| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Journal of Physiology (2001), 533.1, pp. 119-125
© Copyright 2001 The Physiological Society
subunit gene expression underlies the gradient of transient outward current in canine and human ventricle |
ABSTRACT |
|---|
 TopAbstract IntroductionMethodsResultsDiscussionReferences |
|---|
subunits was examined in canine heart. Only one member of the gene family, KChIP2, was expressed in heart.
subunit mRNA was expressed at equal levels across the ventricular wall.
subunit gene, rather than the Kv4.3 subunit gene, is the primary determinant regulating the transmural gradient of Ito expression in the ventricular free wall of canine and human heart.
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Transmural gradients of ion channel expression in the ventricular wall are critical determinants of myocardial function (Antzelevitch et al. 1991; Nabauer, 1998). These gradients determine the different action potential durations in epicardial and endocardial myocardium and, consequently, the concordant polarity of the T-wave of the ECG (Burgess, 1979; Franz et al. 1991; Yan & Antzelevitch, 1998). One classic example of a transmural gradient in ion channel expression is the gradient of transient outward current (Ito) expression across the ventricular free wall (Furukawa et al. 1990; Liu et al. 1993; Clark et al. 1993; Nabauer et al. 1996; Brahmajothi et al. 1999). In many species, including canine and human, Ito is significantly larger in epicardial myocytes than in endocardial myocytes (Liu et al. 1993; Wettwer et al. 1994; Nabauer et al. 1996; Li et al. 1998). In addition, the biophysical properties of the current differ between endocardium and epicardium. In particular, epicardial Ito recovers more rapidly from inactivation than does endocardial Ito (Nabauer et al. 1996; Li et al. 1998; Yu et al. 2000).
It has been proposed that Ito in the ventricle of canine and human heart is encoded primarily by the Kv4.3 gene (Dixon et al. 1996; Kaab et al. 1998). The Kv4.3 gene was originally identified in canine heart and it was shown to encode a channel that has most, but not all, of the functional properties of the native Ito channels found in the bulk of the ventricular myocardium (Dixon et al. 1996). One unresolved problem with this hypothesis is that it cannot adequately explain the gradient of Ito expression in the ventricular free wall of canine and human heart (Liu et al. 1993; Nabauer et al. 1996).
Recently, it has been shown that channel subunits encoded by Kv4 genes form heteromeric complexes in vivo with subunits encoded by the KChIP gene family (An et al. 2000). Co-assembly of the KChIP subunits with Kv4 subunits results in a significant increase in the size of the currents and in an increase in the rate of recovery from inactivation (An et al. 2000). In this paper it is shown that differential expression of a subunit gene, KChIP2, can account for the transmural gradient of Ito expression in canine and human heart, but not in rat heart, in which an subunit gene, Kv4.2, is the primary determinant.
|
METHODS |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
All animal procedures were approved by the Institutional Animal Care and Use Committee of SUNY at Stony Brook.
Preparation of cDNA templates
cDNA templates were prepared by reverse transcription and PCR amplification from total RNA isolated from canine, human or rat heart or brain using the primers listed in Table 1.
The complete rat KChIP4 sequence has been submitted to GenBank (accession nos AF345444, AF345445). The canine Kv4.3 and rat Kv4.2 templates have been described previously (Dixon & McKinnon, 1994; Dixon et al. 1996).
Preparation of mRNA and RNase protection assay
Canine and human heart tissue samples were obtained as follows. Adult mongrel dogs weighing 18-25 kg were killed with pentobarbital (80 mg kg-1 I.V.) and their hearts were quickly removed. Human ventricular myocardium was obtained from explanted donor hearts unsuitable for transplantation (gift of Dr Stephan Kaab, University of Munchen), as approved by the University's ethics committee after receipt of the necessary consent. Small strips of approximately 2 mm thickness were dissected from the left ventricular endocardial surface taking care to avoid Purkinje fibres. Similar strips were prepared from the epicardial surface taking care to avoid major blood vessels. Midmyocardial strips of approximately 4 mm thickness were taken from the centre of the left ventricular wall. Total RNA was prepared and RNase protection assays were performed as described previously (Dixon et al. 1996).
Rat RNA was prepared as described previously (Dixon & McKinnon, 1994). Rats were anaesthetized with sodium pentobarbital (40 mg kg-1 I.P.) and then decapitated before tissues were removed.
Preparation of isolated canine ventricular myocytes and electrophysiological recordings
Canine cardiac myocytes were obtained from regions of the tissue corresponding to those used for RNA analysis. Cell isolation and recording of Ito were performed as described previously (Yu et al. 2000). The pipette solution contained (mM): potassium aspartate 130, MgCl2 2, CaCl2 5, EGTA 11 and Na-Hepes 10, pH 7.2. The extracellular solution contained (mM): NaCl 140, KCl 5.4, MgCl2 1, CaCl2 1.8, Na-Hepes 5 and glucose 10. To reduce Ca2+ current contamination, CdCl2 (0.2 mM) and MnCl2 (2 mM) were added to the extracellular solution. Experiments were performed at room temperature (22-23 °C).
Ito was elicited from a holding potential of -70 mV, by 500 ms voltage steps ranging from -20 to +50 mV (in 10 mV increments). Each step was preceded by a 10 ms pulse to -45 mV to partially inactivate the inward Na+ current. Ito was calculated as the difference between the peak current amplitude and the steady-state current measured at 500 ms. For comparisons, the peak current was measured in response to a +50 mV depolarization (close to the Na+ current reversal potential) to minimize contamination with voltage-activated Na+ currents. Ito inhibition by flecainide was measured as the percentage decrease in the area delimited by the current trace after subtraction of the steady-state current value.
Expression in Xenopus oocytes
Xenopus oocytes were collected under 0·1 % tricaine anaesthesia from frogs that were humanely killed after the final extraction. A full-length KChIP2 cDNA was amplified from rat heart cDNA using the following oligonucleotides: ATGCGGGGCCAGGGCCGCAAGG (forward) and CTAGATGACATTGTCAAAGAGCTGCATG (reverse). The Kv4.3 clone and methods for recording from oocytes have been described previously (Dixon et al. 1996).
|
RESULTS |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Potassium channel gene and Ito expression across canine ventricular free wall
It has been shown previously that the Kv4.3 channel underlies the majority of Ito in canine ventricle (Dixon et al. 1996). One result in apparent conflict with this conclusion is the fact that there is no gradient in Kv4.3 mRNA expression across the ventricular free wall (Fig. 1A). Kv4.3 mRNA transcripts were equally abundant in endocardial, midmyocardial and epicardial tissues (Fig. 1B). In marked contrast to the pattern of Kv4.3 mRNA expression, there was a steep gradient in Ito expression across canine left ventricular free wall (Fig. 1C), as has been reported previously (Liu et al. 1993). There was a 7.5-fold increase in Ito expression in epicardial myocytes compared to endocardial myocytes (Fig. 1D). Midmyocardial Ito expression was intermediate, although closer to that of epicardium. It is possible that a potassium channel gene other than Kv4.3 could contribute to the gradient of Ito expression in canine heart. However, the Kv1.4 gene is the only alternative candidate in canine heart (Dixon et al. 1996), and it was found to be expressed at a constant, very low, level across the ventricular free wall (data not shown).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 1 A, Kv4.3 mRNA expression across the left ventricular free wall of canine heart determined by RNase protection analysis. En, endocardium; M, midmyocardium; Ep, epicardium; P, probe; t, negative control tRNA; cyc, cyclophilin. There was 5 µg of total RNA in each sample and the x-ray film was exposed overnight. B, histogram comparing the relative abundance of Kv4.3 mRNA transcripts in endocardium, midmyocardium and epicardium. Error bars indicate S.E.M. (n = 4). C, recordings of Ito obtained from endocardial, midmyocardial and epicardial myocytes isolated from canine left ventricular free wall. The currents were elicited in response to 500 ms depolarizing voltage steps (traces are truncated in the figure) ranging from -20 to +50 mV in 10 mV increments, from a holding potential of -70 mV at a frequency of 0.1 Hz. D, histogram comparing the magnitude of Ito in endocardial, midmyocardial and epicardial myocytes. Ito was measured at +50 mV and was determined as the difference between the peak current and the plateau current at 500 ms. Data were normalized to cell capacitance. Error bars indicate S.E.M. (n = 11-14).
| ||
KChIP gene family expression in canine ventricle
Kv4 channels assemble in vivo as heteromeric complexes, composed of Kv4 subunits and subunits belonging to the KChIP family (An et al. 2000). When a native channel forms as a complex, containing more than one type of subunit, the relative availability of either or subunits can potentially limit channel expression. It has been shown that co-expression of KChIP proteins significantly increases the functional expression of the Kv4 channel complex in vitro (An et al. 2000). This suggested the hypothesis that the availability of one or more KChIP subunits might limit expression of the Ito channel, thereby regulating Ito expression across the ventricular free wall. To test this possibility we first examined the expression of the four known KChIP genes in canine ventricle. Only one of the four KChIP genes, KChIP2, was found to be expressed at detectable levels in canine left ventriclar free wall (Fig. 2A).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 2 A, KChIP1, KChIP2, KChIP3 and KChIP4 mRNA expression in the left ventricular free wall of canine heart determined by RNase protection analysis. Only KChIP2 is expressed at detectable levels in canine left ventricle. The weak, lower protected band in the brain sample for KChIP3 is due either to a polymorphism or to a single-base error in the probe. V, left ventricle; C, positive control brain cortex; P, probe; t, negative control tRNA; cyc, cyclophilin. There was 5 µg of total RNA in the ventricular samples and 2.5 µg of total RNA in the cortical samples. B, KChIP2 mRNA expression across the left ventricular free wall of canine heart. En, endocardium; M, midmyocardium; Ep, epicardium. There was 5 µg of total RNA in each of the samples. C, histogram comparing the relative abundance of KChIP2 mRNA transcripts in endocardium, midmyocardium and epicardium. Data points for each independent experiment were normalized relative to expression in epicardium. Errors bars are S.E.M. (n = 4).
| ||
KChIP2 mRNA expression was examined in endocardial, midmyocardial and epicardial tissue samples dissected from the left ventricular free wall. KChIP2 mRNA was expressed in a steep gradient across the left ventricular free wall of canine heart (Fig. 2B), and was of low abundance in endocardium and expressed at high levels in epicardium. On average, KChIP2 mRNA expression was 25-fold higher in epicardium than in endocardium (Fig. 2C). Expression in midmyocardium was intermediate between endocardium and epicardium levels.
Co-expression of KChIP2 subunits with Kv4 channels in cell lines increases the magnitude of the expressed transient currents by a factor of 5.5- to 9.0-fold and by a smaller factor in Xenopus oocytes (An et al. 2000). The specific combination of KChIP2 and Kv4.3 has not been tested previously and to confirm that the two proteins interact, the KChIP2 and Kv4.3 subunits were co-expressed in Xenopus oocytes. The current produced by the Kv4.3-KChIP2 combination was markedly increased compared to that with Kv4.3 alone (3.5 (± 1.0)-fold, n = 17 and 20 for Kv4.3 and Kv4.3-KChIP2, respectively). The rate of recovery from inactivation was more rapid when the Kv4.3 channel was co-expressed with the KChIP2 subunit, confirming that the two proteins interact. Using a two-pulse protocol, recovery from inactivation was fitted with a monoexponential function to obtain 
values of 520 ± 46 ms (n = 13) for Kv4.3 alone and 64 ± 12 ms for Kv4.3-KChIP2, respectively (n = 11).
Pharmacological properties of the Ito channel in endocardial and epicardial myocytes
The results suggest that the difference in the magnitude and properties of Ito currents between endocardial and epicardial myocytes may be due to a change in the level of KChIP2 subunit expression rather than a change in Kv4.3 subunit expression. This predicts that the pore properties of the Ito channel should be the same in endocardial and epicardial myocytes, because currents in both tissues are carried predominantly by channels formed from Kv4.3 subunits. This prediction was tested using the channel blocker flecainide, which is a potent blocker of both Ito and the Kv4.3 channel. Flecainide can be used to distinguish between Kv4.3 channels and Kv1.4 channels because Kv1.4 channels are relatively insensitive to flecainide block (Yeola & Snyders, 1997).
Both the endocardial and epicardial Ito were blocked by flecainide (Fig. 3A). Dose-response analysis of flecainide block showed that the IC50 for channel blockade of Ito was almost identical in the two tissues (Fig. 3B), suggesting that the Kv4.3 subunit is a primary component of the native Ito channel complex in both endocardial and epicardial myocytes.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 3 A, effect of flecainide on Ito in epicardial and endocardial myocytes isolated from canine left ventricular free wall. Ito elicited in a representative epicardial (top) and endocardial (bottom) myocyte by a 300 ms voltage step to +50 mV, in control conditions or in the presence of 100 µM flecainide, as indicated. B, comparison of the dose-response curve for flecainide block of Ito in endocardial and epicardial myocytes. Plotted data points represent the mean values (± S.E.M.) for the percentage blockade of Ito (measured as the current-time integral) for different flecainide concentrations in epicardial (
| ||
Kv4.3 and KChIP2 gene expression in human heart
There is a gradient in Ito expression across the left ventricular free wall of human heart that is analogous to that found in canine heart (Nabauer et al. 1996). There was a correspondingly steep gradient of KChIP2 mRNA across the left ventricular free wall of human heart, whereas expression of Kv4.3 mRNA was constant (Fig. 4A). This suggests that there is a common mechanism by which Ito expression is regulated in canine and human ventricular myocytes.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 4 A, KChIP2 and Kv4.3 mRNA expression across the left ventricular free wall of human heart determined by RNase protection analysis. B, KChIP2 and Kv4.2 mRNA expression across the left ventricular free wall of rat heart. Pa, papillary muscle; En, endocardium; M, midmyocardium; Ep, epicardium; P, probe; t, negative control tRNA; cyc, cyclophilin.
| ||
KChIP gene family expression in rat heart
There are marked differences in the molecular mechanisms regulating Ito expression in the hearts of large and small mammals. In particular, the Kv4.2 gene makes a significant contribution to Ito in small mammals (Dixon & McKinnon, 1994; Fiset et al. 1997), whereas this gene is not expressed in canine and human heart (Dixon et al. 1996). In rat, and possibly other small mammals, the gradient in Ito expression across the left ventricular free wall appears to be a product of the gradient in Kv4.2 gene expression (Dixon & McKinnon, 1994). This suggests the possibility that regulation of KChIP2 gene expression may not be a primary determinant of Ito expression in small mammals. To address this possibility, the expression of all four KChIP genes was examined in rat heart. KChIP2 mRNA was the predominant KChIP mRNA, although there was also a very low level of KChIP3 expression (not shown). KChIP2 mRNA was expressed at very high levels in rat heart, significantly higher than that found in canine heart. In marked contrast to the results in canine and human heart, KChIP2 mRNA was expressed at uniformly high levels across the left ventricular free wall of rat heart (Fig. 4B). The pattern of KChIP2 gene expression was clearly distinguishable from the pattern of Kv4.2 gene expression. Kv4.2 mRNA was expressed in a steep gradient across the rat left ventricular free wall (Fig. 4B).
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
There is a steep gradient of KChIP2 mRNA expression across the ventricular free wall of canine and human heart. KChIP2 mRNA is 25-fold more abundant in the epicardium than in the endocardium of canine heart. The gradient of KChIP2 mRNA expression parallels the gradient in Ito expression across the ventricular free wall (Fig. 1; Liu et al. 1993; Nabauer et al. 1996). Many native channels, including Kv4 channels (An et al. 2000), exist as heteromeric complexes containing both and subunits and, as a consequence, the abundance of either or subunits can potentially limit cell surface expression of the channel complex. In canine and human myocytes, the Kv4.3 gene is expressed at constant levels throughout the ventricular wall, suggesting that the major factor limiting the expression of the Ito channel complex in endocardial and midmyocardial myocytes is the abundance of KChIP2 subunits. This implies that it is the regulation of expression of the KChIP2 subunit gene, rather than the Kv4.3 subunit gene, that is the primary determinant regulating the transmural gradient of Ito expression in the ventricular free wall of these species.
The gradient in KChIP2 mRNA expression is larger than that of Ito expression, which is not entirely unexpected. Kv4.3 subunits can form functional channels in the absence of the KChIP2 subunit in vitro, and presumably this is also true in vivo. It is possible, therefore, that Ito channel complexes found in endocardial cells lack the KChIP2 subunit. This may account, at least in part, for the different rates of recovery from inactivation of endocardial and epicardial Ito (Nabauer et al. 1996; Li et al. 1998; Yu et al. 2000). The results do not exclude the possibility that there are other components of the native Ito complex and the kinetic differences between endocardial and epicardial Ito may not be solely attributable to the presence or absence of the KChIP2 subunit. There is indirect evidence for other subunits that can also modify the kinetic properties of the Kv4 channel complex (Chabala et al. 1993; An et al. 2000).
In both small and large mammals there is a gradient of Ito expression across the ventricular free wall (Furukawa et al. 1990; Liu et al. 1993; Clark et al. 1993; Nabauer et al. 1996; Brahmajothi et al. 1999). It is notable that the gradient of Ito expression across the ventricular free wall in small mammals is apparently produced by a quite different molecular mechanism to that used in large mammals. Small mammals such as rat express a second Kv4 channel known as Kv4.2, in addition to the Kv4.3 channel, and in these animals there is a gradient in Kv4.2 mRNA expression (Dixon & McKinnon, 1994), which is thought to underlie the gradient in Ito expression. In the rat heart, KChIP2 mRNA is extremely abundant, and it remains likely that the abundance of the Kv4.2 subunit is the major determinant of the gradient in Ito expression in this species (Dixon & McKinnon, 1994). This is in marked contrast to large mammals, such as canine and human, which do not express the Kv4.2 gene (Dixon et al. 1996).
In canine heart there is no significant difference in the sensitivity of the endocardial and epicardial Ito to blockade by flecainide. Since sensitivity to channel blockade by flecainide distinguishes Kv4 channels from the Kv1.4 channel (Dixon et al. 1996; Yeola & Snyders, 1997), this result suggests that the Kv1.4 channel makes a minimal contribution to the endocardial Ito in canine heart. It has been proposed that the Kv1.4 channel may underlie the endocardial Ito in ferret and possibly in other species (Brahmajothi et al. 1999). A potential problem with this hypothesis has been the difficulty in explaining why Kv4 channels are not also expressed in endocardium when significant Kv4 mRNA is present. A gradient in KChIP2 expression may exist in species other than canine and human heart and this may account for the great reduction or apparent absence of Kv4 channels in endocardial myocytes in these species.
Common to both large and small mammals is the fact that there is a transmural gradient of gene expression across the ventricle wall, which appears to be the primary mechanism underlying the gradient in Ito expression. Two potassium channel genes, Kv4.2 and KChIP2, are expressed in a steep gradient across the ventricular free wall in different species. It will be of interest to determine whether there are common transcriptional mechanisms regulating Kv4.2 and KChIP2 gene expression in the ventricular free wall of these different species, such as a gradient in the expression of one or more transcription factors.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
| AN W. F., BOWLBY, M. R., BETTY, M., CAO, J., LING, H. P., MENDOZA, G., HINSON, J. W., MATTSSON, K. I., STRASSLE, B. W., TRIMMER, J. S. & RHODES, K. J. (2000). Modulation of A-type potassium channels by a family of calcium sensors. Nature 403, 553-556 | [Medline] |
| ANTZELEVITCH C., SICOURI, S., LITOVSKY, S. H., LUKAS, A., KRISHNAN, S. C., DI DIEGO, J. M., GINTANT, G. A. & LIU, D. W. (1991). Heterogeneity within the ventricular wall. Circulation Research 69, 1427-1449 | [Medline] |
| BRAHMAJOTHI M. V., CAMPBELL, D. L., RASMUSSON, R. L., MORALES, M. J., TRIMMER, J. S., NERBONNE, J. M. & STRAUSS, H. C. (1999). Distinct transient outward potassium current (Ito) phenotypes and distribution of fast-inactivating potassium channel alpha subunits in ferret left ventricular myocytes. Journal of General Physiology 113, 581-600 | [Medline] |
| BURGESS M. J. (1979). Relation of ventricular repolarization to electrocardiographic T wave-form and arrhythmia vulnerability. Amercian Journal of Physiology 236, H391-402 | [Medline] |
| CHABALA L. D., BAKRY, N. & COVARRUBIAS, M. (1993). Low molecular weight poly(A)+ mRNA species encode factors that modulate gating of a non-Shaker A-type K+ channel. Journal of General Physiology 102, 713-728 | [Medline] |
| CLARK R. B., BOUCHARD, R. A., SALINAS-STEFANON, E., SANCHEZ-CHAPULA, J. & GILES, W. R. (1993). Heterogeneity of action potential waveforms and potassium currents in rat ventricle. Cardiovascular Research 27, 1795-1799 | [Medline] |
| DIXON J. E. & MCKINNON, D. (1994). Quantitative analysis of potassium channel mRNA expression in atrial and ventricular muscle of rats. Circulation Research 75, 252-260 | [Abstract] |
| DIXON J. E., SHI, W., WANG, H.-S., MACDONALD, C., YU, H., WYMORE, R., COHEN, I. S. & MCKINNON, D. (1996). Role of the Kv4. 3 potassium channel in ventricular muscle: a molecular correlate for the transient outward current. Circulation Research 79, 659-668 | [Abstract/Full Text] |
| FISET C., CLARK, R. B., SHIMONI, Y. & GILES, W. R. (1997). Shal-type channels contribute to the Ca2+-independent transient outward K+ current in rat ventricle. Journal of Physiology 500, 51-64 | [Abstract] |
| FRANZ M. R., BARGHEER, K., COSTARD-JACKLE, A., MILLER, D. C. & LICHTLEN, P. R. (1991). Human ventricular repolarization and T wave genesis. Progress in Cardiovascular Diseases 33, 369-384 | [Medline] |
| FURUKAWA T., MYERBURG, R. J., FURUKAWA, N., BASSETT, A. L. & KIMURA, S. (1990). Differences in transient outward currents of feline endocardial and epicardial myocytes. Circulation Research 67, 1287-1291 | [Abstract] |
| KAAB S., DIXON, J., DUC, J., ASHEN, D., NABAUER, M., BEUCKELMANN, D. J., STEINBECK, G., MCKINNON, D. & TOMASELLI, G. F. (1998). Molecular basis of transient outward potassium current downregulation in human heart failure: a decrease in Kv4. 3 mRNA correlates with a reduction in current density. Circulation 98, 1383-1393 | [Abstract/Full Text] |
| LI G.-R., FENG, J., YUE, L. & CARRIER, M. (1998). Transmural heterogeneity of action potentials and Ito1 in myocytes isolated from the human right ventricle. Amercian Journal of Physiology 275, H369-377 | [Medline] |
| LIU D. W., GINTANT, G. A. & ANTZELEVITCH, C. (1993). Ionic bases for electrophysiological distinctions among epicardial, midmyocardial, and endocardial myocytes from the free wall of the canine left ventricle. Circulation Research 72, 671-687 | [Abstract] |
| NABAUER M. (1998). Electrical heterogeneity in the ventricular wall - and the M cell. Cardiovascular Research 40, 248-250 | [Medline] |
| NABAUER M., BEUCKELMANN, D. J., UBERFUHR, P. & STEINBECK, G. (1996). Regional differences in current density and rate-dependent properties of the transient outward current in subepicardial and subendocardial myocytes of human left ventricle. Circulation 93, 168-177 | [Abstract/Full Text] |
| WETTWER E., AMOS, G. J., POSIVAL, H. & RAVENS, U. (1994). Transient outward current in human ventricular myocytes of subepicardial and subendocardial origin. Circulation Research 75, 473-482 | [Abstract] |
| YAN G.-X. & ANTZELEVITCH, C. (1998). Cellular basis for the normal T wave and the electrocardiographic manifestations of the long-QT syndrome. Circulation 98, 1928-1936 | [Abstract/Full Text] |
| YEOLA S. W. & SNYDERS, D. J. (1997). Electrophysiological and pharmacological correspondence between Kv4. 2 current and rat cardiac transient outward current. Cardiovascular Research 33, 540-547 | [Medline] |
| YU H., GAO, J., WANG, H., WYMORE, R., STEINBERG, S., MCKINNON, D., ROSEN, M. R. & COHEN, I. S. (2000). Effects of the renin-angiotensin system on the current Ito in epicardial and endocardial ventricular myocytes from the canine heart. Circulation Research 86, 1062-1068 | [Abstract/Full Text] |
Acknowledgements
This study was supported by grants HL-28958, NS-29755, HL-61269 and HL-20558.
Corresponding author
D. McKinnon: Department of Physiology, BST Room 124, Level 6, SUNY, Stony Brook, NY 11794-8661, USA.
Email: dmckinnon{at}notes.cc.sunysb.edu
This article has been cited by other articles:
|
|
 |
|
  N. Gaborit, S. Le Bouter, V. Szuts, A. Varro, D. Escande, S. Nattel, and S. Demolombe Regional and tissue specific transcript signatures of ion channel genes in the non-diseased human heart J. Physiol., July 15, 2007; 582(2): 675 - 693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kaab Variety is the spice of life: searching for the substrates of regional myocardial electrical properties J. Physiol., July 15, 2007; 582(2): 473 - 473. [Full Text] [PDF]
|
|
|
|
 |
|
 D. Goltz, J.-H. Schultz, C. Stucke, M. Wagner, P. Bassalay, A. P. Schwoerer, H. Ehmke, and T. Volk Diminished Kv4.2/3 but not KChIP2 levels reduce the cardiac transient outward K+ current in spontaneously hypertensive rats Cardiovasc Res, April 1, 2007; 74(1): 85 - 95. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Teutsch, R. P. Kondo, D. A. Dederko, J. Chrast, K. R. Chien, and W. R. Giles Spatial distributions of Kv4 channels and KChip2 isoforms in the murine heart based on laser capture microdissection Cardiovasc Res, March 1, 2007; 73(4): 739 - 749. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Gong, I. Bodi, C. Zobel, A. Schwartz, J. D. Molkentin, and P. H. Backx Calcineurin Increases Cardiac Transient Outward K+ Currents via Transcriptional Up-regulation of Kv4.2 Channel Subunits J. Biol. Chem., December 15, 2006; 281(50): 38498 - 38506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. N. Flaim, W. R. Giles, and A. D. McCulloch Contributions of sustained INa and IKv43 to transmural heterogeneity of early repolarization and arrhythmogenesis in canine left ventricular myocytes Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2617 - H2629. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Han, S. Nattel, T. Noguchi, and A. Shrier C-terminal Domain of Kv4.2 and Associated KChIP2 Interactions Regulate Functional Expression and Gating of Kv4.2 J. Biol. Chem., September 15, 2006; 281(37): 27134 - 27144. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Radicke, D. Cotella, E. M. Graf, U. Banse, N. Jost, A. Varro, G.-N. Tseng, U. Ravens, and E. Wettwer Functional modulation of the transient outward current Ito by KCNE {beta}-subunits and regional distribution in human non-failing and failing hearts Cardiovasc Res, September 1, 2006; 71(4): 695 - 703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. N. Obreztchikova, K. W. Patberg, A. N. Plotnikov, N. Ozgen, I. N. Shlapakova, A. V. Rybin, E. A. Sosunov, P. Danilo Jr., E. P. Anyukhovsky, R. B. Robinson, et al. IKr contributes to the altered ventricular repolarization that determines long-term cardiac memory Cardiovasc Res, July 1, 2006; 71(1): 88 - 96. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Li, S. Y. Um, and T. V. Mcdonald Voltage-Gated Potassium Channels: Regulation by Accessory Subunits Neuroscientist, June 1, 2006; 12(3): 199 - 210. [Abstract] [PDF]
|
|
|
|
 |
|
 C. F. Rossow, K. W. Dilly, and L. F. Santana Differential Calcineurin/NFATc3 Activity Contributes to the Ito Transmural Gradient in the Mouse Heart Circ. Res., May 26, 2006; 98(10): 1306 - 1313. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. S. Barth and S. Kaab MAPK = Mitogen-Activated Protein KChIP2?: Unraveling Signaling Pathways Controlling Cardiac Ito Expression Circ. Res., February 17, 2006; 98(3): 301 - 302. [Full Text] [PDF]
|
|
|
|
|
|
Y. Jia and K. Takimoto Mitogen-Activated Protein Kinases Control Cardiac KChIP2 Gene Expression Circ. Res., February 17, 2006; 98(3): 386 - 393. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Salvador-Recatala, W. J. Gallin, J. Abbruzzese, P. C. Ruben, and A. N. Spencer A potassium channel (Kv4) cloned from the heart of the tunicate Ciona intestinalis and its modulation by a KChIP subunit J. Exp. Biol., February 15, 2006; 209(4): 731 - 747. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Guo, W. E. Jung, C. Marionneau, F. Aimond, H. Xu, K. A. Yamada, T. L. Schwarz, S. Demolombe, and J. M. Nerbonne Targeted Deletion of Kv4.2 Eliminates Ito,f and Results in Electrical and Molecular Remodeling, With No Evidence of Ventricular Hypertrophy or Myocardial Dysfunction Circ. Res., December 9, 2005; 97(12): 1342 - 1350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Patel and D. L. Campbell Transient outward potassium current, 'Ito', phenotypes in the mammalian left ventricle: underlying molecular, cellular and biophysical mechanisms J. Physiol., November 15, 2005; 569(1): 7 - 39. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. W. Patberg, M. N. Obreztchikova, S. F. Giardina, A. J. Symes, A. N. Plotnikov, J. Qu, P. Chandra, D. McKinnon, S. R. Liou, A. V. Rybin, et al. The cAMP response element binding protein modulates expression of the transient outward current: Implications for cardiac memory Cardiovasc Res, November 1, 2005; 68(2): 259 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Nerbonne and R. S. Kass Molecular Physiology of Cardiac Repolarization Physiol Rev, October 1, 2005; 85(4): 1205 - 1253. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Gao, W. Wang, I. S. Cohen, and R. T. Mathias Transmural Gradients in Na/K Pump Activity and [Na+]i in Canine Ventricle Biophys. J., September 1, 2005; 89(3): 1700 - 1709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. G. Akar, R. C. Wu, G. J. Juang, Y. Tian, M. Burysek, D. DiSilvestre, W. Xiong, A. A. Armoundas, and G. F. Tomaselli Molecular mechanisms underlying K+ current downregulation in canine tachycardia-induced heart failure Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2887 - H2896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Rose, A. A. Armoundas, Y. Tian, D. DiSilvestre, M. Burysek, V. Halperin, B. O'Rourke, D. A. Kass, E. Marban, and G. F. Tomaselli Molecular correlates of altered expression of potassium currents in failing rabbit myocardium Am J Physiol Heart Circ Physiol, May 1, 2005; 288(5): H2077 - H2087. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Gallego, R. Setien, L. Puebla, M. d. C. Boyano-Adanez, E. Arilla, and O. Casis {alpha}1-Adrenoceptors stimulate a G{alpha}s protein and reduce the transient outward K+ current via a cAMP/PKA-mediated pathway in the rat heart Am J Physiol Cell Physiol, March 1, 2005; 288(3): C577 - C585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Szentadrassy, T. Banyasz, T. Biro, G. Szabo, B. I. Toth, J. Magyar, J. Lazar, A. Varro, L. Kovacs, and P. P. Nanasi Apico-basal inhomogeneity in distribution of ion channels in canine and human ventricular myocardium Cardiovasc Res, March 1, 2005; 65(4): 851 - 860. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Zicha, L. Xiao, S. Stafford, T. J. Cha, W. Han, A. Varro, and S. Nattel Transmural expression of transient outward potassium current subunits in normal and failing canine and human hearts J. Physiol., December 15, 2004; 561(3): 735 - 748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Caballero, R. Gomez, L. Nunez, I. Moreno, J. Tamargo, and E. Delpon Diltiazem inhibits hKv1.5 and Kv4.3 currents at therapeutic concentrations Cardiovasc Res, December 1, 2004; 64(3): 457 - 466. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Doronin, I. A. Potapova, Z. Lu, and I. S. Cohen Angiotensin Receptor Type 1 Forms a Complex with the Transient Outward Potassium Channel Kv4.3 and Regulates Its Gating Properties and Intracellular Localization J. Biol. Chem., November 12, 2004; 279(46): 48231 - 48237. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Bassani, J. Altamirano, J. L. Puglisi, and D. M. Bers Action potential duration determines sarcoplasmic reticulum Ca2+ reloading in mammalian ventricular myocytes J. Physiol., September 1, 2004; 559(2): 593 - 609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wakisaka, S. Niwano, H. Niwano, J. Saito, T. Yoshida, S. Hirasawa, H. Kawada, and T. Izumi Structural and electrical ventricular remodeling in rat acute myocarditis and subsequent heart failure Cardiovasc Res, September 1, 2004; 63(4): 689 - 699. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. N. Plotnikov, E. A. Sosunov, K. W. Patberg, E. P. Anyukhovsky, R. Z. Gainullin, I. N. Shlapakova, G. Krishnamurthy, P. Danilo Jr, and M. R. Rosen Cardiac Memory Evolves With Age in Association With Development of the Transient Outward Current Circulation, August 3, 2004; 110(5): 489 - 495. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. G. Birnbaum, A. W. Varga, L.-L. Yuan, A. E. Anderson, J. D. Sweatt, and L. A. Schrader Structure and Function of Kv4-Family Transient Potassium Channels Physiol Rev, July 1, 2004; 84(3): 803 - 833. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Decher, A. S. Barth, T. Gonzalez, K. Steinmeyer, and M. C. Sanguinetti Novel KChIP2 isoforms increase functional diversity of transient outward potassium currents J. Physiol., June 15, 2004; 557(3): 761 - 772. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Krumerman, X. Gao, J.-S. Bian, Y. F. Melman, A. Kagan, and T. V. McDonald An LQT mutant minK alters KvLQT1 trafficking Am J Physiol Cell Physiol, June 1, 2004; 286(6): C1453 - C1463. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. P. Patel, R. Parai, R. Parai, and D. L. Campbell Regulation of Kv4.3 voltage-dependent gating kinetics by KChIP2 isoforms J. Physiol., May 15, 2004; 557(1): 19 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Rosati and D. McKinnon Regulation of Ion Channel Expression Circ. Res., April 16, 2004; 94 |
, n = 4) and endocardial (
, n = 3) myocytes. Data points were fitted with the Hill equation. There was no significant difference in the IC50 for flecainide block for the two cell types (IC50 = 12.6 ± 1.2 and 10.8 ± 2.7 µM for endocardial and epicardial myocytes, respectively).