMP software (Axon Instruments) which controlled the command voltage of the voltage-clamp feedback circuit (Oocyte Clamp OC-725C, Warner Instruments, Hamden, CT, USA). Recordings were displayed on a HAMEG storage oscilloscope. Data were acquired and stored simultaneously by a microcomputer (Gateway 2000-Pentium-133 MHz) interfaced with pp-50 LAB analog-to-digital converting system (Warner Instruments).
During the voltage clamping of oocytes, the voltage was held at -70 mV, since the reversal potential of the Na+-Ca2+ exchanger was calculated to be -76·82 mV assuming the stoichiometry of 3Na+:1Ca2+ and the ion concentrations to be (mM): 100 [Na+]o, 10 [Na+]i, 2 [Ca2+]o and 0·0001 [Ca2+]i. Using the amplifier, the voltage was stepped from -70 mV to -60 mV for a short period of 100 ms (for leak subtraction) from the holding potential. A series of 1 s voltage pulses from the holding potential -70 mV to voltages between -80 and 60 mV were applied. This protocol was used to produce a current-voltage relationship. A different procedure was used to produce the RPP or 'repeated pulse protocol'. The RPP involves a series of eight depolarizing pulses of 1 s duration from -70 mV to +60 mV. The time between consecutive pulses was fixed for a series of eight pulses at one of five values: 1, 2, 4, 8 or 16 s. A complete series of currents was measured for analysing the effect of RPP. Analysis of results was performed using Clampfit (Axon Instruments).
The oocytes were preincubated with 100 µM ouabain in a Na+-solution (containing 90 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, 5 mM Hepes, pH 7·5) for a minimum of 30 min prior to the experiment. Immediately before the experiment, the bathing solution was changed to one of the two chloride-free solutions containing ouabain. One solution contained Na+ and had the following composition (mM): NaOH 100, CsOH 20, CaCO3 2, Mg(OH)2, tetraethylammonium hydroxide 20, Hepes 20, ouabain 0·25, Ba(OH)2 2, 3-[N-morpho]inopropane sulfonic acid 100, pH 7·4. The other was Na+ free using N-methyl D-glucamine instead of Na+. These bath solutions were used to eliminate the endogenous calcium-activated chloride current and to reduce any contamination from endogenous K+ current during measurement of Na+-Ca2+ exchanger activity (Trac et al. 1997). The perfusion bath had a volume of 500 µl and a constant flow rate of 2 ml min-1 was maintained to enable rapid solution change during current measurement. All chemical agents used in this study were purchased from Sigma. The forskolin was dissolved in ethanol while A23187, IBMX and KT5720 (KT) (LC Laboratories, Wobum, MA, USA) were dissolved in DMSO. The current measurements were done at room temperature (
22°C).
PKA regulation of NCX1 isoforms expressed in Xenopus oocytes and in rat ventricular cardiomyocytes
Na+-dependent 45Ca2+ influx was measured at 32°C (Ruknudin et al. 1997). The oocytes were pre-incubated for 30 min in 90 mM Na+ solution containing 0·5 mM ouabain (90 mM NaCl, 30 mM CaCl2, 250 mM MgCl2, 5 mM Hepes, pH 7·5). Then the solution was changed to either 0 Na+ (90 mM KCl replaces NaCl) or 90 mM Na+ solution, both containing 10 mCi ml-1 45CaCl2. After 20 min the oocytes were washed and 45CaCl2was counted. To block Na+-Ca2+ exchanger activity, 5 mM NiCl2 was added to 0 Na+ solution. To activate PKA, a cAMP-dependent protein kinase-activating cocktail (10 µM forskolin, 100 µM N6,2'-O-dibutyryl adenosine 3'5'-cyclic monophosphate and 100 µM 3 isobutyl-1-methylxanthine) was added to the 90 mM Na+ preincubating solution and this cocktail has been previously used by us and others to phosphorylate cystic fibrosis transmembrane regulator protein (Ruknudin et al. 1998b). To inhibit PKA activity, the cells were preincubated in 90 mM Na+ solution containing 1 µM KT (Kase et al. 1987) for 2 h before the oocytes were switched to PKA activating cocktail.
The ventricular myocytes from adult rat were prepared according to Gomez et al. (1997) and the cells were studied in modified Tyrode's solution containing (mM): NaCl 144, CaCl2 1, MgCl2 2, dextrose 11, Hepes-Tris 10, pH 7·4. The amount of Ca2+ uptake through the Na+-Ca2+ exchanger was estimated by adding 3·4 µCi ml-1 of 45CaCl2. To inhibit Ca2+ channels present in ventricular myocytes, verapamil (10 µM) was added to the solutions during Ca2+ influx measurement and Ca2+ uptake was measured for 10 min. All other conditions were similar to oocyte experiments. The results were calculated as means ± S.E.M. with n values representing the number of oocytes. Statistical significance between two points was determined by either Student's paired or unpaired t test.
Immunoprecipitation and in vitro phosphorylation
The oocytes (
50) were frozen in liquid nitrogen and homogenized using a microhomogenizer (Kontes Glass) in 200 µl of solubilization buffer composed of 50 mM Tris (pH 7·4), 10 mM EDTA, 4 % SDS and protease inhibitors (50 µg ml-1 PMSF, 1 mM iodoacetamide, 1 µM pepstatin, 2 mg ml-1 leupeptin, 1000 units ml-1 aprotinin and 1 mM 1,10-phenonthroline). While homogenizing the oocytes, 600 µl of immunoprecipitation buffer containing 190 mM NaCl, 6 mM EDTA, 50 mM Tris (pH 7·4) and 2·5 % Triton X-100 was added. Undissolved cell fragments were removed by centrifugation at 1000 g for 10 min at 4°C. The supernatant was concentrated 3-fold using Microcon-50 (Millipore) and mixed with NCX antibody (Swant, Switzerland). The antigen-antibody complex was precipitated by mixing with protein-A sepharose beads (Sigma). The complex was washed in immunowash buffer containing 150 mM NaCl, 6 mM EDTA, 50 mM Tris (pH 7·4), 0·1 % Triton X-100 and 0·02 % SDS. Phosphorylation was performed by incubation of the pellet with 1 µg of the catalytic subunit of PKA (PKA-CS reconstituted in 5 mM dithiothreitol) and 10 µCi of [
-32P]ATP (3000 Ci mmol-1) in phosphorylation buffer for 10 min at 37°C. In some experiments, PKA inhibitor (Sigma, USA) was included along with PKA catalytic subunit. The reaction was stopped by adding 1 ml of stop buffer (50 mM sodium phosphate buffer pH 7·4, 50 mM KF, 75 mM NaCl, 2·5 mM EDTA, 0·01 % NaN3 and 25 mM Tris pH 7·4) (Ivanina et al. 1994). Samples were heated to 75°C for 3 min in gel loading buffer containing 100 mM dithiothreitol and analysed on 8 % polyacrylamide gels. The proteins from the gel were transferred to nitrocellulose membrane (Amersham Pharmacia Biotech) and exposed to Kodak XOMAT-AR at -80°C. The nitrocellulose membrane containing the proteins was identified with VSV-antibody (MBL, MA, USA) and visualized using ECL kit (Amersham Pharmacia Biotech). The images were obtained using Kodak Biomax-MR film. The images of 110 kDa protein in the autoradiograph and chemiluminescent films were quantified using a GelExpert densitometer (NucleoTech).
| RESULTS |
|---|
|
|
|---|
Measuring the Na+-Ca2+ exchanger current in oocytes expressing mammalian NCX1
Using Xenopus oocytes injected with isoform-specific NCX1 mRNA, voltage-dependent current was measured in 100 mM Na+o and upon changing to 0 mM Na+o (Fig. 1A and B). These oocytes were preincubated with 100 µM ouabain for 30 min to ensure a high intracellular Na+ level. In Na+-containing Cl--free solutions, clear differences in outward currents were observed as shown in Fig. 1A and B. This Na+-sensitive outward current is INaCa. Thus the Na+-Ca2+ exchanger current, INaCa, was measured as a difference current (Fig. 1C and D). Addition of Ni2+ (4 mM) blocked INaCa and water-injected oocytes produced no significant INaCa (Fig. 1D). From these experiments we conclude that the Na+-Ca2+ exchanger functions appropriately for this transporter and is consistent with the findings of others (Kimura et al. 1986; Nicoll et al. 1990; Matsuoka et al. 1993).
![]() |
View larger version [in this window] [in a new window] |
|
|
A, voltage protocol (top) and current measured (bottom) from a Na+-loaded Xenopus oocyte expressing the cardiac isoform of the Na+-Ca2+ exchanger measured in the presence of 100 mM [Na+]o. B, current traces from the same oocyte 2 min after changing to Na+-free solution. C, subtraction of the current records shown in A from B. The difference current is the Na+-Ca2+ exchanger current, INaCa. D, the current-voltage (I-V ) relationships of the cardiac Na+-Ca2+ exchanger obtained from the cell shown in A-C ( | ||
Ca2+-activated chloride current (ICa,Cl) is reported in Xenopus oocytes by several investigators (Trac et al. 1997). To test whether or not such ICa,Cl contaminated our results, we examined outward currents in control and NCX1 cRNA-injected oocytes that were permeabilized by the Ca2+ ionophore A23187. These oocytes produced similar outward currents in Cl--free, Na+-free solutions in the absence and presence of 2 mM Ca2+ (data not shown).
Voltage dependence of cardiac and renal isoforms
The relative voltage dependence of INaCa for cardiac and renal isoforms are plotted in Fig. 1E. Significant differences in the voltage dependence of INaCa for cardiac and renal isoforms were observed as shown in Fig. 1E over the voltage range -25 to +50 mV (P < 0·01). Each data set was fitted by an exponential revealing a doubling of current every 25·8 mV for heart and every 19·5 mV for kidney as shown in Fig. 1E (P < 0·01). The difference between the voltage dependence of the NCX1 isoforms is better seen in the log plot of the data (Fig. 1F). The linear regression fit of the data gives a slope of 0·038 and 0·046 for the cardiac and renal isoforms, respectively, and they are significantly different (P < 0·001). Since the only difference in the two isoforms is the alternatively spliced region, we conclude that the alternatively spliced (AS) region influences the Na+-Ca2+ exchanger function and appears to increase the voltage sensitivity of the renal isoform (see Discussion).
Differential response to the repeated pulse protocol (RPP) by cardiac and renal isoforms of NCX1
Successive depolarizations to +60 mV with a 1 s interval between depolarizations revealed increasing INaCa as shown in Fig. 2A and B for both the cardiac and the renal isoforms, respectively. Longer intervals (16 s) between depolarizations showed no increase in successive pulses (Fig. 2C and D). The pattern of such differences depended on the NCX1 isoform expressed in the oocytes (Fig. 2E and F). This distinction can be seen best in Fig. 2G which shows a fractional increase of INaCa for the cardiac and the renal isoforms while water-injected oocytes showed no increase (Fig. 2H). As INaCa produces outward current, it brings Ca2+ into the cell that presumably activates INaCa through the catalytic site on the Na+-Ca2+ exchanger (Matsuoka et al. 1992). The increased outward current with successive depolarizations presumably reflects this activation. To test the hypothesis that the Ca2+ transported by the Na+-Ca2+ exchanger was responsible for the increase in current during RPP experiments, the RPP experiments were repeated with 10 mM extracellular Ba2+ instead of 2 mM Ca2+. The Na+-Ca2+ exchanger current was observed in the Ba2+ solutions as seen by others (Trac et al. 1997) (Fig. 3A and B). However, the increase in outward current with successive depolarization was reduced significantly (Fig. 3C). Additionally there was little difference in the responses for cardiac and renal isoforms, particularly at t = 16 s (see Fig. 3C). These results support our hypothesis that the difference in cardiac and renal INaCa reflects a greater sensitivity of the renal isoform to be activated by intracellular Ca2+.
![]() |
View larger version [in this window] [in a new window] |
|
|
A, RPP (see inset and Methods) was used to generate current responses for t = 1 s in oocytes expressing the cardiac NCX1 isoform. Currents from depolarizing episodes N = 1-8 are shown. B, same as A but with oocyte expressing the renal isoform of NCX1. C, same as A but t = 16 s. D, same as C but with oocyte expressing the renal isoform of NCX1. E, plot of currents for t = 1 s, t = 2 s and t = 16 s for RPP experiment as a function of episode number, N = 1-8. F, same as E but with oocyte expressing renal isoform of NCX1. G, averaged results for the increase in current, as a fractional increase, from N = 1-8 are shown for cardiac (filled symbols, n = 10) and renal (open symbols n = 10) Na+-Ca2+ exchanger. Signal-averaged responses for episodes t = 1 s (squares) to t = 16 s (circles) are shown. Asterisks denote significant difference between the cardiac and renal isoforms of NCX1 (P < 0·001). H, same as E and F but with oocyte injected with water (no RNA). | ||
![]() |
View larger version [in this window] [in a new window] |
|
|
A, the repeated pulse protocol (RPP) was used to generate current responses in oocyte expressing the cardiac isoform of NCX1. Plots of the current for t = 1 s and t = 16 s as a function of episode number N = 1-8 are shown. B, same as in A but with oocyte expressing the renal isoform of NCX1. C, the increase in current, as a multiple of baseline, for N = 1-8 are shown for cardiac (filled symbols, n = 8) and renal (open symbols, n = 8) Na+-Ca2+ exchanger isoforms. Continuous and dashed lines show data from Fig. 2G (Ca2+) for comparison. Asterisks denote significant difference between the current in the presence of Ca2+ and the current in the presence of Ba2+ (P < 0·001). | ||
Phosphorylation enhances the activity of the cardiac isoform of NCX1
45Ca2+ uptake by the oocytes expressing the cardiac isoform of NCX1 was enhanced 40 % upon removal of Na+o when preincubated with the cocktail to activate the PKA pathway (Fig. 4A) in oocytes. KT5720 (KT), which is known to block PKA-dependent phosphorylation (Kase et al. 1987), abolished the PKA-induced increase in Na+-dependent 45Ca2+ uptake. The oocytes expressing the predominant renal isoform of NCX1 did not show any increase in 45Ca2+ uptake when PKA was activated, suggesting that the effect of PKA activation is isoform specific (Fig. 4A). Water-injected oocytes did not show any significant Na+-dependent 45Ca2+ uptake. We also determined whether PKA activation can enhance the activity of the Na+-Ca2+ exchanger in native cardiomyocytes. The Na+-dependent 45Ca2+ uptake by the adult ventricular cardiomyocytes was enhanced after incubating with the cocktail to activate PKA and the increase was blocked in cells treated with KT (Fig. 4B). The Na+-dependent 45Ca2+ uptake was Ni2+ sensitive. Thus we find that the phosphorylation affects the cardiac isoform of NCX1 in cardiomyocytes as it does in Xenopus oocytes.
![]() |
View larger version [in this window] [in a new window] |
|
|
A, 45Ca2+ uptake over a 20 min period was measured in Na+-loaded oocytes expressing NCX1 after reducing [Na+]o to 0 mM. PKA activity was enhanced with a cocktail of IBMX, dibutyryl cAMP and forskolin. KT5720 (1 µM) was added to the cocktail where indicated (KT). 45Ca2+ uptake by the oocytes in the presence and absence of PKA cocktail was compared and 45Ca2+ uptake in PKA-treated oocytes in the presence and absence of KT5720 was also shown. Double asterisks indicate a significant difference, P < 0·01, n = 6. B, 45Ca2+ uptake for a period of 10 min after depolarizing the adult rat ventricular cardiomyocytes in 0 Na+, 144 mM K+. All solutions contained 100 µM ouabain and 10 µM nifedipine including solutions used for the 30 min pretreatment. Ni2+ (4 mM) was added with 0 Na+, 144 mM K+ solution in some experiments. The PKA cocktail (see A) was added in 0 Na+, 144 mM K+ solution, and in some experiments KT (1 µM) was also added. 45Ca2+ uptake by the cardiomyocytes in the presence and absence of Ni2+ was compared and 45Ca2+ uptake in PKA-treated cardiomyocytes in the presence and absence of KT5720 was also shown. Double asterisks indicate significant differences, P < 0·001 (n = 6). C, INaCa from oocyte-expressing cardiac Na+-Ca2+ exchanger before ( | ||
PKA activation alters voltage-dependent NCX1 current for the cardiac isoform only
The oocytes expressing the cardiac isoform of NCX1 displayed a time-dependent increase in INaCa amplitude following PKA activation (Fig. 4C and D). The increase in INaCa following stimulation of the PKA pathway was observed at all potentials positive to -50 mV (Fig. 4C and D). The INaCa of the renal isoform did not increase following activation of the PKA pathway, consistent with the results of 45Ca2+ uptake studies (Fig. 4E).
PKA-CS phosphorylates the Na+-Ca2+ exchanger in vitro
To investigate whether the Na+-Ca2+ exchanger could be directly phosphorylated, the Na+-Ca2+ exchanger protein expressed in oocytes was precipitated by NCX antibody and analysed using SDS-PAGE. Analysis of equal amounts of total protein in SDS-PAGE showed several protein bands in uninjected and in injected oocytes expressing cardiac and renal isoforms (Fig. 5A). The cardiac and renal isoforms of NCX1 protein precipitated by the NCX antibody could be identified by the VSV antibody as a 110 kDa band in Western blots (Fig. 5B). Incubation of the cardiac isoform of Na+-Ca2+ exchanger protein from the oocytes was immunoprecipitated by NCX-antibody and heavily phosphorylated in the presence of [
32P]ATP and PKA-CS. The quantification of the Western blots and autoradiograph images showed that when equal amounts of protein were detected in Western blots (Fig. 5B), the cardiac isoform of the Na+-Ca2+ exchanger was phosphorylated more than the renal isoform (Fig. 5C) When PKA inhibitor was used, the phosphorylation of cardiac and renal isoforms was blocked (Fig. 5D). These results suggest that the Na+-Ca2+ exchanger can be directly phosphorylated in vitro by PKA-CS. When data from multiple experiments were analysed, a significant difference in the ability to phosphorylate the cardiac Na+-Ca2+ exchanger was noted when compared to the renal isoform of the Na+-Ca2+ exchanger (Fig. 5E).
![]() |
View larger version [in this window] [in a new window] |
|
|
A, SDS-PAGE of the total proteins (10 µg) from oocytes which were the uninjected (U), cardiac (C) or renal (R) isoform cRNA injected. The gel was stained with coomassie blue. The molecular mass markers in kDa (M) are indicated. B, Western blot of the Na+-Ca2+ exchanger protein immunoprecipitated by NCX antibody. The 110 kDa fraction was identified by VSV antibody in lanes 2 and 3 (C and R). The immunoglobulins used for immunoprecipitation appear as a thick band at ~50 kDa. The uninjected control oocytes did not show any Na+-Ca2+ exchanger protein in lane 1 (U). C, autoradiograph of the Na+-Ca2+ exchanger protein showing the phosphorylation by PKA in vitro. The control oocytes (U) are shown in lane 1. The oocytes were injected with cardiac (lane 2) and renal isoform cRNAs (lane 3). The Na+-Ca2+ exchanger protein was phosphorylated in vitro using a catalytic subunit of PKA and [ | ||
| DISCUSSION |
|---|
|
|
|---|
We have demonstrated that the cardiac and the renal isoforms of NCX1 differ functionally. By expressing the cardiac and the renal isoforms of the Na+-Ca2+ exchanger in Xenopus oocytes, we observed that the voltage dependence and the [Ca2+]i sensitivity of the cardiac isoform are different when compared to the renal isoform. Moreover, cAMP-dependent phosphorylation selectively increases the activity of the cardiac isoform when expressed in Xenopus oocytes as it does in native cardiomyocytes. We conclude that these differences in the Na+-Ca2+ exchanger function are due only to the differences in the alternatively spliced region of the protein.
Significance of tissue-specific expression of Na+-Ca2+ exchanger isoforms
Renal and cardiac cells express different isoforms of the Na+-Ca2+ exchanger (Kofuji et al. 1993) which are produced by alternative splicing of a single NCX1 gene (Kofuji et al. 1994). The distribution of the Na+-Ca2+ exchanger isoforms is tissue specific (Lee et al. 1994; Quednau et al. 1997) and this has been confirmed by others in various tissues (Reilly & Shugrue, 1992; Nakasaki et al. 1993; Lee et al. 1994; Quednau et al. 1997). The isoforms that contain exon A are generally found in excitable cells (e.g. heart muscle, neurons, skeletal muscle) while exon B-containing isoforms are found primarily in other tissues (e.g. kidney, liver, lung). This report demonstrates functional differences in representative examples of these two groups of isoforms (e.g. cardiac, containing exons ACDEF, versus renal, containing exons BD).
Voltage dependence of the Na+-Ca2+ exchange current
Voltage-dependent transport. While several studies have previously demonstrated that the Na+-Ca2+ exchanger is voltage dependent (Lauger, 1987; Matsuoka & Hilgemann, 1992; Niggli & Lipp, 1994), there are at least three ways for the electric field across the membrane containing the Na+-Ca2+ exchanger to influence ion transport. (1) The field could affect the local [Na+] or [Ca2+] within the voltage field. This influence is limited to the region of the cell affected by the voltage field (i.e. close to the membrane). (2) The field could apply a distorting force on the membrane containing the Na+-Ca2+ exchanger. It may consequently alter the kinetics of transport by altering interactions between the protein and the membrane. (3) The field could apply a force directly on the charged regions of the Na+-Ca2+ exchanger protein thereby altering the kinetics of transport. Although there are clear reasons to expect changes in membrane voltage to affect the Na+-Ca2+ exchanger transport, here we provide the first demonstration that isoform differences affect the voltage-dependent features of the Na+-Ca2+ exchanger.
Differences between cardiac and renal isoforms. In the present study, we measured the current-voltage relationship of the Na+-Ca2+ exchange for cardiac and renal isoforms of NCX1. Over the measured membrane voltage range, the voltage dependence of the cardiac isoform differed significantly from that of the renal isoform. A doubling of the INaCa current occurred every 25·8 mV and 19·5 mV for cardiac and renal isoforms, respectively. The slopes of the current-voltage relationships for the cardiac and renal isoforms showed a statistically significant difference. How does this occur? The only difference between these two isoforms is in the alternatively spliced region which is located near the C-terminal of the putative intracellular loop. Because we do not know how the Na+-Ca2+ exchanger protein folds or what regions interact, there are many parts of the protein that could interact with the alternatively spliced region (see Fig. 6). If the alternatively spliced region interacts directly or indirectly with a region in the voltage field across the membrane, then changes in the alternatively spliced region may affect the voltage dependence of the Na+-Ca2+ exchanger. Since we do note differences of voltage dependence of the cardiac isoform versus the renal isoform, we deduce that such interactions must take place. How such interactions lead to alterations in voltage dependence remains under investigation.
![]() |
View larger version [in this window] [in a new window] |
|
|
The putative nine transmembrane regions are shown. Other regions of interest are denoted by letters: A, XIP region; B and C, Ca2+-binding domains; D, alternatively spliced region (see Discussion). IN and OUT refer to cytoplasmic and extracellular sides of the membrane respectively. The hemispherical shaded area is marked to indicate that intra-protein interactions (i.e. 'folding') are likely to account for the 'long distance' effects of the alternatively spliced region (see Discussion). The area between the parallel lines denotes the membrane. | ||
Effect of RPP on the cardiac and renal isoforms
The Na+-Ca2+ exchanger turnover rate is augmented by the RPP (repeated pulse protocol). The most interesting part of this observation is that the effects of RPP are two times greater for the renal isoform of NCX1 than for the cardiac isoform. Since INaCa is an outward current, we deduce that the 'Ca2+ influx mode' of the Na+-Ca2+ exchanger was activated by depolarizing pulses. It is likely that the Ca2+ transported into the cell through the Na+-Ca2+ exchanger may have an effect on the activity of the Na+-Ca2+ exchanger itself to increase the transport activity. The finding that increasing INaCa following RPP could be observed only with short (1 s) intervals but not with long intervals (>2 s) between pulses is consistent with the kinetics of activation of the Na+-Ca2+ exchanger by [Ca2+]i (Matsuoka & Hilgemann, 1992). The activating effect of [Ca2+]i on Na+-Ca2+ exchange has been well characterized in the cardiac Na+-Ca2+ exchanger (Hilgemann et al. 1992). The primary Ca2+-binding regions are in the intracellular loop and are responsible for catalytic activation of the Na+-Ca2+ exchanger by [Ca2+]i. These regions have been identified and confirmed by Ca2+ overlay experiments and site-directed mutagenesis (Matsuoka et al. 1995; Levitsky et al. 1996). To confirm that the increased current in RPP experiments was due to an increase in [Ca2+]i, the RPP experiments were repeated by replacing the Ca2+ with Ba2+. The increase in INaCa was highly reduced or absent for both the cardiac and renal isoforms. Ba2+ is transported by the Na+-Ca2+ exchanger (Blaustein et al. 1991; Trac et al. 1997). However, Ba2+ cannot bind to the Ca2+-binding sites of the Na+-Ca2+ exchanger (Levitsky et al. 1996). In this study, we showed that the RPP effect due to [Ca2+]i of the cardiac isoform is about half that of the renal isoform. How could we account for the cardiac and renal isoforms showing differential effects to [Ca2+]i while having identical Ca2+ binding regions? We hypothesize that the regulatory Ca2+-binding regions may also interact with the alternatively spliced region to effect differential sensitivity to [Ca2+]i. Similar interactions between the Ca2+-binding region and the XIP region has been demonstrated (Hale et al. 1997).
Phosphorylation of the cardiac exchanger by PKA
We demonstrate that activators of the PKA pathway increased the activity of the cardiac Na+-Ca2+ exchanger in rat ventricular cardiomyocytes and in the oocytes expressing the rat cardiac isoform of the exchanger. The increase in the activity of the Na+-Ca2+ exchanger after activating PKA was selectively blocked by KT5720, a blocker of PKA-dependent phosphorylation (Kase et al. 1987). A putative PKA phosphorylation site has been well conserved in mammalian and frog Na+-Ca2+ exchangers (Nicoll et al. 1990; Iwata et al. 1996). Moreover, the fusion protein of the cytoplasmic loop of the dog cardiac Na+-Ca2+ exchanger was shown to be phosphorylated by the PKA catalytic subunit recently (Iwamoto et al. 1996). However, our attempt to phosphorylate the fusion protein of brain isoforms was not successful (He et al. 1998). In our present study, we show for the first time that the cardiac Na+-Ca2+ exchanger can increase its activity in response to activation of PKA and the protein can be phosphorylated in vitro.
| REFERENCES |
|---|
|
|
|---|
| Algrain, M., Turunen, O., Vaheri, A., Louvard, D. & Arpin, M. (1993). Ezrin contains cytoskeleton and membrane binding domains accounting for its proposed role as a membrane linker. Journal of Cell Biology 120, 129-139 | [Abstract] |
| Barnes, K. V., Cheng, G., Dawson, M. M. & Menick, D. R. (1997). Cloning of cardiac, kidney, and brain promoters of the feline ncx1 gene. Journal of Biological Chemistry 272, 11510-11517 | [Abstract/Full Text] |
| Bers, D. M. (1991). Excitation-Contraction Coupling and Cardiac Contractile Force, pp. 71-92. Kluwer Academic Publishers, Dordrecht, The Netherlands. | |
| Blaustein, M. P., DiPolo, R. & Reeves, J. P. (1991). Sodium-calcium exchanger. Annals of the New York Academy of Sciences. 639, 1-667. | [Medline] |
| Dilly, K. W., Gomez, A. M., Neubauer, C. F., Schulze, D. H., Altshuld, R. & Lederer, W. J. (1997). Distribution of Na/Ca exchanger in hypertrophic and failing rat cardiac myocytes. Biophysical Journal 72, A66. | |
| Dipla, K., Mattiello, J. A., Margulies, K. B., Jeevanandam, V. & Houser, S. R. (1999). The sarcoplasmic reticulum and the Na+-Ca2+ exchanger both contribute to the Ca2+ transient of failing human ventricular myocytes. Circulation Research 84, 435-444 | [Abstract/Full Text] |
| Dyck, C., Omelchenko, A., Elians, C. L., Quednau, B. D., Philipson, K. D., Hnatowich, M. & Hryshko, L. A. (1999). Ionic regulatory properties of brain and kidney splice variants of the NCX1 Na-Ca exchanger. Journal of General Physiology 114, 701-711 | [Abstract/Full Text] |
| Gaughan, J. P., Furukawa, S., Jeevanandam, V., Hefner, C. A., Kubo, H., Margulies, K. B., McGowan, B. S., Mattiello, J. A., Dipla, K., Piacentino, V. III, Li, S. & Houser, S. R. (1999). Sodium/calcium exchange contributes to contraction and relaxation in failed human ventricular myocytes. American Journal of Physiology 277, H714-724 | [Medline] |
| Gesek, F. A. & Friedman, P. A. (1992). On the mechanism of parathyroid hormone stimulation of calcium uptake by mouse distal convoluted tubule cells. Journal of Clinical Investigation 90, 749-758 | [Medline] |
| Gesek, F. A. & Friedman, P. A. (1993). Calcitonin stimulates calcium transport in distal convoluted tubule cells. American Journal of Physiology 264, F744-751 | [Medline] |
| Gomez, A. M., Valdivia, H. H., Cheng, H., Lederer, M. R., Santana, L. F., Cannell, M. B., McCune, S. A., Altschuld, R. A. & Lederer, W. J. (1997). Defective excitation-contraction coupling in experimental cardiac hypertrophy and heart failure. Science 276, 800-806 | [Abstract/Full Text] |
| Hale, C. C., Blier, S., Quinn, T. P. & Peletskaya, E. N. (1997). Localization of an exchange inhibitory peptide (XIP) binding site on the cardiac sodium-calcium exchanger. Biochemical and Biophysical Research Communications 236, 113-117 | [Medline] |
| Harrison, S. M. & Boyett, M. R. (1995). The role of the Na/Ca exchanger in the rate-dependent increase in contraction in guinea-pig ventricular myocytes. The Journal of Physiology 482, 555-566 | [Medline] |
| He, S., Ruknudin, A., Bambrick, L., Lederer, W. J. & Schulze, D. H. (1998). Isoform-specific regulation of the Na/Ca exchanger in rat astrocytes and neurons. Journal of Neuroscience 18, 4833-4841 | [Abstract/Full Text] |
| Hilgemann, D. W., Collins, A. & Matsuoka, S. (1992). Steady state and dynamic properties of cardiac sodium-calcium exchange: secondary modulation by cytoplasmic calcium and ATP. Journal of General Physiology 100, 933-961 | [Abstract] |
| Ivanina, T., Perets, T., Thornhill, W. B., Levin, G., Dascal, N. & Lotan, I. (1994). Phosphorylation by protein kinase A of RCK K+ channels expressed in oocytes. Biochemistry 33, 8786-8792 | |
| Iwamoto, T., Pan, Y., Wajabayashi, S., Imagawa, T., Yamanaka, H. I. & Shigekawa, M. (1996). Phosphorylation-dependent regulation of cardiac Na/Ca exchanger via protein kinase C. Journal of Biological Chemistry 271, 13609-13615 | [Abstract/Full Text] |
| Iwata, T., Kraev, A., Guerini, D. & Carafoli, E. (1996). A splicing variant in the frog heart sarcolemmal Na-Ca exchanger creates a putative ATP-binding site. Annals of the New York Academy of Sciences 779, 37-45 | [Medline] |
| Kase, H., Iwahashi, K., Nakanishi, S., Matsuda, Y., Yamada, K., Takahashi, M., Murakata, C., Sato, A. & Kaneko, M. (1987). K-252 compounds, novel and potent inhibitors of protein kinase C and cyclic nucleotide-dependent protein kinases. Biochemical and Biophysical Research Communications 142, 436-440 | [Medline] |
| Kimura, J., Noma, A. & Irisawa, H. (1986). Na-Ca exchange current in mammalian heart cells. Nature 319, 596-597 | [Medline] |
| Kofuji, P., Hadley, R. W., Kieval, R. S., Lederer, W. J. & Schulze, D. H. (1993). Expression of the Na/Ca exchanger in diverse tissues: a study using the cloned human cardiac Na/Ca exchanger. American Journal of Physiology 263, C1241-1249. | |
| Kofuji, P., Lederer, W. J. & Schulze, D. H. (1994). Mutually exclusive and cassette exons underlie alternatively spliced isoforms of the Na/Ca exchanger. Journal of Biological Chemistry 269, 14849-14852 | [Abstract] |
| Lauger, P. (1987). Voltage dependence of sodium-calcium exchange: predictions from kinetic models. Journal of Membrane Biology 99, 1-11 | [Medline] |
| Leblanc, N. & Hume, J. R. (1990). Sodium current-induced release of calcium from sarcoplasmic reticulum. Science 248, 372-376 | [Medline] |
| Lee, S. L., Yu, A. S. L. & Lytton, J. (1994). Tissue-specific expression of Na-Ca exchanger isoforms. Journal of Biological Chemistry 269, 14849-14852 | [Abstract] |
| Le Guennec, J.-Y. & Noble, D. (1994). Effects of rapid changes of external Na+ concentration at different moments during the action potential in guinea-pig myocytes. The Journal of Physiology 478, 493-504 | [Medline] |
| Levitsky, D. O., Fraysse, B., Leoty, C., Nicoll, D. A. & Philipson, K. D. (1996). Cooperative interaction between Ca2+ binding sites in the hydrophilic loop of the Na+-Ca2+ exchanger. Molecular and Cellular Biochemistry 160-161, 27-32 | [Medline] |
| Li, Z., Matsuoka, S., Hryshko, L. V., Nicoll, D. A., Bersohn, M. M., Burke, E. P., Lifton, R. P. & Philipson, K. D. (1994). Cloning of the NCX2 isoform of the plasma membrane Na-Ca exchanger. Journal of Biological Chemistry 269, 17434-17439 | [Abstract] |
| Lipp, P. & Niggli, E. (1994). Sodium current-induced calcium signals in isolated guinea-pig cardiac myocytes. The Journal of Physiology 474, 439-446 | [Medline] |
| Matsuoka, S. & Hilgemann, D. W. (1992). Steady state and dynamic properties of cardiac sodium-calcium exchange: ion and voltage dependencies of the transport cycle. Journal of General Physiology 100, 963-1001 | [Abstract] |
| Matsuoka, S., Nicoll, D. A., Hryshko, L. V., Levitsky, D. O., Weiss, J. N. & Philipson, K. D. (1995). Regulation of the cardiac sarcolemmal Na-Ca exchanger. Journal of General Physiology 105, 403-420 | [Abstract] |
| Matsuoka, S., Nicoll, D. A., Reilly, R. F., Hilgemann, D. W. & Philipson, K. D. (1993). Initial localization of regulatory regions of the cardiac sarcolemmal Na-Ca exchanger. Proceedings of the National Academy of Sciences of the USA 90, 3870-3874 | [Abstract] |
| Mattiello, J. A., Margulies, K. B., Jeevanandam, V. & Houser, S. R. (1998). Contribution of reverse-mode sodium-calcium exchange to contractions in failing human left ventricular myocytes. Cardiovascular Research 37, 424-431 | [Medline] |
| Nakasaki, Y., Iwamoto, T., Hanada, H., Imagawa, T. & Shigekawa, M. (1993). Cloning of the rat aortic smooth muscle Na/Ca exchanger and tissue-specific expression of isoforms. Journal of Biochemistry 114, 528-534 | [Medline] |
| Nicoll, D. A., Longoni, S. & Philipson, K. D. (1990). Molecular cloning and functional expression of the cardiac sarcolemmal Na/Ca exchanger. Science 250, 562-565 | [Medline] |
| Nicoll, D. A., Quednau, B. D., Qui, Z. Y., Xia, Y. R., Lusis, A. J. & Philipson, K. D. (1996). Cloning of a third mammalian Na-Ca exchanger, NCX3. Journal of Biological Chemistry 271, 24914-24921 | [Abstract/Full Text] |
| Niggli, E. & Lipp, P. (1994). Voltage-dependence of Na-Ca exchanger conformational currents. Biophysical Journal 67, 1516-1524 | [Abstract] |
| Quednau, B. D., Nicoll, D. A. & Philipson, K. D. (1997). Tissue specificity and alternative splicing of the Na/Ca exchanger isoforms NCX1, NCX2 and NCX3 in rat. American Journal of Physiology 272, C1250-1261 | [Medline] |
| Reilly, R. F. & Shugrue, C. A. (1992). cDNA cloning of a renal Na-Ca exchanger. American The Journal of Physiology 262, F1105-1109 | [Medline] |
| Reilly, R. F., Shugrue, C. A., Lattazani, D. & Biemesderfer, D. (1993). Immunolocalization of the Na/Ca exchanger in rabbit kidney. American Journal of Physiology 265, F327-332 | [Medline] |
| Ruknudin, A., Lederer, W. J., He, S. & Schulze, D. H. (1998a). Functional differences between heart and kidney isoforms of the Na/Ca exchanger, NCX1. Biophysical Journal 74, A193. | |
| Ruknudin, A., Schulze, D. H., Sullivan, S. K., Lederer, W. J. & Welling, P. A. (1998b). Novel subunit composition of renal KATP channel. Journal of Biological Chemistry 273, 14165-14171 | [Abstract/Full Text] |
| Ruknudin, A., Valdivia, C., Kofuji, P., Lederer, W. J. & Schulze, D. H. (1997). Na/Ca exchanger in Drosophila: cloning, expression, and transport differences. American Journal of Physiology 273, C257-265 | [Medline] |
| Studer, R., Reinecke, H., Bilger, J., Eschenhagen, T., Bohm, M., Hasenfuss, G., Just, H., Holtz, J. & Drexler, H. (1994). Gene expression of the cardiac Na/Ca exchanger in end-stage human heart failure. Circulation Research 75, 443-453 | [Abstract] |
| Tang, W., Ruknudin, A., Yang, W.-P., Shaw, S.-Y., Knickerbroker, A. & Kurtz, S. (1995). Functional expression of a vertebrate inwardly rectifying K channel in yeast. Molecular and Cellular Biology 6, 1231-1240. | |
| Trac, M., Dyck, C., Hnatowich, M., Omelchenko, A. & Hryshko, L. V. (1997). Transport and regulation of the cardiac Na+-Ca2+ exchanger, NCX1. Comparison between Ca2+ and Ba2+. Journal of General Physiology 109, 361-369 | [Abstract/Full Text] |
| White, K. E., Gesek, F. A. & Friedman, P. A. (1996). Structural and functional analysis of Na/Ca exchange in distal convoluted tubule cells. American Journal of Physiology 271, F560-570 | [Medline] |
This work was supported by Pepper Centre Grant, Grants-in-Aid American Heart Association MDS2295 and MDS2297 (A.R.) and by National Institutes of Health grants AG08191(D.H.S.), HL25675 and HL36974 (W.J.L.).
Corresponding author
A. Ruknudin: Department of Microbiology and Immunology, 655 W. Baltimore Street, University of Maryland at Baltimore, School of Medicine, Baltimore, MD 21201, USA.
Email: aruknudi{at}umaryland.edu
This article has been cited by other articles:
![]() |
C. Orchard and F. Brette t-tubules and sarcoplasmic reticulum function in cardiac ventricular myocytes Cardiovasc Res, January 15, 2008; 77(2): 237 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Reppel, B. K. Fleischmann, H. Reuter, P. Sasse, H. Schunkert, and J. Hescheler Regulation of the Na+/Ca2+ exchanger (NCX) in the murine embryonic heart Cardiovasc Res, July 1, 2007; 75(1): 99 - 108. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-k. Wei, A. M. Ruknudin, M. Shou, J. M. McCurley, S. U. Hanlon, E. Elgin, D. H. Schulze, and M. C.P. Haigney Muscarinic Modulation of the Sodium-Calcium Exchanger in Heart Failure Circulation, March 13, 2007; 115(10): 1225 - 1233. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Tucker, J. Song, X.-Q. Zhang, J. Wang, B. A. Ahlers, L. L. Carl, J. P. Mounsey, J. R. Moorman, L. I. Rothblum, and J. Y. Cheung Altered contractility and [Ca2+]i homeostasis in phospholemman-deficient murine myocytes: role of Na+/Ca2+ exchange Am J Physiol Heart Circ Physiol, November 1, 2006; 291(5): H2199 - H2209. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hurtado, M. Prociuk, T. G. Maddaford, E. Dibrov, N. Mesaeli, L. V. Hryshko, and G. N. Pierce Cells expressing unique Na+/Ca2+ exchange (NCX1) splice variants exhibit different susceptibilities to Ca2+ overload Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H2155 - H2162. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Q. Zhang, B. A. Ahlers, A. L. Tucker, J. Song, J. Wang, J. R. Moorman, J. P. Mounsey, L. L. Carl, L. I. Rothblum, and J. Y. Cheung Phospholemman Inhibition of the Cardiac Na+/Ca2+ Exchanger: ROLE OF PHOSPHORYLATION J. Biol. Chem., March 24, 2006; 281(12): 7784 - 7792. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Vinogradova, A. E. Lyashkov, W. Zhu, A. M. Ruknudin, S. Sirenko, D. Yang, S. Deo, M. Barlow, S. Johnson, J. L. Caffrey, et al. High Basal Protein Kinase A-Dependent Phosphorylation Drives Rhythmic Internal Ca2+ Store Oscillations and Spontaneous Beating of Cardiac Pacemaker Cells Circ. Res., March 3, 2006; 98(4): 505 - 514. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Lin, H. Jo, Y. Sakakibara, K. Tambara, B. Kim, M. Komeda, and S. Matsuoka {beta}-Adrenergic stimulation does not activate Na+/Ca2+ exchange current in guinea pig, mouse, and rat ventricular myocytes Am J Physiol Cell Physiol, February 1, 2006; 290(2): C601 - C608. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dipolo and L. Beauge Sodium/Calcium Exchanger: Influence of Metabolic Regulation on Ion Carrier Interactions Physiol Rev, January 1, 2006; 86(1): 155 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Marshall, T.-C. Pan, H. D. Le, A. Omelchenko, P. P. Hwang, L. V. Hryshko, and G. F. Tibbits cDNA Cloning and Expression of the Cardiac Na+/Ca2+ Exchanger from Mozambique Tilapia (Oreochromis mossambicus) Reveal a Teleost Membrane Transporter with Mammalian Temperature Dependence J. Biol. Chem., August 12, 2005; 280(32): 28903 - 28911. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Bolck, G. Munch, P. Mackenstein, M. Hellmich, I. Hirsch, H. Reuter, N. Hattebuhr, H.-J. Weig, M. Ungerer, K. Brixius, et al. Na+/Ca2+ exchanger overexpression impairs frequency- and ouabain-dependent cell shortening in adult rat cardiomyocytes Am J Physiol Heart Circ Physiol, October 1, 2004; 287(4): H1435 - H1445. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. H. Schulze, M. Muqhal, W. J. Lederer, and A. M. Ruknudin Sodium/Calcium Exchanger (NCX1) Macromolecular Complex J. Biol. Chem., August 1, 2003; 278(31): 28849 - 28855. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-k. Wei, A. Ruknudin, S. U. Hanlon, J. M. McCurley, D. H. Schulze, and M. C.P. Haigney Protein Kinase A Hyperphosphorylation Increases Basal Current but Decreases {beta}-Adrenergic Responsiveness of the Sarcolemmal Na+-Ca2+ Exchanger in Failing Pig Myocytes Circ. Res., May 2, 2003; 92(8): 897 - 903. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shigekawa and T. Iwamoto Cardiac Na+-Ca2+ Exchange : Molecular and Pharmacological Aspects Circ. Res., May 11, 2001; 88(9): 864 - 876. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||