J Physiol Society Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 532, Number 2, 449-457, April 15, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kibble, J. D.
Right arrow Articles by Taylor, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kibble, J. D.
Right arrow Articles by Taylor, C. J.
Journal of Physiology (2001), 532.2, pp. 449-457
© Copyright 2001 The Physiological Society

Renal proximal tubule function is preserved in Cftrtm2cam DeltaF508 cystic fibrosis mice


J. D. Kibble, K. J. D. Balloch, A. M. Neal, C. Hill, S. White, L. Robson, R. Green * and C. J. Taylor †


Department of Biomedical Science, University of Sheffield, Sheffield S10 2TN, * School of Biological Sciences, University of Manchester, Manchester M13 9PT and † Department of Paediatrics, Sheffield Children's Hospital, Sheffield S10 2TH, UK

MS 11510 Received 4 August 2000; accepted after revision 12 December 2000

  ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

  1. Changes in proximal tubule function have been reported in cystic fibrosis patients. The aim of this study was to investigate proximal tubule function in the Cftrtm2cam DeltaF508 cystic fibrosis (CF) mouse model. A range of techniques were used including renal clearance studies, in situ microperfusion, RT-PCR and whole-cell patch clamping.

  2. Renal Na+ clearance was similar in wild-type (1.4 ± 0.3 µl min-1, number of animals, N = 12) and CF mice (1.6 ± 0.4 µl min-1, N = 7) under control conditions. Acute extracellular volume expansion resulted in significant natriuresis in wild-type (7.0 ± 0.8 µl min-1, N = 8) and CF mice (9.3 ± 1.4 µl min-1, N = 9); no difference between genotypes was observed.

  3. In situ microperfusion revealed that fluid absorptive rate (Jv) was similar under control conditions between wild-type (2.2 ± 0.4 nl mm-1 min-1, n = 10) and CF mice (1.9 ± 0.3 nl mm-1 min-1, n = 11). Addition of a forskolin-dibutyryl cAMP (db-cAMP) cocktail to the perfusate caused no significant change in Jv in either wild-type (2.6 ± 0.7 nl mm-1 min-1, n = 10) or Cftrtm2cam DeltaF508 mice (2.0 ± 0.5 nl mm-1 min-1, n = 10).

  4. CFTR expression was confirmed in samples of outer cortex using RT-PCR. However, no evidence for functional CFTR was obtained when outer cortical cells were stimulated with protein kinase A or forskolin-db-cAMP using whole-cell patch clamping.

  5. In conclusion, no functional deficit in proximal tubule function was found in Cftrtm2cam DeltaF508 mice. This may be a consequence of a lack of whole-cell cAMP-dependent Cl- conductance in mouse proximal tubule cells.

  INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

It is well documented that defects in the cystic fibrosis transmembrane conductance regulator (CFTR) are the cause of abnormal epithelial electrolyte transport in cystic fibrosis (Koch & Hoiby, 1993). Pathology of the respiratory and gastrointestinal systems is the major feature of cystic fibrosis and it is not widely appreciated that CFTR is also expressed in the kidney (Stanton, 1997). Clearance studies in cystic fibrosis patients have identified several disturbances in renal electrolyte handling. For example, it has been reported that CF patients tend to retain Na+ (Stenvinkel et al. 1991) and have an abnormally low natriuretic response to Na+ loading (Berg et al. 1982). A reduction in free water clearance in CF patients also indicates a reduction in renal diluting capacity (Robson et al. 1971; Berg et al. 1982; Donckerwolcke et al. 1992). The mechanisms responsible for these changes in renal function are not known. With the exception of one study, which found that CF patients had a reduced tubular reabsorptive capacity during Na+ loading (Aladjem et al. 1983), evidence for inappropriately high sodium reabsorption in the proximal tubule has been presented (Robson et al. 1971; Berg et al. 1982; Stenvinkel et al. 1991; Donckerwolcke et al. 1992). Whether changes in proximal tubule transport represent a primary defect or a compensatory phenomenon is unclear.

There is currently no consensus about the expression of CFTR in the renal proximal tubule. Whilst early immunohistochemical analysis in human kidney suggested expression in apical membrane (Crawford et al. 1991), a more recent study, using several antibodies directed against CFTR, indicated diffuse cytoplasmic expression (Devuyst et al. 1996). The issue of CFTR localisation is further complicated by single-channel recordings from the basolateral membrane of Ambystoma proximal tubule showing a CFTR-like channel (Segal & Boulpaep, 1992). In agreement with this, a CFTR-like conductance has been reported in the basolateral membrane of rabbit proximal tubule (Segal et al. 1993; Seki et al. 1995). In contrast, Rubera et al. (1998) could not detect CFTR currents using whole-cell patch clamp recording in primary cultured rabbit proximal tubule cells.

Evidence that cAMP-activated Cl- channels may be important in proximal tubule NaCl and fluid absorption has been obtained from micropuncture experiments in the rat. Wang et al. (1995) suggested the marked increase in fluid absorption observed during cAMP stimulation indicated the presence of cAMP-activated Cl- channels in both the apical and basolateral membranes. In support of this idea, a number of cAMP-activated Cl- conductances have been reported in the proximal tubule (Lipkowitz & Abramson, 1989; Suzuki et al. 1991; Segal & Boulpaep, 1992; Segal et al. 1993; Darvish et al. 1994; Seki et al. 1995).

In the present study we compared proximal tubule function between wild-type and Cftrtm2cam DeltaF508 mice. The aims of the study were first to assess whether loss of CFTR expression is associated with changes in whole kidney function. The effect of acute saline loading was also assessed in Cftrtm2cam DeltaF508 mice since CF patients have been reported to exhibit abnormal excretory responses to a salt load (Berg et al. 1982; Aladjem et al. 1983). Proximal tubule fluid absorptive rate was measured directly by in situ microperfusion. We tested the hypothesis that cAMP stimulation would increase fluid absorption in a CFTR-dependent manner. Finally, expression of CFTR was assessed using RT-PCR and whole-cell patch clamp recording.

  METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Animals and genotyping

Mice were originally produced by Colledge et al. (1995). The DeltaF508 mutation was introduced into the Cftr gene by targeted replacement using a construct with a 3 bp deletion between nucleotides 1522 and 1524 in exon 10. Mice were bred from heterozygotes and genotyped by a PCR method as described previously (Kibble et al. 2000).

Anaesthesia and renal clearance surgery

Adult male mice were used throughout and were obtained from the Field Laboratories, Western Bank, University of Sheffield, UK. Animals were specific-pathogen free and were housed in a temperature- (20-22 °C) and humidity- (40-60 %) controlled room with a 12 h light-dark cycle. Mice were maintained on a standard chow diet containing 0.32 % w/w NaCl and were given access to tap water ad libitum prior to experimentation. Animals were weighed and anaesthetized with an initial intraperitoneal injection of 100 mg kg-1 sodium thiopentone (Thiovet, C-Vet Veterinary Products, Leyland, UK). Ketamine (10 mg kg-1)-xylazine (1.5 mg kg-1) (Research Biochemicals International, Natick, MA, USA) was given intraperitoneally if additional maintenance anaesthesia was required. Ketamine-xylazine was used in preference to sodium thiopentone for maintenance anaesthesia since its subsequent administration does not cause acute depression of blood pressure. Animals were placed on a thermostatically controlled heated blanket set to maintain body temperature at 38 °C (Harvard Apparatus, Kent, UK), and were surgically prepared for either renal clearance or in situ microperfusion experiments. For clearance studies, polyethylene cannulae (outer diameter 0.63 mm, bore 0.50 mm) were placed in the right jugular vein for intravenous infusion and in the left carotid artery for continuous blood pressure monitoring and blood sampling. The bladder was also cannulated via a suprapubic incision, for urine collection. A tracheostomy was performed to maintain a clear airway and pure oxygen was blown over the neck area throughout.

Clearance protocols

Immediately following implantation of the venous cannula, until the end of surgery, all animals received intravenous infusion of 0.9 % NaCl at a rate of 0.3 ml h-1 to replace fluid loss due to surgery. After surgery an equilibration period lasting 45 min was observed, followed by an experimental clearance period of 60 min, over which urine was collected for analysis. Two saline infusion protocols were adopted to assess the effect of saline volume expansion and were compared in both wild-type and Cftrtm2cam DeltaF508 mice. Control animals received a maintenance infusion of 0.9 % saline at a rate of 0.3 ml h-1 throughout the equilibration and experimental periods. Animals subjected to volume expansion were given a 1 ml priming dose of saline delivered over the first 15 min of the equilibration period, followed by a maintenance infusion of 0.6 ml h-1 thereafter. [3H]Inulin (Amersham Life Sciences, UK) was included in the infusion solutions to allow estimation of the glomerular filtration rate (GFR). [3H]Inulin concentrations were adjusted so that all animals received a 1.5 µCi priming dose during the first 5 min of equilibration, followed by 4.5 µCi h-1 maintenance dose thereafter. Preliminary experiments established that these protocols produced stable plasma [3H]inulin activity, [Na+], [Cl-], and haematocrit during the 60 min experimental clearance period. For this reason, a terminal plasma sample was used for calculation of renal clearances. Following the terminal blood sample, mice were killed by anaesthetic overdose. [3H]Inulin was assayed by liquid scintillation counting, Na+ was determined by single-channel flame photometry (Sherwood, Model 410, Scientific Laboratory Supplies, Nottingham, UK) and Cl- was measured by electrometric titration (Jenway PCLM3, Essex, UK).

In situ microperfusion experiments

During preliminary experiments we observed that the total length of surgery was an important determinant of experimental success. The additional 30-40 min of surgery required to prepare the kidney for micropuncture after that described above for clearance was associated with poor renal function in around 80 % of animals. To reduce surgical stress, the bladder and carotid cannulae were omitted in order that microperfusion experiments could be carried out in the same time frame as that described above for clearance measurements. A jugular cannula and tracheostomy were performed as described above and the left kidney was exposed via a flank incision. The perirenal fat and suprarenal gland were separated from the kidney, which was then placed in a Perspex holder. The kidney was further stabilised by immersing it in warmed 2 % agar-0.9 % saline. The surface of the kidney was exposed by cutting a window in the agar and was then bathed in paraffin oil maintained at body temperature. Following equilibration, two or three microperfusions per animal were carried out within a further 60 min period as described for clearance studies. Sharpened glass micropipettes with a tip diameter of 4-8 µm were used for micropunctures. Surface proximal tubules were perfused at a rate of 15 nl min-1 as described previously in the rat (Bishop et al. 1978). The perfusion solution contained (mM): 140 NaCl, 5 KCl, 1 MgCl2, 1 CaCl2, 10 Hepes; pH 7.0. The solution also contained 50 µCi ml-1 [3H]inulin (Amersham) and 0.05 % Erioglaucine dye (Aldrich), so that the perfusate was visible within the tubule. For cAMP stimulation experiments, 0.5 mM dibutyryl cAMP (db-cAMP) and 10 µM forskolin (Sigma) were included (Wang et al. 1995). After microperfusion, the length of perfused sections of nephron was determined from a silicone cast as described previously in the rat (Bishop et al. 1978).

Cell isolation and whole-cell patch clamp experiments

Mice were humanely killed by cervical dislocation (in accordance with UK legislation). The kidneys were removed into an ice-cold solution containing (mM): 140 KCl, 1 MgCl2, 1 CaCl2, 10 Hepes, titrated to pH 7.4 with KOH and gassed with 100 % O2. The kidney capsule was removed and thin (< 0.5 mm) slices of the outer cortex taken. The cortical slices were minced between two razor blades and further homogenised with two strokes of a glass-Teflon homogeniser. The homogenate was passed through a nylon mesh (PP80, Millipore) and stored in isolation buffer on ice until required. No enzymes were used at any stage of the cell isolation procedure. For patch clamping, cells were transferred to a Perspex chamber mounted on the stage of an Olympus IX70 inverted microscope. Cells were continuously superfused with bath solution throughout the experiment. The conventional whole-cell recording method was applied (Hamill et al. 1981) to measure membrane currents. Patch pipettes were made from haematocrit capillary tubes (LIP Equipment Services, Shipley, UK) using a two-stage vertical puller (PB-7, Narishige, Japan). Membrane currents were recorded using a List EPC-7 amplifier (Heka Electronik, Germany). Step voltage pulses were generated using the pCLAMP software (v. 6, Axon Instruments) and a Digidata 1200 series interface (Axon Instruments). Signals were passed through an 8-pole low pass filter set to 5 kHz to filter high frequency electrical noise. Data were stored on computer hard disk and were processed using the pCLAMP6 Clampex and Clampfit software. The control bath solution contained (mM): 140 CsCl, 2 CaCl2, 1 MgCl2, 0.1 GdCl3, 10 mannitol, 10 Hepes; pH 7.4. The control pipette solution contained (mM): 140 CsCl, 2 MgCl2, 0.5 EGTA, 2 Na2ATP, 10 Hepes; pH 7.4. CsCl was used to inhibit K+ conductances and GdCl3 was included to inhibit non-selective cation conductances (K. J. D. Balloch, I. D. Millar, J. D. Kibble & L. Robson, unpublished data). To activate cAMP-dependent Cl- currents, either 0.5 mM cAMP or 375 nM protein kinase A (PKA) catalytic subunit (Promega, UK) were added to the pipette solution. Given previous observations in pancreatic duct that CFTR activation required Ca2+-free conditions (Gray et al. 1993), an additional series of experiments was also performed in the absence of added Ca2+ in either the isolation or the patch clamp solutions. After 25 min of whole-cell recording, the bath solution was exchanged for one which contained 28 mM CsCl. Osmotic strength was maintained by addition of mannitol. This manoeuvre was performed to assess the relative anion:cation selectivity of any activated currents.

Reverse transcription-polymerase chain reaction (RT-PCR) determination of CFTR mRNA expression

All reagents were obtained from Promega, Southampton, UK, unless otherwise stated. Slices of outer kidney cortex were taken as described above for patch clamping. Total RNA was extracted from cortex using Trizol reagent (Gibco BRL, Paisley, UK) according to the manufacturer's instructions, and then treated with DNAse I to remove genomic DNA. Reverse transcription reactions used 2 µg total RNA, 2 µl of 25 µM JW1 primer (an oligo(dT)ll with GC clamp) and molecular biology grade water up to a final volume of 12.9 µl. Samples were heated at 90 °C for 2 min to denature RNA secondary structures. To each sample 4 µl of reverse transcriptase buffer, 1.6 µl of deoxynucleotide phosphate (dNTPs) mix and 1.5 µl of Moloney murine leukaemia virus (MMLV) reverse transcriptase were added and allowed to anneal on ice. Finally, samples were heated for 1 h at 35 °C then 95 °C for 5 min to denature the reverse transcriptase. PCR was performed with primers designed against the mouse CFTR sequence (forward primer CCCGAUCAGUUCUCAGUAAGG, reverse primer AGUUGCUUCCUCAGCAUCC). The PCR reaction contained 50 mM KCl, 10 mM Tris-HCl (pH 9.0 at 25 °C), 0.1 % Triton-X 100, 200 mM of dNTP mix, 3.5 mM MgCl2, 1.25 units of Taq polymerase, 200 nM of each primer (CFTR or glyceraldehyde phosphate dehydrogenase (GAPDH)) plus the target DNA. Samples were heated to 94 °C for 4 min then subjected to 40 cycles of denaturation (94 °C, 1 min), annealing (57.5 or 60 °C, 1 min) and extension (72 °C, 1.5 min). A final extension phase of 72 °C for 10 min was included for all samples. PCR products were separated by electrophoresis on a 3 % agarose gel and visualised by ethidium bromide staining under UV (302 nm) light. Each determination was performed with and without reverse transcriptase and each RT-PCR was performed at least three times on RNA from three separate extractions.

Data presentation and statistics

Renal clearance (CX, µl min-1) and fractional excretion (FEX, %) of a substance X were calculated using the following formulae:

CX = (UXV)/PX,

FEX = CX/GFR times 100,

where UX and PX are the urinary and plasma concentrations of substance X (mM), V is urine flow rate (µl min-1) and GFR is glomerular filtration rate, estimated from the clearance of [3H]inulin (µl min-1).

In microperfusion experiments, the fluid reabsorptive rate (Jv, nl mm-1 min-1) was calculated:

Jv = Vo(1 - Ino/Inl)/L,

where Vo is the perfusion rate (nl min-1), Ino and Inl are the [3H]inulin concentrations in perfused and collected fluid (d.p.m. nl-1), respectively, and L is the length of perfused tubule (mm).

In patch clamp experiments data were expressed as current densities by dividing whole-cell current (pA) by the cell capacitance determined from the cancellation of slow capacitance transients (pF) using the analog circuitry of the EPC7 amplifier. This was done to reduce variations introduced by using cells of different sizes. All currents recorded were linear, such that current densities are reported at a single potential of +40 mV for comparison between groups.

Data are expressed throughout as means ± S.E.M. In clearance experiments data are reported for N animals in each group. In microperfusion and patch clamp experiments data are reported for n tubules and cells, respectively, derived from at least four animals in any one experimental group. Statistical analysis was by one-way analysis of variance. Inequalities were located by Student's unpaired t test with Bonferroni's modification applied to accommodate multiple comparisons. P < 0.05 was taken as the level of statistical significance.

  RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Effects of saline volume expansion

It was possible to rear Cftrtm2cam DeltaF508 mice on regular chow diets without causing mortality due to intestinal obstruction. The pooled average age of mice was 80 ± 3 days (N = 58), with no significant differences between genotypes or any experimental treatments. The pooled average weight of animals was 28.0 ± 0.4 g (N = 58). Juvenile Cftrtm2cam DeltaF508 mice gained weight more slowly than wild-types (data not shown), though there was no significant difference in adult body weight between genotypes and again no differences between experimental groups were noted. Pre-weaning mortality was negligible in wild-type animals, but was consistently around 20 % in Cftrtm2cam DeltaF508 mice. No special difficulties were noted in maintaining Cftrtm2cam DeltaF508 mice under anaesthesia.

Comparing plasma composition and renal excretion data for wild-type and Cftrtm2cam DeltaF508 mice under control conditions (Table 1) showed no differences in any of the measured variables. Application of saline volume expansion caused no change in mean arterial blood pressure, or plasma electrolytes in either genotype. GFR was significantly increased in wild-type mice, but not in Cftrtm2cam DeltaF508 mice. Haematocrit was slightly reduced in both genotypes (P = 0.04 for wild-type and P = 0.02 for Cftrtm2cam DeltaF508 mice prior to Bonferroni's modification). The volume expansion protocol caused a significant diuresis in Cftrtm2cam DeltaF508 mice, though the change in urine flow in wild-type animals was not statistically significant. Figure 1 shows that a large and significant natriuresis and chloruresis occurred following volume expansion in both genotypes, though no significant difference between wild-type and Cftrtm2cam DeltaF508 mice was observed in respect of Na+ or Cl- clearance. Inspection of Table 1 shows that the increase in fractional Na+ excretion caused by volume expansion was greater in Cftrtm2cam DeltaF508 mice than in wild-type animals.

tab1

View larger version
[in this window]
[in a new window]

    Figure 1. Effect of acute extracellular volume expansion (VE) on renal Na+ and Cl- clearance (C) in wild-type (WT) and Cftrtm2cam DeltaF508 (CF) mice

    squ, constant 0.9 % saline infusion at 0.3 ml h-1; , a volume expansion with a 1 ml saline bolus followed by constant infusion at 0.6 ml h-1. The number of animals in each group is shown in parentheses. *Significant increase in clearance in response to volume expansion (ANOVA plus Student's t test with Bonferroni's correction, P < 0.05). ns denotes no significant difference between WT and CF mice.

In situ microperfusion

Animals used for microperfusion studies were age and weight matched (Table 2). In all groups, recovery of the non-reabsorbed marker [3H]inulin was not significantly different from 100 %. In vitro calibration of the Effenberger microperfusion pump, performed by perfusing into saline-filled capillary tubes, yielded a mean perfusion rate of 15.0 ± 0.3 nl min-1 (n = 10). There was no significant difference in the duration of microperfusion, or in the lengths of perfused tubule between experimental groups. Basal fluid absorptive rate measured in the absence of cAMP stimulation ranged from 1 to 4 nl mm-1 min-1 in both wild-type and Cftrtm2cam DeltaF508 mice. Figure 2 shows that there was no significant difference in basal fluid absorptive rate between genotypes. Moreover, when cAMP stimulation was applied by including 10 µM forskolin-0.5 mM db-cAMP in the luminal perfusate, no change in fluid absorptive rate was observed in either genotype.

tab2

View larger version
[in this window]
[in a new window]

    Figure 2. Effect of cAMP stimulation on fluid absorptive rate (Jv) in proximal tubules of wild-type (WT) and Cftrtm2cam DeltaF508 (CF) mice microperfused in situ

    Tubules were perfused at a rate of 15 nl min-1 with a Hepes buffered saline containing either 0.1 % DMSO vehicle (squ) or 10 µM forskolin and 0.5 mM dibutyryl cAMP (). The number of tubules perfused in each group is shown below the bars. No significant difference in Jv between genotypes or due to cAMP stimulation was observed (ANOVA, P > 0.05).

RT-PCR and whole-cell patch clamp recording

RT-PCR identified a band of the anticipated size for CFTR (398 bp) from kidney cortex of wild-type mice (Fig. 3). The primers were not designed to discriminate against DeltaF508 CFTR and a band of the same size was observed in kidney cortex from Cftrtm2cam DeltaF508 mice. As controls, each set of samples was performed with and without reverse transcriptase to check for contamination from genomic DNA and RT-PCR was performed on RNA to identify the housekeeping gene GAPDH to check the viability of the RNA which gave an appropriately sized product of 597 bp.

View larger version
[in this window]
[in a new window]

    Figure 3. CFTR expression in mouse outer renal cortex

    RT-PCR using primers to identify CFTR and GAPDH. Lanes 1 and 5, 100 bp ladder; lanes 2 and 6, RNA from wild-type kidney outer cortex identifying CFTR with and without reverse transcription (RT), respectively; lanes 3 and 7, RNA from Cftrtm2Cam mice identifying CFTR with and without RT, respectively; lanes 4 and 8, RNA from wild-type outer cortex identifying GAPDH as a house keeping gene with and without RT, respectively.

In patch clamp experiments, cell capacitance ranged from 2.1 to 7.9 pF, with an overall mean of 4.2 ± 1.7 pF (n = 48). No significant differences in capacitance were noted between experimental groups. Access resistance ranged from 3 to 20 MOmega, with an overall mean of 8 ± 1 MOmega (n = 48). No differences in access resistance were noted between groups. None of the treatments was associated with a change in capacitance or access resistance. In control cells (absence of pipette PKA) initial whole-cell currents in wild-type cells were small (2.6 ± 1.4 pA pF-1, n = 5) and did not change significantly over a further 25 min of whole-cell recording (3.9 ± 0.7 pA pF-1, Student's paired t test, P > 0.05). Figure 4 shows that addition of 375 nM PKA catalytic subunit to the pipette solution was also associated with very small initial whole-cell currents (3.0 ± 1.9 pA pF-1, n = 11). There was no significant activation of current over the next 25 min of recording (2.8 ± 1.8 pA pF-1). Changing the bath solution to one with a 5-fold lower CsCl solution caused no significant shift in reversal potential (2 ± 3 mV, n = 11) indicating that the small conductance present was probably carried by leak currents. Figure 4 also shows the effects of other manoeuvres designed to activate cAMP-dependent Cl- currents. The removal of bath GdCl3 (normally present in case of activation of non-selective cation currents) had no effect on currents recorded in the presence of PKA. When cells were isolated in the nominal absence of Ca2+, to reduce the possibility of channel inactivation by Ca2+-dependent phosphatases, PKA was still unable to activate a conductance. Finally in cells isolated and continuously incubated in a forskolin-db-cAMP cocktail, as described by Gray et al. (1993), currents were not significantly different from other groups (Fig. 4).

View larger version
[in this window]
[in a new window]

    Figure 4. Lack of cAMP-dependent whole-cell Cl- conductance in isolated mouse proximal tubule cells

    The upper panel shows representative current profiles and corresponding I-V plots of currents recorded in the presence of 375 nM PKA catalytic subunit in the pipette solution; 20 mV voltage steps of 0.6 s duration from +40 to -100 mV were applied from a holding potential of -40 mV. Dashed lines indicate zero current. No activation of current was observed over 25 min of whole-cell recording (WCR). The lower panel shows mean data for a range of treatments: control, absence of PKA; PKA-Gd, PKA in the absence of bath GdCl3; Ca2+-free, effect of PKA in cells isolated in the absence of added Ca2+; cocktail, initial currents recorded after cell incubation for 30 min to 4 h in forskolin-db-cAMP mixture. No significant difference between any treatments were noted (ANOVA, P > 0.05).

  DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

Effect of acute salt loading

Given the known contribution of increased proximal tubule Na+ outflow to volume natriuresis in other species (Miller et al. 1996) it was important to investigate this phenomenon in a study of proximal tubule function. In the present study we gave a moderate volume expansion, with control animals receiving a total saline load of around 2 % of body weight and treated animals receiving a total infusion of around 6 % of body weight. Animals were weight matched so that the fixed infusion protocol resulted in equivalent saline loads. This protocol was sufficient to cause approximately 5-fold increases in urine Na+ output (Table 1), though only a slight fall in haematocrit was noted. The diuresis induced by the protocol was variable and only significant in CF mice. Whether this represents a difference in the status of the urine concentrating mechanism in CF animals cannot be determined from these data. The secretion of ADH associated with anaesthesia (Bonjour & Malvin, 1970) complicates interpretation of this observation and further investigation is needed. The main observation from these experiments was that the natriuresis induced by volume expansion in Cftrtm2cam DeltaF508 mice was not different from controls. However, the data suggest differences in the mechanism by which a volume load is cleared between wild-type and Cftrtm2cam DeltaF508 mice. For instance, in wild-type mice there was a significant increase in GFR, which was not observed in Cftrtm2cam DeltaF508 mice. This probably contributed to the higher fractional Na+ excretion observed in CF mice during volume expansion, such that these animals allowed more Na+ to escape tubular absorption to achieve a comparable volume natriuresis. The nephron location of this reduced Na+ reabsorption cannot be determined from the data, but the response is not consistent with the enhanced proximal tubular absorption reported in CF patients by several groups (Robson et al. 1971; Berg et al. 1982; Stenvinkel et al. 1991; Donckerwolcke et al. 1992). In general very little is currently known about the mechanisms responsible for volume natriuresis in the mouse. In a recent study, Cervenka et al. (1999) applied a saline load of 5 % of the body weight. The response of wild-type mice, albeit of a different strain, was very similar to the present study. No change in mean arterial blood pressure occurred, whilst GFR and absolute sodium excretion increased to approximately the same degree. Enhanced fractional Na+ reabsorption indicates that the mouse excretes a salt load both by increasing GFR and also by reducing the proportion of filtered Na+ absorbed by the tubule. Further work will be required to define the contribution of different nephron segments to volume natriuresis in the mouse.

In situ microperfusion

The purpose of these experiments was to test directly whether proximal tubule reabsorption was altered in Cftrtm2cam DeltaF508 mice. In CF patients, the observation of reduced lithium clearance (CLi) by Donckerwolcke et al. (1992) indicated an increase in proximal reabsorption. Stenvinkel et al. (1991) found no difference in CLi, though absolute proximal reabsorption (GFR - CLi) was increased in CF patients. The observation of reduced free water clearance in CF patients (Robson et al. 1971; Berg et al. 1982; Donckerwolcke et al. 1992) has led to the idea that excess Na+ reabsorption in the proximal nephron limits salt delivery to the loop of Henle, so reducing the diluting capacity (Robson et al. 1971; Berg et al. 1982). However, Donckerwolcke et al. (1992) proposed that the cause of reduced free water clearance was a reabsorptive defect in the diluting segment itself and that increased proximal tubule reabsorption was a compensatory effect. By using CF mice it was possible to measure proximal tubule fluid reabsorption directly by renal micropuncture. Examining basal rates of fluid absorption (Fig. 2) we observed a rate of around 2 nl mm-1 min-1, which is around 20 % higher than observed for some other strains of mouse (Wang et al. 1999). However, there was no difference between wild-type and Cftrtm2cam DeltaF508 mice, indicating that no hyper-absorption occurs in proximal tubule in this model of CF.

Wang et al. (1995) reported that in the microperfused rat proximal tubule, fluid absorptive rate was increased by cAMP stimulation. They further showed that this effect only occurred when there was a significant transepithelial [Cl-] gradient and that Cl- channel blockers could inhibit the stimulatory effect of cAMP. The model proposed included cAMP-dependent Cl- channels in both the apical and basolateral membranes, which would allow the transepithelial movement of Cl- along the favourable gradient. It is interesting to note that the stilbene derivative 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid (DIDS) was not an effective blocker when applied from the luminal side. Since external DIDS does not readily block CFTR (Kartner et al. 1991), this raised the possibility that CFTR could be the apical Cl- channel. Thus we also set out to test the hypothesis that cAMP stimulation would result in an increase in proximal tubule fluid absorption, which would not occur in the Cftrtm2cam DeltaF508 mice. Knowing plasma [Cl-] from the foregoing clearance study, the perfusate contained 149 mM Cl-, providing approximately a 30-40 mM transepithelial [Cl-] gradient to promote Cl- absorption. However, we observed no significant change in fluid absorption in either wild-type or Cftrtm2cam DeltaF508 mice during cAMP stimulation.

CFTR expression in proximal nephron

Given the foregoing data from clearance and tubular microperfusion experiments, there was no evidence to suggest a significant defect in proximal tubule function. It was important, therefore, to further investigate the expression of CFTR in mouse proximal nephron. Slices of outer cortex were used to enrich the preparation for proximal tubule cells. In preliminary studies we observed that 20/22 cells responded to addition of glucose and amino acids by swelling, indicating a proximal tubule phenotype. In addition, when mapping the course of tubules during micropuncture only 7/82 tubules had a visible surface distal tubule convolution. When RT-PCR was performed using CFTR-specific primers, clear expression of CFTR mRNA was observed. The presence of CFTR expression in mouse outer cortex, with a probable proximal tubule origin, was not consistent with the normal function seen in Cftrtm2cam DeltaF508 mice. We therefore conducted patch clamp studies in parallel to assay functional channel expression. Using a variety of approaches known to activate CFTR in other tissues we were unable to find evidence of CFTR-like whole-cell currents (or any other cAMP-dependent Cl- currents) in 37 recordings. These data suggest that the CFTR protein does not reach the plasma membrane to form functional channels in mouse proximal nephron.

There is a general consensus that CFTR mRNA is expressed in proximal tubule from several species including rat, human and rabbit (Morales et al. 1996; Rubera et al. 1998). In agreement with our current findings, whole-cell currents resembling CFTR were not observed in MDCK type II cells, derived from dog proximal tubule (Mohamed et al. 1997), or in primary cultures of rabbit proximal tubule (Rubera et al. 1998). Evidence for the expression of cAMP-dependent Cl- channels in proximal tubule has been obtained from single-channel recordings in the rat (Darvish et al. 1994), rabbit (Suzuki et al. 1991) and Ambystoma (Segal & Boulpaep, 1992). It may be, therefore, that some feature of the whole-cell recording configuration (e.g. washout of cytoplasmic factors) is responsible for the absence of currents. In the case of CFTR at least, this seems unlikely, since CFTR currents have been recorded in whole-cell mode in numerous other studies.

Renal function in cystic fibrosis mice

The present clearance experiments show that under basal conditions there is no apparent difference between wild-type and cystic fibrosis mice with respect to NaCl excretion. CF mice have both comparable GFR and fractional NaCl excretion rates to control animals. CF mice are able to mount a comparable volume natriuresis to control animals and are also equally able to adapt to chronic salt restriction by reducing renal Na+ excretion (Kibble et al. 2000). However, there are some differences in the mechanisms by which CF mice cope with these stresses. In the case of volume expansion, they do not significantly increase GFR in the same way as controls, relying on relatively less Na+ reabsorption by the tubule. During salt restriction, amiloride-sensitive Na+ reabsorption is almost doubled in CF animals. This suggests that while control animals recruit Na+-conserving mechanisms at more proximal sites, CF mice rely more on the distal tubule and collecting duct to increase Na+ reabsorption under these circumstances. To date only two studies have investigated the transport properties of single nephrons from CF mice. The present study shows that the proximal tubule is unaffected under basal conditions. Marvão et al. (1998) used isolated perfused cortical thick ascending limbs and similarly found no difference in Cl- absorption between cftrm1Unc-null CF mice and controls. Further studies are indicated to investigate the potential significance of interactions between CFTR and other proteins such as the epithelial Na+ channel ENaC (Schreiber et al. 1999) and the K+ channel ROMK (Ho, 1998). Analysis of single nephron function during application of renal stresses will also be important.

  REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

ALADJEM M., LOTAN, D., BOICHIS, H., ORDA, S. & KATZNELSON, D. (1983). Renal function in patients with cystic fibrosis. Nephron 4, 84-86
BERG U., KUSOFFSKY, E. & STRANDVIK, B. (1982). Renal function with special reference to sodium handling. Acta Paediatrica Scandinavica 71, 833-838 [Medline]
BISHOP J. V. H., GREEN, R. & THOMAS, S. (1978). Effects of glucose on water and sodium reabsorption in the proximal convoluted tubule of the rat kidney. Journal of Physiology 275, 481-493 [Abstract]
BONJOUR J. P. & MALVIN, R. L. (1970). Plasma concentrations of ADH in conscious and anaesthetized dogs. American Journal of Physiology 218, 1128-1132 [Medline]
CERVENKA L., MITCHELL, K. D., OLIVERIO, M. I., COFFMAN, T. M. & NAVAR, L. G. (1999). Renal function in the AT1A receptor knockout mouse during normal and volume-expanded conditions. Kidney International 56, 1855-1862 [Medline]
COLLEDGE W. H., ABELLA, B. S., SOUTHERN, K. W., RATCLIFF, R., JIANG, C., CHENG, S. H., MACVINISH, L. J., ANDERSON, J. R., CUTHBERT, A. W. & EVANS, M. J. (1995). Generation and characterization of a DeltaF508 cystic fibrosis mouse model. Nature Genetics 10, 445-452 [Medline]
CRAWFORD I., MALONEY, P. C., ZEITLIN, P. L., GUGGINO, W. B., HYDE, S. C., TURLEY, H., GATTER, K. C., HARRIS, A. & HIGGINS, C. F. (1991). Immunocytochemical localization of the cystic fibrosis gene product CFTR. Proceedings of the National Academy of Sciences of the USA 88, 9262-9266 [Abstract]
DARVISH N., WINAVER, J. & DAGAN, D. (1994). Diverse modulations of chloride channels in renal proximal tubules. American Journal of Physiology 267, F716-724 [Medline]
DEVUYST O., BURROW, C. R., SCHWIEBERT, E. M., GUGGINO, W. B. & WILSON, P. D. (1996). Developmental regulation of CFTR expression during human nephrogenesis. American Journal of Physiology 271, F723-735. [Medline]
DONCKERWOLCKE R. A., VAN DIEMEN-STEENVOORDE, R., VAN DER LAAG, J., KOOMANS, H. A. & BOER, W. H. (1992). Impaired diluting segment chloride reabsorption in patients with cystic fibrosis. Clinical Investigation 12, 186-191
GRAY M. A., PLANT, S. & ARGENT, B. E. (1993). cAMP-regulated whole-cell chloride currents in pancreatic duct cells. American Journal of Physiology 264, C591-602 [Medline]
HAMILL O. P., MARTY, A., NEHER, E., SAKMANN, B. & SIGWORTH, F. J. (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell free membrane patches. Pflügers Archiv 391, 85-100. [Medline]
HO K. (1998). The ROMK-cystic fibrosis transmembrane conductance regulator connection: new insights into the relationship between ROMK and the cystic fibrosis transmembrane conductance regulator. Current Opinion in Nephrology and Hypertension 7, 49-58 [Medline]
KARTNER N., HANRAHAN, J. W., JENSEN, T. J., NAISMITH, A. L., SUN, S., ACKERLY, A., REYES, E. F., TSUI, L.-C., ROMMENS, J. M., BEAR, C. E. & RIORDAN, J. R. (1991). Expression of the cystic fibrosis gene in non-epithelial invertebrate cells produces a regulated anion conductance. Cell 64, 681-691 [Medline]
KIBBLE J. D., NEAL, A. M., COLLEDGE, W. H., GREEN, R. & TAYLOR, C. J. (2000). Evidence for cystic fibrosis transmembrane conductance regulator-dependent sodium reabsorption in kidney, using Cftrtm2cam mice. Journal of Physiology 526, 27-34 [Abstract/Full Text]
KOCH C. & HOIBY, N. (1993). Pathogenesis of cystic fibrosis. Lancet 341, 1065-1069 [Medline]
LIPKOWITZ M. S. & ABRAMSON, R. G. (1989). Modulation of the ionic permeability of renal cortical brush-border membranes by cAMP. American Journal of Physiology 257, F769-776 [Medline]
MARVÃO P., DE JESUS FERREIRA, M.-C., BAILLY, C., PAULAIS, M., BENS, M., GUINAMARD, R., MOREAU, R., VANDEWALLE, A & TEULON, J. (1998). Cl- absorption across the thick ascending limb is not altered in cystic fibrosis mice. A role for pseudo-CFTR channel. Journal of Clinical Investigation 102, 1986-1993 [Abstract/Full Text]
MILLER J. A., TOBE, S. W. & SKORECKI, K. L. (1996). Control of extracellular fluid volume and pathophysiology of edema formation. In The Kidney, ed. BRENNER, B. M., pp. 817-872. W.B. Saunders Company, Philadelphia
MOHAMED A., FERGUSON, D., SEIBERT, F. S., CAI, H. M., KARTNER, N., GRINSTEIN, S., RIORDAN, J. R. & LUKACS, G. L. (1997). Functional expression and apical localization of the cystic fibrosis transmembrane conductance regulator in MDCK I cells. Biochemical Journal 322, 259-265 [Medline]
MORALES M. M., CARROLL, T. P., MORITA, T., SCHWEIBERT, E. M., DEVUYST, O., WILSON, P. D., LOPES, A. G., STANTON, B. A., DIETZ, H. C., CUTTING, G. R. & GUGGINO, W. B. (1996). Both the wild-type and a functional isoform of CFTR are expressed in kidney. American Journal of Physiology 270, F1038-1048 [Medline]
ROBSON A. M., TATEISHI, S., INGELFINGER, J. R., STROMINGER, D. B. & KLAHR, S. (1971). Renal function in patients with cystic fibrosis. Journal of Paediatrics 79, 42-50
RUBERA I., TAUC, M., BIDET, M., POUJEOL, C., CUILLER, B., WATRIN, A., TOURET, N. & POUJEOL, P. (1998). Chloride currents in primary cultures of rabbit proximal and distal convoluted tubules. American Journal of Physiology 275, F651-663 [Medline]
SCHREIBER R., HOPF, A., MALL, M., GREGER, R. & KUNZELMANN, K. (1999). The first nucleotide binding domain of the cystic fibrosis transmembrane conductance regulator is important for inhibition of the epithelial Na+ channel. Proceedings of the National Academy of Sciences of the USA 96, 5310-5315 [Abstract/Full Text]
SEGAL A. S. & BOULPAEP, E. L. (1992). cAMP-activated chloride channel on the basolateral membrane of renal proximal tubule. Journal of the American Society of Nephrology 3, 819.
SEGAL A. S., GEIBEL, J. & BOULPAEP, E. L. (1993). A chloride channel in the basolateral membrane of rabbit proximal tubule. Journal of the American Society of Nephrology 4, 879
SEKI G., TANIGUCHI, S., UWATOKO, S., SUZUKI, K. & KUROKAWA, K. (1995). Activation of the basolateral Cl- conductance by cAMP in rabbit renal proximal tubule S3 segments. Pflügers Archiv 430, 88-95 [Medline]
STANTON B. A. (1997). Cystic fibrosis transmembrane conductance regulator (CFTR) and renal function. Wiener Klinische Wochenschrift 109, 457-464 [Medline]
STENVINKEL P., HJELTE, G. A., HEDMAN, A., HULTMAN, E. & STRANDVIK, B. (1991). Decreased renal clearance of sodium in cystic fibrosis. Acta Paediatrica Scandinavica 80, 194-198 [Medline]
SUZUKI M., MORITA, K., HANAOKA, Y., KAWAGUCHI, Y. & SAKAI, O. (1991). A Cl- channel activated by parathyroid hormone in rabbit renal proximal tubule cells. Journal of Clinical Investigation 88, 735-742 [Medline]
WANG T., SEGAL, A. S., GIEBISCH, G. & ARONSON, P. S. (1995). Stimulation of chloride transport by cAMP in rat proximal tubules. American Journal of Physiology 268, F204-210 [Medline]
WANG T., YANG, C.-L., ABBIATI, T., SCHULTHEIS, J., SHULL, G. E., GIEBISCH, G. & ARONSON, P. S. (1999). Mechanism of proximal tubule bicarbonate absorption in NHE3 null mice. American Journal of Physiology 277, F298-302 [Medline]

Acknowledgements

We thank the Wellcome Trust, Royal Society, National Kidney Research Fund and Sheffield Children's Appeal for financial support. The technical assistance of Sarah Jennings is gratefully acknowledged.

Corresponding author

J. Kibble: Department of Biomedical Science, University of Sheffield, Alfred Denny Building, Western Bank, Sheffield S10 2TN, UK.

Email: j.kibble{at}sheffield.ac.uk




This article has been cited by other articles:


Home page
ThoraxHome page
K. W Southern
Acute renal failure in people with cystic fibrosis
Thorax, June 1, 2007; 62(6): 472 - 473.
[Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
F. Jouret, A. Bernard, C. Hermans, G. Dom, S. Terryn, T. Leal, P. Lebecque, J.-J. Cassiman, B. J. Scholte, H. R. de Jonge, et al.
Cystic Fibrosis Is Associated with a Defect in Apical Receptor-Mediated Endocytosis in Mouse and Human Kidney
J. Am. Soc. Nephrol., March 1, 2007; 18(3): 707 - 718.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. Feil, S. M. Lohmann, H. de Jonge, U. Walter, and F. Hofmann
Cyclic GMP-Dependent Protein Kinases and the Cardiovascular System: Insights From Genetically Modified Mice
Circ. Res., November 14, 2003; 93(10): 907 - 916.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
G. Laverty, C. McWilliams, A. Sheldon, and S. S. Arnason
PTH stimulates a Cl--dependent and EIPA-sensitive current in chick proximal tubule cells in culture
Am J Physiol Renal Physiol, May 1, 2003; 284(5): F987 - F995.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
O. Devuyst and W. B. Guggino
Chloride channels in the kidney: lessons learned from knockout animals
Am J Physiol Renal Physiol, December 1, 2002; 283(6): F1176 - F1191.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kibble, J. D.
Right arrow Articles by Taylor, C. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kibble, J. D.
Right arrow Articles by Taylor, C. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS