J Physiol Society Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 536, Number 2, 583-592, October 15, 2001
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Montgomery, D. E.
Right arrow Articles by Chandra, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Montgomery, D. E.
Right arrow Articles by Chandra, M.

Journal of Physiology (2001), 536.2, pp. 583-592
© Copyright 2001 The Physiological Society

Cardiac troponin T mutations: correlation between the type of mutation and the nature of myofilament dysfunction in transgenic mice


David E. Montgomery, Jil C. Tardiff * and Murali Chandra


Department of Physiology and Biophysics and Program in Cardiovascular Sciences, University of Illinois at Chicago, College of Medicine, Chicago, IL 60612 and * Department of Medicine, Albert Einstein College of Medicine, Bronx, NY 10461, USA

MS 12644 Resubmitted 25 April 2001; accepted after revision 13 June 2001

  ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

  1. The heterogenic nature of familial hypertrophic cardiomyopathy (FHC) in humans suggests a link between the type of mutation and the nature of patho-physiological alterations in cardiac myocytes. Exactly how FHC-associated mutations in cardiac troponin T (cTnT) lead to impaired cardiac function is unclear.
  2. We measured steady-state isometric force and ATPase activity in detergent-skinned cardiac fibre bundles from three transgenic (TG) mouse hearts in which 50, 92 and 6 % of the native cTnT was replaced by the wild type (WT) cTnT, R92Q mutant cTnT (R92Q) and the C-terminal deletion mutant of cTnT (cTnTDEL), respectively.
  3. Normalized pCa-tension relationships of R92Q and cTnTDEL fibres demonstrated a significant increase in sensitivity to Ca2+ at short (2.0 µm) and long (2.3 µm) sarcomere lengths (SL). At short SL, the pCa50 values, representing the midpoint of the pCa-tension relationship, were 5.69 ± 0.01, 5.96 ± 0.01 and 5.81 ± 0.01 for WT, R92Q and cTnTDEL fibres, respectively. At long SL, the pCa50 values were 5.81 ± 0.01, 6.08 ± 0.01 and 5.95 ± 0.01 for WT, R92Q and cTnTDEL fibres, respectively.
  4. The difference in pCa required for half-maximal activation (DeltapCa50) at short and long SL was 0.12 ± 0.01 for the R92Q (92 %) TG fibres, which is significantly less than the previously reported DeltapCa50 value of 0.29 ± 0.02 for R92Q (67 %) TG fibres.
  5. At short SL, Ca2+-activated maximal tension in both R92Q and cTnTDEL fibres decreased significantly (24 and 21 %, respectively; P < 0.005), with no corresponding decrease in Ca2+-activated maximal ATPase activity. Therefore, at short SL, the tension cost in R92Q and cTnTDEL fibres increased by 35 and 29 %, respectively (P < 0.001).
  6. The fibre bundles reconstituted with the recombinant mutant cTnTDEL protein developed only 37 % of the Ca2+-activated maximal force developed by recombinant WT cTnT reconstituted fibre bundles, with no apparent changes in Ca2+ sensitivity.
  7. Our data indicate that an important mutation-linked effect on cardiac function is the result of an inefficient use of ATP at the myofilament level. Furthermore, the extent of the mutation-induced dysfunction depends not only on the nature of the mutation, but also on the concentration of the mutant protein in the sarcomere.

  INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

Familial hypertrophic cardiomyopathy (FHC) is a disease of the sarcomere (Bonne et al. 1998). Mutations in several sarcomeric proteins are the cause of FHC and play a key role in the evolution of the systemic effects of this disease (Maron et al. 1987; Geisterfer-Lowrance et al. 1990). Two of the most lethal mutations associated with human FHC involve changes in cardiac troponin T (cTnT). A mutation that results in a C-terminal truncation of cTnT (cTnTDEL) and another in which there is a charge change at position 92 in cTnT (R92Q) both result in a hypercontractile phenotype in transgenic (TG) mice and a high frequency of sudden cardiac death in humans. Although previous studies have indicated that mutations linked to FHC function via a dominant-negative mode, a growing body of evidence supports the idea that a gain of function (that is, hypercontractility) may play a significant role in the complications associated with FHC. Hypercontractility (hypercontractile systolic function) is common in humans with FHC-associated mutations (Maron et al. 1987; Schaub et al. 1997). We have previously shown that cTnT mutations result in hypercontractility (increased sensitivity to Ca2+) in the absence of hypertrophy in TG mouse hearts (Tardiff et al. 1999; Chandra et al. 2001). However, how a gain of function translates into cardiac dysfunction and ultimately into the sequelae associated with FHC is not well understood.

We hypothesize that one of the major determinants of the functional outcome of this mutation is the amount of sarcomeric incorporation of the mutant. One of the most striking features of the study by Tardiff et al. (1999) was that mouse hearts expressing high levels (92 %) of the R92Q mutant cTnT (R92Q) demonstrated markedly increased lipid deposition and mitochondrial pathology, although the sarcomeric structure remained intact. This phenotype strongly suggested that total cellular metabolism (usage of cellular ATP) was altered. How the mutation could lead to altered ATP usage has not been explored. In another TG mouse (Tardiff et al. 1998), expression of only 6 % of cTnTDEL resulted in scattered sarcomeric disarray and scattered myofibrillar lysis, whereas homozygous TG mice expressing 10 % of the cTnTDEL mutant were either stillborn or died within 24 h of birth, emphasizing the severity of this mutation. Watkins et al. (1996) showed that quail skeletal myotubes expressing the mutant human cTnTDEL developed 80 % less force than control myotubes. However, with both mutants (92 % R92Q cTnT and 6 % cTnTDEL), we have shown that the myofilaments are hypercontractile (Tardiff et al. 1999; Chandra et al. 2001). Other studies of the functional consequences of the R92Q and cTnTDEL mutants have provided conflicting results (Morimoto et al. 1998; Sweeney et al. 1998; Rust et al. 1999; Szczesna et al. 1999). This might be related to the use of heterologous proteins, different expression levels and/or the cell type. Evidence obtained from recent in vitro studies suggests that a cTnT mutant can have multiple effects depending on the concentration of the mutant protein in the sarcomere (Redwood et al. 2000). This is an interesting observation in that it might partly explain how different stimuli induce distinct morphological and functional phenotypes.

The main objective of this study was to determine the molecular basis of two cTnT mutations that elicit different responses in TG mouse hearts. We studied two TG models that offer selective advantages for addressing the important issues in our study. First, the R92Q mutation limits relaxation, but hypercontractility might increase energy costs for contraction. This could lead to a chronic mismatch between ATP synthesis and consumption by the overall crossbridge activity. Second, a TG mouse model in which the cTnTDEL is expressed at 6 % of the total cTnT pool allowed us to test the effects of low level expression of cTnTDEL on myofilament function. To determine the effect of a higher concentration of cTnTDEL on myofilament activation, we measured Ca2+ activation of tension development in mouse cardiac fibre bundles reconstituted with the recombinant mutant cTnTDEL. Furthermore, because these mutations result in increased sensitivity to Ca2+, it is possible that an important aspect of cardiac regulation (i.e. the Frank-Starling mechanism) is impaired. We tested the effect of both mutations on length-dependent activation. Our findings add a new dimension to the understanding of mutations that cause a gain of function. Here, we show that FHC-linked mutations in cTnT are correlated with changes in energetic aspects of contraction.

  METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Transgenic mice

A 2996 bp rat alpha-myosin heavy chain promoter (Tardiff et al. 1998) was used to drive cardiac-specific expression of three different lines of TG mice that expressed the WT mouse cTnT, the R92Q mutant cTnT (R92Q) and the C-terminal deletion mutant cTnT (cTnTDEL), as described in Tardiff et al. (1998, 1999). The skipping of exon 15 in human cTnT leads to the deletion of 28 amino acids from the carboxyl terminus, which is replaced by a seven amino acid peptide that is not related to cTnT (Watkins et al. 1995). In all the TG constructs, cTnT was tagged at the N-terminus with an 11 amino acid human c-myc epitope (Tardiff et al. 1998). In previous studies, neither the transgene (WT) expression nor the presence of the myc tag at the N-terminus had any effect on the normal function of the heart (Tardiff et al. 1998) or Ca2+-activated tension development in detergent-skinned fibre bundles (Chandra et al. 2001). Therefore, we used fibre bundles from the WT TG mouse hearts as controls in our experiments.

Simultaneous measurement of force and ATPase activity

All experiments were carried out according to the guidelines laid down by the Animal Care Committee at the University of Illinois (Chicago). Mice were anaesthetized with sodium pentobarbital (50 mg kg-1 body weight), and the hearts were rapidly excised and placed into ice-cold high-relaxing (HR) solution containing 20 mM Mops, pH 7.0, 53 mM KCl, 10 mM EGTA, 6.81 mM MgCl2, 5.35 mM Na2ATP, 12 mM creatine phosphate, 10 i.u. ml-1 creatine kinase (bovine heart, Sigma) and 0.5 mM DTT. The total ionic strength of HR was 150 mM. A cocktail of protease inhibitors, containing 10 µM leupeptin, 1 µM pepstatin and 100 µM phenylmethylsulphonyl fluoride (PMSF), was included in the buffer. Left ventricular papillary muscles were isolated from the heart and dissected into thin fibre bundles approximately 150-200 µm in width and 1.5-2.0 mm in length. Fibre bundles were detergent skinned overnight in HR solution containing 1 % Triton X-100. The experimental procedures for measuring force and ATPase activity were as described previously (de Tombe & Stienen, 1995; Stienen et al. 1995; Chandra et al. 2001). A computer program (Fabiato & Fabiato, 1979; Godt & Lindley, 1982) was used to calculate the composition of the activating and relaxing solutions. The composition of the relaxation buffer (pCa 8.0) was 100 mM Bes, pH 7.0, 21.2 mM potassium propionate, 5.85 mM Na2ATP, 7.11 mM MgCl2, 20 mM EGTA, 200 µM diadenosine pentaphosphate (A2P5) and 10 µM oligomycin. The composition of the activation buffer (pCa 4.3) was 100 mM Bes, pH 7.0, 1.55 mM potassium propionate, 5.97 mM Na2ATP, 6.59 mM MgCl2, 20 mM CaEGTA, 200 µM A2P5 and 10 µM oligomycin. The total ionic strength was 200 mM. A cocktail of inhibitors, containing 10 µM leupeptin, 1 µM pepstatin and 10 µM PMSF, was included in all the buffers. To determine the pCa-tension and pCa-ATPase activity relationships at short (2.0 µm) and long (2.3 µm) sarcomere lengths (SL), fibre bundles were sequentially bathed in solutions with pCa values ranging from 4.3 to 8.0.

The ATPase activity of a fibre bundle was measured by a coupled enzyme assay, as described previously (Stienen et al. 1995; de Tombe & Stienen, 1995). The ATPase measurements were carried out in a buffer that included 0.9 mM NADH, 5 mM NaN3, 10 mM phosphoenol pyruvate, 4 mg ml-1 pyruvate kinase (500 U mg-1) and 0.24 mg ml-1 lactate dehydrogenase (870 U mg-1). Myofibrillar ATPase activity in skinned fibre bundles was measured as follows: ATP regeneration from ADP was coupled to the breakdown of phosphoenol pyruvate to pyruvate and ATP, catalysed by pyruvate kinase, which was linked to the synthesis of lactate, catalysed by lactate dehydrogenase. The breakdown of NADH, which is proportional to the amount of ATP consumed, was measured by UV absorbance at 340 nm. The ratio of light intensity at 340 nm (sensitive to NADH concentration) and 410 nm (reference signal) was obtained by means of an analog divider. After each recording, the UV absorbance signal of NADH was calibrated with multiple rapid injections of 0.25 nmol ADP (0.025 µl of 10 mM ADP) into the bathing solution with a motor-controlled calibration pipette.

Preparation of recombinant mouse cTnT

The DNA fragments for the WT cTnT and cTnTDEL clones were amplified from the PCR blunt clones by PCR (Tardiff et al. 1998). We used two oligonucleotide primers. Primer 1 (see below) was designed to incorporate codons for amino acids 1-6 (underlined) of the c-myc epitope at the N-terminus of both cTnT clones. This sequence was flanked on the 5' side by nucleotides of the pSBETa expression system (Boehringer Mannheim), including an Nde I restriction enzyme site. Primer 2 (below) was designed to prime 22 nucleotides downstream of the stop codon in both clones. A BamH I site (underlined) was included for subcloning purposes.

Primer 1: 5' GCA GAA TTC AGG CAT ATG ATG GAG CAA AAG CTC ATT 3'

Primer 2: 5' TGCTGGAATTCAGGATCCTGTGAGCCAGGGCA GTG 3'

Amplified DNA fragments were subcloned into the Nde I-BamH I site of the pSBETa expression vector. Clones that contained the correct inserts were sequenced to confirm the sequence.

Expression and purification of proteins

Recombinant WT cTnT and cTnTDEL were expressed in BL21(DE3) cells (Novagen). Cells were grown overnight in Luria Broth containing 30 mg ml-1 kanamycin, and cTnT was extracted and purified, as described previously (Chandra et al. 1999b). Cardiac troponin I (cTnI) and C (cTnC) were purified as described previously (Guo et al. 1994; Pan & Johnson, 1996).

Exchange of endogenous Tn with recombinant WT cTnT and cTnTDEL in detergent-skinned mouse cardiac fibre bundles

Exchange of the endogenous troponin complex (Tn) with the recombinant WT cTnT or cTnTDEL was based on the method described in Chandra et al. (1999a). Left ventricular papillary muscle fibre bundles from freshly dissected mouse hearts were detergent-skinned overnight in HR solution containing 1 % Triton X-100 and a cocktail of protease inhibitors. WT cTnT-cTnI or cTnTDEL-cTnI was dissolved in extraction buffer containing 20 mM Mops, pH 6.5, 250 mM KCl, 5 mM EGTA, 5 mM MgCl2, 100 µM PMSF and 1.0 mM DTT (Chandra et al. 1999a). The Tn exchange experiment was carried out in extraction buffer (2 ml) containing WT cTnT-cTnI or cTnTDEL-cTnI for approximately 70 min at room temperature with constant stirring. After WT cTnT-cTnI or cTnTDEL-cTnI treatment, the fibre bundle was washed in 2 ml of extraction buffer (without WT cTnT-cTnI or cTnTDEL-cTnI) for 10 min and 2 ml of HR for 10 min with constant stirring. To determine the extent of endogenous Tn removed, Ca2+-activated residual force was measured in pCa 4.5 solution (20 mM Mops, pH 7.0, 22 mM KCl, 10 mM EGTA, 9.96 mM CaCl2, 6.48 mM MgCl2, 5.39 mM Na2ATP, 12 mM creatine phosphate, 10 i.u. ml-1 creatine kinase and 0.5 mM DTT). An 87-90 % decrease (compared to initial maximum isometric force) in Ca2+-activated maximum isometric force indicated that most of the endogenous Tn had been removed. Next, the WT cTnT-cTnI- or cTnTDEL-cTnI-treated fibre bundle was relaxed in HR solution. The WT cTnT-cTnI or cTnTDEL-cTnI-treated fibre bundles were reconstituted with cTnC (4 mg ml-1 in HR, pH 7.0) for 90-120 min at room temperature with constant stirring. After cTnC reconstitution, Ca2+-activated maximal force was measured in pCa 4.5 solution.

Gel electrophoresis and Western blot analysis

Samples were prepared and 30 µg of protein per lane was run on 12.5 % SDS-polyacrylamide gels, as described previously (Chandra et al. 1999b). The protein concentration was determined by using a Bio-Rad DC (detergent compatible) protein assay kit. Proteins were transferred onto nitrocellulose for Western blot analysis using an anti-mouse primary antibody against the c-myc tag, as described previously (Tardiff et al. 1998). Non-SDS alkaline urea-PAGE was performed using a 4 % stacking gel and 8 % separating gels containing 6 M urea, as described previously (Blanchard & Solaro, 1984).

Data analysis

Data from the normalized pCa-force and pCa-ATPase activity measurements were fitted to the Hill equation by using non-linear least-squares regression to obtain the pCa50 (pCa required for half-maximal activation) and the Hill coefficient. All data are presented as means ± S.E.M. All data were normally distributed and statistical differences were analysed by Student's unpaired t test or one-way ANOVA with Student-Newman-Keuls post hoc tests. Significance was set at P < 0.05

  RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Ca2+ sensitivity of myofilament activation in detergent-skinned fibre bundles

Figure 1 illustrates the effects of cTnT mutations on the length-dependent activation of detergent-skinned fibre bundles from WT, R92Q and cTnTDEL TG mouse hearts. In Fig. 1A and B, the relationship between the steady-state tension and pCa is compared at SL of 2.0 and 2.3 µm, respectively. When compared to the WT fibres, R92Q fibres had a nearly 2-fold greater sensitivity to Ca2+ at short and long SL. The increase in sensitivity to Ca2+ caused by changing the SL from 2.0 to 2.3 µm in the R92Q fibres was similar to that of WT fibres. The cTnTDEL fibres also demonstrated a significant increase in sensitivity to Ca2+ at both short and long SL. However, the magnitude of the pCa50 shift produced by the cTnTDEL TG fibres was less than that produced by the R92Q fibres.

F1 View larger version
[in this window]
[in a new window]

Figure 1. Normalized pCa-tension relationships in detergent-skinned muscle fibre bundles from WT, R92Q and cTnTDEL TG mouse hearts

The composition of the activation buffer (pCa 4.3, ionic strength 200 mM) is given in the Methods. For complete buffer conditions see Stienen et al. (1995) and de Tombe & Stienen (1995). A, pCa-tension relationship of WT, R92Q and cTnTDEL fibre bundles at SL of 2.0 µm. WT (cir), pCa50 = 5.69 ± 0.01, n = 4.3 ± 0.2; R92Q (fullcir), pCa50 = 5.96 ± 0.01, n = 3.0 ± 0.2; and cTnTDEL (utri), pCa50 = 5.81 ± 0.01, n = 2.8 ± 0.2. B, pCa-tension relationship of WT, R92Q and cTnTDEL fibre bundles at SL of 2.3 µm. WT (cir), pCa50 = 5.81 ± 0.01, n = 3.0 ± 0.1; R92Q (fullcir), pCa50 = 6.08 ± 0.01, n = 3.0 ± 0.1; and cTnTDEL (utri), pCa50 = 5.95 ± 0.01, n = 2.9 ± 0.2. Number of determinations was 10 for the WT, 9 for R92Q and 8 for cTnTDEL.

Figure 2 shows the relationship between the Ca2+-activated ATPase activity and steady-state isometric force generation in detergent-skinned fibre bundles from the WT, R92Q and cTnTDEL TG mouse hearts. Ca2+-activated ATPase activity increased in proportion to the isometric tension development. Thus, the pCa50 values were similar to those for pCa-tension relationships (see Fig. 1). These values demonstrated that both R92Q and cTnTDEL fibre bundles were more sensitive to Ca2+ than were WT bundles. Moreover, the magnitude of the increase in the Ca2+ sensitivity of ATPase activity was similar to the increase in the Ca2+ sensitivity of tension.

F2 View larger version
[in this window]
[in a new window]

Figure 2. Normalized pCa-ATPase activity relationships in detergent-skinned fibre bundles from WT, R92Q and cTnTDEL TG mouse hearts

The buffer used is described in Methods. For other details, see Stienen et al. (1995) and de Tombe & Stienen (1995). A, pCa-ATPase activity relationship at SL of 2.0 µm. WT (cir), pCa50 = 5.78 ± 0.01, n = 4.8 ± 0.2; R92Q (fullcir), pCa50 = 6.02 ± 0.01, n = 3.0 ± 0.2; and cTnTDEL (utri), pCa50 = 5.92 ± 0.01, n = 3.5 ± 0.2. B, pCa-ATPase relationship at SL of 2.3 µm. WT (cir), pCa50 = 5.88 ± 0.01, n = 3.7 ± 0.1; R92Q (fullcir), pCa50 = 6.13 ± 0.01, n = 3.4 ± 0.2; and cTnTDEL (utri), pCa50 = 5.99 ± 0.01, n = 3.0 ± 0.2. Number of determinations was 10 for the WT, 9 for R92Q and 8 for cTnTDEL.

Effects of mutations in cTnT on tension cost in detergent-skinned fibre bundles

To determine the economy of tension maintenance, we measured steady-state isometric force and ATPase activity simultaneously in fibre bundles from WT, R92Q and cTnTDEL TG mouse hearts. The R92Q and cTnTDEL mutations had no significant effect on baseline (pCa 8.0) isometric force and ATPase activity at both short and long SL (data not shown). At SL of 2.0 µm, there was a significant (P < 0.005) 21-24 % decrease in Ca2+-activated maximal tension in the mutant preparations compared to WT (29 ± 1 mN mm-2 for WT, 22 ± 2 mN mm-2 for R92Q and 23 ± 1 mN mm-2 for cTnTDEL; Fig. 3A). Figure 3B shows that at long SL (2.3 µm), Ca2+-activated maximal tension in R92Q and cTnTDEL fibres was not significantly altered when compared to WT fibres (45 ± 2 mN mm-2 for WT, 41 ± 3 mN mm-2 for R92Q and 42 ± 3 mN mm-2 for cTnTDEL).

F3 View larger version
[in this window]
[in a new window]

Figure 3. Ca2+-activated maximal tension in detergent-skinned fibre bundles from WT, R92Q and TnTDEL TG mouse hearts

A, Ca2+-activated maximal tension developed by the fibre bundles at SL of 2.0 µm: WT, 29 ± 1 mN mm-2; R92Q, 22 ± 2 mN mm-2; and cTnTDEL, 23 ± 1 mN mm-2. B, Ca2+-activated maximal tension developed by the fibre bundles at SL of 2.3 µm: WT, 45 ± 2 mN mm-2; R92Q, 41 ± 3 mN mm-2; and cTnTDEL, 42 ± 3 mN mm-2. Number of determinations was 10 for the WT, 9 for R92Q and 8 for cTnTDEL. * Significantly different from WT (P < 0.005).

Interestingly, Ca2+-activated maximal ATPase activity in R92Q and cTnTDEL fibres was not significantly different from that in WT fibres (Fig. 4). At SL of 2.0 µm, Ca2+-activated maximal ATPase activity was 241 ± 17 pmol µl-1 s-1 for the WT, 241 ± 14 pmol µl-1 s-1 for R92Q and 252 ± 14 pmol µl-1 s-1 for cTnTDEL fibres (Fig. 4A). At SL of 2.3 µm, Ca2+-activated maximal ATPase activity was 277 ± 13 pmol µl-1 s-1 for the WT, 279 ± 22 pmol µl-1 s-1 for R92Q, and 283 ± 13 pmol µl-1 s-1 for cTnTDEL fibres (Fig. 4B). At SL of 2.0 µm, although there was a significant decrease in Ca2+-activated maximal tension in the mutant preparations (Fig. 3A), there was no corresponding decrease in Ca2+-activated maximal ATPase activity (Fig. 4A). Therefore, our data indicated that the economy of tension maintenance in R92Q and cTnTDEL TG fibres decreased significantly at SL of 2.0 µm. Figure 5A shows that the tension cost, defined as the ratio of the rate of ATP consumption to the steady-state isometric tension at maximal activation, increased significantly (P < 0.001), by 35 % in R92Q and 29 % in cTnTDEL fibres. This indicated that both the R92Q and the cTnTDEL fibre bundles consume more ATP for a given amount of tension at short SL than WT bundles. The tension cost at long SL was not significantly different for either mutant compared to the WT control (Fig. 5B).

F4 View larger version
[in this window]
[in a new window]

Figure 4. Ca2+-activated maximum rate of ATP consumption by the fibre bundles from WT, R92Q and cTnTDEL TG mouse hearts

A, Ca2+-activated maximal ATPase activity in fibre bundles at SL of 2.0 µm: WT, 241 ± 17 pmol µl-1 s-1; R92Q, 241 ± 14 pmol µl-1 s-1; and cTnTDEL, 252 ± 14 pmol µl-1 s-1. B, Ca2+-activated maximal ATPase activity in fibre bundles at SL of 2.3 µm: WT, 277 ± 13 pmol µl-1 s-1; R92Q, 279 ± 22 pmol µl-1 s-1; and cTnTDEL, 283 ± 13 pmol µl-1 s-1. Number of determinations was 10 for the WT, 9 for R92Q and 8 for cTnTDEL.

F5 View larger version
[in this window]
[in a new window]

Figure 5. Tension cost in detergent-skinned fibre bundles from WT, R92Q and cTnTDEL TG mouse hearts

Tension cost is defined as the ratio of the rate of ATP consumption to the steady-state isometric tension at maximal activation. A, tension cost at SL of 2.0 µm: WT, 8.4 ± 0.3 pmol mN-1 mm-1 s-1; R92Q, 11.4 ± 0.4 pmol mN-1 mm-1 s-1; cTnTDEL, 10.9 ± 0.5 pmol mN-1 mm-1 s-1. B, tension cost at SL of 2.3 µm: WT, 6.2 ± 0.3 pmol mN-1 mm-1 s-1; R92Q, 6.7 ± 0.3 pmol mN-1 mm-1 s-1; cTnTDEL, 6.6 ± 0.2 pmol mN-1 mm-1 s-1. Number of determinations was 10 for the WT, 9 for R92Q and 8 for cTnTDEL. * Significantly different from WT (P < 0.001).

Exchange of endogenous Tn with recombinant WT cTnT and cTnTDEL in detergent-skinned mouse cardiac fibre bundles

Expression of more than 6 % cTnTDEL in the heart is lethal in TG mice (Tardiff et al. 1998). To test the effects of a higher concentration of cTnTDEL on cardiac myofilament activation, we reconstituted purified recombinant WT cTnT and the cTnTDEL mutant into detergent-skinned mouse cardiac fibre bundles using the previously described procedure (Chandra et al. 1999a). In this procedure, the endogenous Tn was replaced by initially treating the fibres with exogenous WT cTnT or cTnTDEL-cTnI followed by reconstitution with cTnC. We previously reported that the amount by which Ca2+-regulated force decreased after the initial treatment with cTnT-cTnI is a function of the extent of endogenous Tn removed from the fibre bundles (Chandra et al. 1999a). After the initial treatment, the decrease in Ca2+-activated force was 87 % for the WT cTnT-cTnI-treated and 90 % for the cTnTDEL-cTnI-treated fibre bundles (Fig. 7A). This indicated that both WT cTnT and cTnTDEL effectively displaced major proportions of the endogenous Tn from the fibre bundles.

The incorporation of WT cTnT and the cTnTDEL mutant into the sarcomere was confirmed by Western blot analysis (Fig. 6A). The efficacy of the removal of endogenous Tn by both mutants was demonstrated by alkaline urea gel electrophoresis in the absence of SDS (Blanchard & Solaro, 1984). Under these conditions, cTnC migrates well ahead of other fibre bundle components and visualization of cTnC is improved. The absence of native cTnC in either the WT cTnT-cTnI- or the cTnTDEL-cTnI-treated fibre bundles offers a good means of estimating the amount of endogenous Tn removed. The absence of native TnC in the WT cTnT-cTnI- and cTnTDEL-cTnI-treated fibre bundles (Fig. 6B, lanes 1 and 3) clearly demonstrated the removal of endogenous Tn. Moreover, the observation that nearly 90 % of Ca2+-regulated force was lost after treatment with either WT cTnT-cTnI or cTnTDEL-cTnI (Fig. 7A) clearly demonstrated that a major proportion of the native Tn had been removed.

F6 View larger version
[in this window]
[in a new window]

Figure 6. Gel analysis of WT cTnT-cTnI- and cTnTDEL-cTnI-treated mouse cardiac fibre bundles

A, Western blot analysis of WT cTnT-cTnI- and cTnTDEL-cTnI-treated fibre bundles. Anti-mouse primary antibody was used to probe for the c-myc tag. Lanes 1 and 2 show the purified c-myc tagged WT cTnT and cTnTDEL. No immunoreactivity was evident in the control untreated preparations (lane 3), whereas the c-myc tag was detectable in the cTnTDEL-reconstituted (lane 4) and WT cTnT preparations (lane 5). B, non-SDS alkaline urea-PAGE (8 %) of the WT cTnT-cTnI-/cTnTDEL-cTnI-treated and cTnC-reconstituted fibre bundles. Lane 1, WT cTnT-cTnI-treated fibres; lane 2, WT cTnT-cTnI-treated fibres + cTnC-reconstituted fibres; lane 3, cTnTDEL-cTnI-treated fibres; lane 4, cTnTDEL-cTnI-treated + cTnC-reconstituted fibres; lane 5, pure cTnC standard.

F7 View larger version
[in this window]
[in a new window]

Figure 7. Effect of recombinant WT cTnT and cTnTDEL on Ca2+-regulated myofilament activation in detergent-skinned mouse cardiac fibre bundles

The composition of the activation buffer (pCa 4.5, ionic strength 150 mM) is given in the Methods. A, effect on Ca2+-activated maximal isometric force. Ca2+-activated maximum force generated by the fibre before the treatment was taken as 100 %. 1, residual force after WT cTnT-cTnI treatment. 2, maximum restored force in WT cTnT-cTnI-treated + cTnC-reconstituted fibre. 3, residual force after cTnTDEL-cTnI treatment. 4, maximum restored force in cTnTDEL-cTnI-treated + cTnC-reconstituted fibre. B, normalized pCa-force relationship in: WT cTnT-cTnI-treated + cTnC-reconstituted fibres (cir, pCa50 = 5.51 ± 0.01, n = 2.74 ± 0.2) and cTnTDEL-cTnI33-211-treated + cTnC-reconstituted fibres (fullcir, pCa50 = 5.49 ± 0.02, n = 1.4 ± 0.1). Number of determinations was 5 for each.

After reconstitution with cTnC, approximately 75 % of the original Ca2+-regulated force was recovered in the WT cTnT-cTnI-treated fibre bundles. By contrast, only 28 % of the original Ca2+-regulated force was recovered in cTnTDEL-cTnI-treated fibre bundles (Fig. 7A). When compared across treatments, the fibre bundles reconstituted with cTnTDEL-cTnI-cTnC developed only 37 % of the force developed by the WT cTnT-cTnI-cTnC reconstituted fibre bundles. Figure 7B illustrates the pCa-force relationships for detergent-skinned fibre bundles reconstituted with WT cTnT and cTnTDEL. In contrast to the case in the cTnTDEL TG mouse model, where only 6 % of the mutant was expressed, the pCa50 values were not different in these exchange experiments (5.51 ± 0.01 for WT cTnT-cTnI-cTnC and 5.49 ± 0.02 for the cTnTDEL-cTnI-cTnC reconstituted fibre bundles). The Hill coefficient values were significantly altered in the case of cTnTDEL reconstituted fibre bundles (2.7 ± 0.2 for WT cTnT-cTnI-cTnC and 1.4 ± 0.1 for the cTnTDEL-cTnI-cTnC reconstituted fibre bundles). The significant change in the Hill coefficient reported here could be due to the weakening of TnC interaction with either cTnI or cTnT. In fact, Mukherjea et al. (1999) have shown that the binding of cTnI to cTnTDEL decreases by 6-fold when compared with the binding of cTnI to normal cTnT. Such a decrease in the binding of cTnI to cTnTDEL might lead to altered Ca2+ activation by modulating the interaction between cTnI and cTnC.

  DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

There has been little insight into the mechanism by which FHC-linked mutations that result in hypercontractility lead to contractile dysfunction. Our findings suggest that hypercontractility, a hallmark of FHC-linked cTnT mutations, could eventually lead to a marked decrease in the economy of tension development. In this way, the available pool of ATP would be compromised and muscle contraction may be hampered. Humans with these mutations often present with differing phenotypes, whereas some show no signs or symptoms of the disease. Here, we present experimental evidence to support the interesting possibility that the disparate expression of these mutations could be a funcion of the concentration of the mutant protein in the sarcomere (Redwood et al. 2000).

Increased Ca2+ sensitivity of TG myofilaments: implications for altered length-dependent activation

With regard to the R92Q mutation in cTnT (Chandra et al. 2001), we have studied a new TG mouse model in which 92 % of the total cTnT in the heart was replaced by R92Q. Tardiff et al. (1999) showed that histopathological changes were more significant in TG mice in which 92 % of the endogenous cTnT was replaced by R92Q. Thus, their observation suggested a direct link between the amount of mutant protein and the extent of myocardial damage. A surprising feature of the TG mouse used in the present study is that sensitivity to Ca2+ was not amplified at long SL in 92 % TG fibres. The SL-induced increase in sensitivity to Ca2+ in the R92Q fibres was similar to that of WT fibres. The difference in pCa required for half-maximal activation at short and long SL (DeltapCa50) was 0.12 for the R92Q (92 %) TG fibres. In the case of R92Q (67 %) TG fibres, pCa50 increased by 0.29 units when the SL was increased from 1.9 to 2.3 µm (Chandra et al. 2001). Thus, whereas the feedback effect of crossbridges on myofilament sensitivity to Ca2+ was enhanced in fibres from R92Q (67 %) TG mouse hearts (Chandra et al. 2001), it appears to be normal in fibres from R92Q (92 %) TG mouse hearts.

The preferential localization of the mutant cTnT on the thin filament might be the mechanism by which crossbridge feedback on myofilament sensitivity to Ca2+ is affected by the amount of mutant protein. If a significant proportion of R92Q in the 67 % TG mouse is non-uniformly distributed in the cardiac thin filament, optimal stretching of the fibres may allow more crossbridges to interact with the region of the thin filament that contains more of the mutant cTnT, thus enhancing the Ca2+ sensitivity of the myofilaments at longer SL in the R92Q (67 %) TG fibres. On the other hand, the thin filament is nearly saturated with mutant cTnT in the 92 % TG line, which leads to enhanced Ca2+ sensitivity at both short and long SL.

Fibers from TG mouse hearts, in which 6 % of the total cTnT was replaced by cTnTDEL, also showed an increase in sensitivity to Ca2+ at both short and long SL. However, the magnitude was smaller than that of fibres from R92Q (92 %) TG mouse hearts (see Fig. 1 and Fig. 2) or from R92Q (67 %) TG mouse hearts (Chandra et al. 2001). Surprisingly, even a relatively small amount of protein had a significant effect on myofilament sensitivity to Ca2+. Observations made from studies using TG mice, expressing 6 % truncated cTnT (cTnTDEL), have also substantiated the deleterious effect of truncated cTnT on heart function (Tardiff et al. 1998). In their study, Tardiff et al. (1998) found that heterozygous TG mouse hearts that expressed ~6 % of truncated cTnT showed significant systolic and diastolic dysfunction. A dramatic effect of truncated cTnT on the TG mouse hearts was illustrated by the observation that an increase in the rate of ventricular pressure development (+dP/dT) in response to an increased work load was significantly diminished. Moreover, there was a severe decline in the slope of the relationship between increased volume and relaxation (-dP/dT) in TG mouse hearts that expressed truncated cTnT. However, the authors could not address the issue of how a higher concentration of the truncated mutant cTnT affects cardiac myofilament function, because the homozygous TG mice expressing nearly 10-12 % of the truncated mutant cTnT died soon after birth (Tardiff et al. 1998).

Effect of higher concentrations of truncated TnT: implications for a concentration-dependent effect of mutation on myofilament activation

An interesting aspect of the present study is that the incorporation of greater amounts of cTnTDEL into detergent-skinned cardiac fibre bundles led to a substantial decrease in Ca2+-activated maximal tension with no apparent changes in sensitivity to Ca2+ at SL of 2.3 µm. This contrasts with the results obtained in TG fibres expressing 6 % cTnTDEL, which were more sensitive to Ca2+ (Fig. 1B), but showed no changes in maximal tension (Fig. 3B) or ATPase activity (Fig. 4B) at SL of 2.3 µm. Consistent with our observation, other in vitro studies have shown that actomyosin ATPase activity decreases substantially when cTnTDEL is incorporated into fully reconstituted thin filaments (Mukherjea et al. 1999; Tobacman et al. 1999). Furthermore, quail skeletal myotubes expressing truncated mutant cTnT developed 80 % less force than control myotubes (Watkins et al. 1996). There is a lack of consensus as to whether these observations can be attributed to altered binding of Tn to thin filaments. One study showed that the Tn complex containing the truncated mutant cTnT caused a 20 % weakening of the binding of tropomyosin to actin filaments (Tobacman et al. 1999), whereas another study found no such changes (Mukherjea et al. 1999). Moreover, in vitro motility assays employing truncated mutant cTnT have given conflicting results. For example, Redwood et al. (2000) reported that there is no change in Ca2+-activated maximal isometric force, which is contrary to the present observations and those of others (Watkins et al. 1996; Mukherjea et al. 1999; Tobacman et al. 1999). Although the reason for this discrepancy is not clear, we cannot rule out the possibility that differences in the nature of assays might have contributed to the differences in the data. Nevertheless, two investigators have shown that the sliding velocity of the regulated thin filament is increased in preparations that contain truncated mutant cTnT (Homsher et al. 2000; Redwood et al. 2000). They proposed that this increase in sliding velocity was due to an increase in the rate of crossbridge detachment induced by the effect of the truncated mutant cTnT on the thin filaments. Interestingly, a shortened duty cycle, resulting from increased crossbridge cycling, has been proposed to increase tension cost in diseased myocardium (Sweeney et al. 1998).

Effect of cTnT mutations on the relationship between tension and ATP hydrolysis: implications for altered muscle economy

An interesting aspect of the present study is that there was a significant increase in tension cost in both R92Q and cTnTDEL TG fibres when compared to the WT TG fibres. Whereas the tension cost for R92Q and cTnTDEL TG fibres remained unaffected at long SL, the increased tension cost at shorter SL represents a new finding. The short SL used in the present study closely approximates the lower working range of SL in a beating heart (approximately 1.9-2.3 µm; Rodriguez et al. 1992). A possible mechanism by which a decrease in the SL could affect the relationship between ATPase activity and tension is provided by Kentish & Stienen's (1994) work. They suggested that the disproportionate drop in force, relative to ATPase activity, might be accounted for in part by an increase in restoring force that arose from the deformation of the extracellular components at SL less than 2.0 µm. In this regard, the presence of mild fibrosis reported in the R92Q and cTnTDEL TG mouse hearts (Tardiff et al. 1998, 1999) may be highly relevant.

An alternative explanation is that the increased ATPase activity at short SL is due to alterations in the kinetics of actin-myosin interaction. In this case, an increase in the rate of crossbridge dissociation from actin might lead to increased ATPase activity, but a decrease the isometric force (Homsher et al. 2000). Interestingly, Homsher et al. (2000) suggested that the incorporation of I79N mutant cTnT into preparations studied in an in vitro motility assay led to an increase in the unloaded shortening velocity with a concomitant decrease in the isometric force that probably resulted from a decrease in the fraction of the attached crossbridges. However, we did not observe any significant changes in Ca2+-activated maximal tension or ATPase activity at long SL in myofilaments containing R92Q and cTnTDEL. Thus, our data suggest that the increased ATPase activity at the short SL was not due to an alteration in crossbridge cycling rates, but might be related to increased restoring forces associated with fibrosis in the TG fibres.

Since we did not control for phosphorylation of myofilament proteins, it is impossible to rule out other secondary changes, such as altered phosphorylation of myofilament proteins, as possible explanations of the differences in mechanical results. However, the differences in mechanical results reported here cannot be explained by changes in the phosphorylation of myofilament proteins, for several reasons. First, PKA-induced phosphorylation of myofilaments is known to decrease myofilament Ca2+ sensitivity (Garvey et al. 1988; de Tombe et al. 1995; Zhang et al. 1995; Kentish et al. 2001). However, the results of the present study demonstrate an increase in sensitivity to Ca2+ of R92Q and cTnTDEL fibres at both short and long SL. Second, PKC-induced phosphorylation decreases Ca2+-activated maximal tension at long SL in detergent-skinned fibre bundles (Montgomery et al. 2001). Our observations show that at long SL, Ca2+-activated maximal tension and ATPase activity in both R92Q and cTnTDEL fibres were not significantly different from those of control WT TG fibres. By contrast, Ca2+-activated maximal tension at short SL in both R92Q and cTnTDEL fibres is significantly depressed when compared to that of WT TG fibres. Therefore, we conclude that the increase in tension cost that we observed at short SL is unrelated to the state of myofilament phosphorylation in TG fibres. One of the limitations of our study is that we did not measure SL during maximal Ca2+ activation. Considering that the magnitude of the internal shortening in detergent-skinned muscle fibre preparations might be as much as 5 %, the resting SL of 2.0 and 2.3 µm during full Ca2+ activation could correspond to an average SL of 1.9 and 2.2 µm, respectively. It should, however, be noted that at SL of 2.0 µm, both R92Q and cTnTDEL TG fibres demonstrated significant increases in tension cost, which remained unaltered in the WT TG fibres. Therefore, we conclude that any inhomogeneity of SL would be too small to account for the change in tension cost in R92Q and cTnTDEL TG fibres.

In conclusion, our study suggests that the cellular changes induced by primary contractile dysfunction might increase energetic costs during isovolumic contractions and the ejection phase of the cardiac cycle in severely affected hearts. Chronic mismatch between ATP synthesis and ATP consumption by the overall crossbridge activity could be exacerbated when stress is imposed on the heart. Such an increase in the energy cost of contraction might also serve to link observed changes in lipid content and mitochondrial morphology in TG myocytes (Tardiff et al. 1999) to the primary dysfunction at the sarcomere level. Moreover, our study also suggests that the concentration of the mutant cTnT in the thin filament has a direct bearing on both the nature and extent of cardiac myofilament dysfunction. Thus, the clinical heterogeneity of FHC in humans could be explained, in part, by a mechanism that involves a mutation-dependent effect on myofilament function.

  REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

BLANCHARD, E. M. & SOLARO, R. J. (1984). Inhibition of the activation and troponin calcium binding of dog cardiac myofibrils by acidic pH. Circulation Research 55, 382-391 [Abstract]
BONNE, G., CARRIER, L., RICHARD, P., HAINQUE, B. & SCHWARTZ, K. (1998). Familial hypertrophic cardiomyopathy: from mutations to functional defects. Circulation Research 83, 580-593 [Abstract/Full Text]
CHANDRA, M., KIM, J. J. & SOLARO, R. J. (1999a). An improved method for exchanging troponin subunits in detergent-skinned rat cardiac fibre bundles. Biochemical and Biophysical Research Communications 263, 219-223 [Medline]
CHANDRA, M., MONTGOMERY, D. E., KIM, J. J. & SOLARO, R. J. (1999b). The N-terminal region of troponin T is essential for the maximal activation of rat cardiac myofilaments. Journal of Molecular and Cellular Cardiology 31, 867-880 [Medline]
CHANDRA, M., RUNDELL, V. L., TARDIFF, J. C., LEINWAND, L. A., DE TOMBE, P. P. & SOLARO, R. J. (2001). Ca2+ activation of myofilaments from transgenic mouse hearts expressing R92Q mutant cardiac troponin T. American Journal of Physiology - Heart and Circulatory Physiology 280, H705-713 [Medline]
DE TOMBE, P. P. & STIENEN, G. J. (1995). Protein kinase A does not alter economy of force maintenance in skinned rat cardiac trabeculae. Circulation Research 76, 734-741 [Abstract/Full Text]
FABIATO, A. & FABIATO, F. (1979). Use of chlorotetracycline fluorescence to demonstrate Ca2+-induced release of Ca2+ from the sarcoplasmic reticulum of skinned cardiac cells. Nature 281, 146-148 [Medline]
GARVEY, J. L., KRANIAS, E. G. & SOLARO, R. J. (1988). Phosphorylation of C-protein, troponin I and phospholamban in isolated rabbit hearts. Biochemical Journal 249, 709-714 [Medline]
GEISTERFER-LOWRANCE, A. A., KASS, S., TANIGAWA, G., VOSBERG, H. P., MCKENNA, W., SEIDMAN, C. E. & SEIDMAN, J. G. (1990). A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain gene missense mutation. Cell 62, 999-1006 [Medline]
GODT, R. E. & LINDLEY, B. D. (1982). Influence of temperature upon contractile activation and isometric force production in mechanically skinned muscle fibres of the frog. Journal of General Physiology 80, 279-297 [Abstract]
GUO, X., WATTANAPERMPOOL, J., PALMITER, K. A., MURPHY, A. M. & SOLARO, R. J. (1994). Mutagenesis of cardiac troponin I. Role of the unique NH2-terminal peptide in myofilament activation. Journal of Biological Chemistry 269, 15210-15216 [Abstract]
HOMSHER, E., LEE, D. M., MORRIS, C., PAVLOV, D. & TOBACMAN, L. S. (2000). Regulation of force and unloaded sliding speed in single thin filaments: effects of regulatory proteins and calcium. Journal of Physiology 524, 233-243 [Abstract/Full Text]
KENTISH, J. C., MCCLOSKEY, D. T., LAYLAND, J., PALMER, S., LEIDEN, J. M., MARTIN, A. F. & SOLARO, R. J. (2001). Phosphorylation of troponin I by protein kinase A accelerates relaxation and crossbridge cycle kinetics in mouse ventricular muscle. Circulation Research 88, 1059-1065 [Abstract/Full Text]
KENTISH, J. C. & STIENEN, G. J. (1994). Differential effects of length on maximum force production and myofibrillar ATPase activity in rat skinned cardiac muscle. Journal of Physiology 475, 175-184 [Abstract]
MARON, B. J., BONOW, R. O., CANNON, R. O. III, LEON, M. B. & EPSTEIN, S. E. (1987). Hypertrophic cardiomyopathy. Interrelationships of clinical manifestations, pathophysiology, and therapy (2). New England Journal of Medicine 316, 844-852 [Medline]
MONTGOMERY, D. E., CHANDRA, M., HUANG, Q., JIN, J.-P. & SOLARO, R. J. (2001). Transgenic incorporation of skeletal TnT into cardiac myofilaments blunts PKC-mediated depression of force. American Journal of Physiology 280, H1011-1018
MORIMOTO, S., YANAGA, F., MINAKAMI, R. & OHTSUKI, I. (1998). Ca2+-sensitizing effects of the mutations at Ile-79 and Arg-92 of troponin T in hypertrophic cardiomyopathy. American Journal of Physiology 275, C200-207 [Medline]
MUKHERJEA, P., TONG, L., SEIDMAN, J. G., SEIDMAN, C. E. & HITCHCOCK-DEGREGORI, S. E. (1999). Altered regulatory function of two familial hypertrophic cardiomyopathy troponin T mutants. Biochemistry 38, 13296-13301 [Medline]
PAN, B. S. & JOHNSON, R. G. JR (1996). Interaction of cardiotonic thiadiazinone derivatives with cardiac troponin C. Journal of Biological Chemistry 271, 817-823 [Abstract/Full Text]
REDWOOD, C., LOHMANN, K., BING, W., ESPOSITO, G. M., ELLIOTT, K., ABDULRAZZAK, H., KNOTT, A., PURCELL, I., MARSTON, S. & WATKINS, H. (2000). Investigation of a truncated cardiac troponin T that causes familial hypertrophic cardiomyopathy: Ca2+ regulatory properties of reconstituted thin filaments depend on the ratio of mutant to wild-type protein. Circulation Research 86, 1146-1152 [Abstract/Full Text]
RODRIGUEZ, E. K., HUNTER, W. C., ROYCE, M. J., LEPPO, M. K., DOUGLAS, A. S. & WEISMAN, H. F. (1992). A method to reconstruct myocardial sarcomere lengths and orientations at transmural sites in beating canine hearts. American Journal of Physiology 263, H293-306 [Medline]
RUST, E. M., ALBAYYA, F. P. & METZGER, J. M. (1999). Identification of a contractile deficit in adult cardiac myocytes expressing hypertrophic cardiomyopathy-associated mutant troponin T proteins. Journal of Clinical Investigation 103, 1459-1467 [Abstract/Full Text]
SCHAUB, M. C., HEFTI, M. A., HARDER, B. A. & EPPENBERGER, H. M. (1997). Various hypertrophic stimuli induce distinct phenotypes in cardiomyocytes. Journal of Molecular Medicine 75, 901-920 [Medline]
STIENEN, G. J. M., ZAREMBA, R. & ELZINGA, G. (1995). ATP utilization for calcium uptake and force production in skinned muscle fibres of Xenopus laevis. Journal of Physiology 482, 109-122 [Abstract]
SWEENEY, H. L., FENG, H. S., YANG, Z. & WATKINS, H. (1998). Functional analyses of troponin T mutations that cause hypertrophic cardiomyopathy: insights into disease pathogenesis and troponin function. Proceedings of the National Academy of Sciences of the USA 95, 14406-14410 [Abstract/Full Text]
SZCZESNA, D., ZHANG, R., ZHAO, J., JONES, M. & POTTER, J. D. (1999). The role of the NH2- and COOH-terminal domains of the inhibitory region of troponin I in the regulation of skeletal muscle contraction. Journal of Biological Chemistry 274, 29536-29542 [Abstract/Full Text]
TARDIFF, J. C., FACTOR, S. M., TOMPKINS, B. D., HEWETT, T. E., PALMER, B. M., MOORE, R. L., SCHWARTZ, S., ROBBINS, J. & LEINWAND, L. A. (1998). A truncated cardiac troponin T molecule in transgenic mice suggests multiple cellular mechanisms for familial hypertrophic cardiomyopathy. Journal of Clinical Investigation 101, 2800-2811 [Abstract/Full Text]
TARDIFF, J. C., HEWETT, T. E., PALMER, B. M., OLSSON, C., FACTOR, S. M., MOORE, R. L., ROBBINS, J. & LEINWAND, L. A. (1999). Cardiac troponin T mutations result in allele-specific phenotypes in a mouse model for hypertrophic cardiomyopathy. Journal of Clinical Investigation 104, 469-481 [Abstract/Full Text]
TOBACMAN, L. S., LIN, D., BUTTERS, C., LANDIS, C., BACK, N., PAVLOV, D. & HOMSHER, E. (1999). Functional consequences of troponin T mutations found in hypertrophic cardiomyopathy. Journal of Biological Chemistry 274, 28363-28370 [Abstract/Full Text]
WATKINS, H., MCKENNA, W. J., THIERFELDER, L., SUK, H. J., ANAN, R., O'DONOGHUE, A., SPIRITO, P., MATSUMORI, A., MORAVEC, C. S., SEIDMAN, J. G. & SEIDMAN, C. E. (1995). Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy. New England Journal of Medicine 332, 1058-1064 [Abstract/Full Text]
WATKINS, H., SEIDMAN, C. E., SEIDMAN, J. G., FENG, H. S. & SWEENEY, H. L. (1996). Expression and functional assessment of a truncated cardiac troponin T that causes hypertrophic cardiomyopathy. Evidence for a dominant negative action. Journal of Clinical Investigation 98, 2456-2461 [Abstract/Full Text]
ZHANG, R., ZHAO, J., MANDVENO, A. & POTTER, J. D. (1995). Cardiac troponin I phosphorylation increases the rate of cardiac muscle relaxation. Circulation Research 76, 1028-1035 [Abstract/Full Text]

Acknowledgements

We would like to thank especially Drs R. John Solaro, Pieter de Tombe and Leslie A. Leinwand for their helpful comments. Thanks also to Linda Alaniz-Avila for assistance with photography. This work was supported by a Grant-In-Aid from the American Heart Association of Metropolitan Chicago 9807905x (to M.C.).

Corresponding author

M. Chandra: Department of VCAPP, 205 Wegner Hall, Washington State University, Pullman, WA 99164-6520, USA.

Email: murali{at}vetmed.wsu.ed


This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Chandra, M. L. Tschirgi, S. J. Ford, B. K. Slinker, and K. B. Campbell
Interaction between myosin heavy chain and troponin isoforms modulate cardiac myofiber contractile dynamics
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1595 - R1607.
[Abstract] [Full Text] [PDF]


Home page
Biophys. JHome page
H. He, M. M. Javadpour, F. Latif, J. C. Tardiff, and J. S. Ingwall
R-92L and R-92W Mutations in Cardiac Troponin T Lead to Distinct Energetic Phenotypes in Intact Mouse Hearts
Biophys. J., September 1, 2007; 93(5): 1834 - 1844.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Frey, K. Brixius, R. H. G. Schwinger, T. Benis, A. Karpowski, H. P. Lorenzen, M. Luedde, H. A. Katus, and W. M. Franz
Alterations of Tension-dependent ATP Utilization in a Transgenic Rat Model of Hypertrophic Cardiomyopathy
J. Biol. Chem., October 6, 2006; 281(40): 29575 - 29582.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
M. L. Tschirgi, I. Rajapakse, and M. Chandra
Functional consequence of mutation in rat cardiac troponin T is affected differently by myosin heavy chain isoforms
J. Physiol., July 1, 2006; 574(1): 263 - 273.
[Abstract] [Full Text] [PDF]


Home page
Biophys. JHome page
M. Chandra, M. L. Tschirgi, I. Rajapakse, and K. B. Campbell
Troponin T Modulates Sarcomere Length-Dependent Recruitment of Cross-Bridges in Cardiac Muscle
Biophys. J., April 15, 2006; 90(8): 2867 - 2876.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. R. Ertz-Berger, H. He, C. Dowell, S. M. Factor, T. E. Haim, S. Nunez, S. D. Schwartz, J. S. Ingwall, and J. C. Tardiff
Changes in the chemical and dynamic properties of cardiac troponin T cause discrete cardiomyopathies in transgenic mice
PNAS, December 13, 2005; 102(50): 18219 - 18224.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. E. Montgomery, V. L. M. Rundell, P. H. Goldspink, D. Urboniene, D. L. Geenen, P. P. de Tombe, and P. M. Buttrick
Protein kinase C{varepsilon} induces systolic cardiac failure marked by exhausted inotropic reserve and intact Frank-Starling mechanism
Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H1881 - H1888.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. E. Stelzer, J. R. Patel, M. C. Olsson, D. P. Fitzsimons, L. A. Leinwand, and R. L. Moss
Expression of cardiac troponin T with COOH-terminal truncation accelerates cross-bridge interaction kinetics in mouse myocardium
Am J Physiol Heart Circ Physiol, October 1, 2004; 287(4): H1756 - H1761.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
J. G. Crilley, E. A. Boehm, E. Blair, B. Rajagopalan, A. M. Blamire, P. Styles, W. J. McKenna, I. Ostman-Smith, K. Clarke, and H. Watkins
Hypertrophic cardiomyopathy due to sarcomeric gene mutations is characterized by impaired energy metabolism irrespective of the degree of hypertrophy
J. Am. Coll. Cardiol., May 21, 2003; 41(10): 1776 - 1782.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Watkins
Genetic Clues to Disease Pathways in Hypertrophic and Dilated Cardiomyopathies
Circulation, March 18, 2003; 107(10): 1344 - 1346.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Robinson, M. Mirza, A. Knott, H. Abdulrazzak, R. Willott, S. Marston, H. Watkins, and C. Redwood
Alterations in Thin Filament Regulation Induced by a Human Cardiac Troponin T Mutant That Causes Dilated Cardiomyopathy Are Distinct from Those Induced by Troponin T Mutants That Cause Hypertrophic Cardiomyopathy
J. Biol. Chem., October 18, 2002; 277(43): 40710 - 40716.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. Moolman-Smook, E. Flashman, W. de Lange, Z. Li, V. Corfield, C. Redwood, and H. Watkins
Identification of Novel Interactions Between Domains of Myosin Binding Protein-C That Are Modulated by Hypertrophic Cardiomyopathy Missense Mutations
Circ. Res., October 18, 2002; 91(8): 704 - 711.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. B. Marston, J. S. Ingwall, and S. B. Glueck
Calcium, contractions, and tropomyosin Focus on "Divergent abnormal muscle relaxation by hypertrophic cardiomyopathy and nemaline myopathy mutant tropomyosins"
Physiol Genomics, May 10, 2002; 9(2): 57 - 58.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar