| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Journal of Physiology (2001), 536.3, pp. 769-783
© Copyright 2001 The Physiological Society
 |
ABSTRACT |
|---|
 TopAbstract IntroductionMethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Mutations in the renal chloride channel, ClC-5, cause Dent's disease (Wrong et al. 1994; Lloyd et al. 1996, 1997). The pathophysiology underlying this X-linked renal tubular disorder is complex and is characterized, in males, by abnormally high urinary levels of low molecular weight proteins (low molecular weight proteinuria), excessive urinary calcium excretion (hypercalciuria), intrarenal calcification (nephrocalcinosis), formation of calcium kidney stones (nephrolithiasis) and renal failure.
ClC-5 is a member of the ClC family of chloride channels (Jentsch et al. 1995; Waldegger & Jentsch, 2000). It is mainly expressed in the kidney in humans (Fisher et al. 1994) and in mouse, although murine ClC-5 (mClC-5) is also expressed in brain, testis and liver (Tanaka et al. 1999). Mammalian ClC-5 conferred strongly outwardly rectifying Cl- currents at the plasma membrane when expressed in CHO-K1 cells (Sakamoto et al. 1996), Xenopus oocytes (Steinmeyer et al. 1995; Lloyd et al. 1996) and HEK cells (Friedrich et al. 1999); as did the expression of amphibian ClC-5 in Xenopus oocytes (Mo et al. 1999). Rat ClC-5 currents in CHO-K1 cells were sensitive to inhibition by the stilbene derivative DIDS, whereas human and amphibian ClC-5 were not. The marked outward rectification of ClC-5 currents in these heterologous expression systems is difficult to reconcile with a physiological role as a plasma membrane Cl- conductance at physiological membrane potentials.
Localization studies of ClC-5 have shown it to be present at the apical pole (just below the brush border) of mouse, rat and human kidney proximal tubular cells (Günther et al. 1998; Devuyst et al. 1999; Sakamoto et al. 1999), where it appears to be colocalized with the proton pump (Günther et al. 1998; Sakamoto et al. 1999). These findings together with work in model proximal tubule (PT) cells (Dowland et al. 2000) suggest an endosomal location where ClC-5 provides the electrical shunt necessary for intravesicular acidification in the proximal tubule. Defects in ClC-5 may result in impaired endocytosis of proteins in the proximal tubule and thus explain the low molecular weight proteinuria observed in Dent's disease. However, this fails to explain the entire phenotype, especially the nephrocalcinosis and renal stone formation.
Murine models of Dent's disease have enabled further understanding of the complex phenotype. The mouse model reported by Piwon et al. (2000) demonstrates convincingly that disruption of ClC-5 leads to a reduction in apical proximal tubule endocytosis, with slowing of internalization of transporter molecules NaPi2 and NHE3. However these mice did not develop calculi or nephrocalcinosis, probably because the animals were not hypercalciuric (Piwon et al. 2000). Calcium homeostasis and the presence of hypercalciuira may be dependent upon ClC-5 affecting parathyroid hormone (PTH) and 1,25 dihydroxy vitamin D levels. Hypercalciuria has, however, been demonstrated in two other murine models. The first model demonstrated a modest hypercalciuria, which was age dependent and corrected by dietary deprivation of calcium, and an intestinal defect of calcium rather than a renal defect was suggested (Luyckx et al. 1999). The second model reported by Wang et al. (2000) demonstrates a broad phenotype including hypercalciuria and evidence of renal calcium deposition, in addition to low molecular weight proteinuria and aminoaciduria. This tantalizing model includes many of the phenotypical features of Dent's disease and has confirmed a role for ClC-5 in the proximal tubule.
ClC-5 is expressed not only in the proximal tubule, but also in the thick ascending limb and the collecting duct. The role of ClC-5 in these nephron segments has still to be elucidated. Calcium and pH homeostasis are highly regulated in the distal nephron and the Dent's disease phenotype suggests a crucial role for ClC-5 is possible. Both in situ hybridization and immunocytochemistry show ClC-5 to be present in type A (acid-secreting) intercalated cells in human medullary collecting duct (Devuyst et al. 1999), rat cortical and inner medullary collecting duct (Luyckx et al. 1998; Obermüller et al. 1998; Günther et al. 1998), and mouse cortical collecting duct (Sakamoto et al. 1999). In intercalated cells ClC-5 appears to be located at the apical cell pole and this has led to the hypothesis that ClC-5 acts as a plasma membrane chloride conductance to facilitate proton pumping across the apical membrane (Günther et al. 1998; Devuyst et al. 1999; Sakamoto et al. 1999). In native renal epithelial cells there is as yet no direct evidence to establish whether or not ClC-5 functions as a chloride conductance at the plasma membrane.
In order to test the hypothesis that ClC-5 functions as a plasma membrane chloride conductance we have studied the molecular expression, electrophysiological properties and localization of ClC-5 in a murine renal epithelial cell line, mIMCD-3. These cells retain the cellular characteristics of the intact collecting duct, including formation of polarized, functional epithelia (Rauchman et al. 1993), and have been used as a model for cell biological studies and electrophysiological characterization (Delpire et al. 1994; Sansom et al. 1994; Shindo et al. 1996; Stewart et al. 2001).
Here we demonstrate that mIMCD-3 cells express the murine homologue of ClC-5 (mClC-5). We have cloned mClC-5 from both mouse kidney and mIMCD-3 cells and have determined that it functions as a plasma membrane Cl- conductance, after heterologous expression in CHO-K1 cells. Whole-cell patch-clamp measurements then assessed the relative contribution of mClC-5 to whole-cell chloride conductance in mIMCD-3 cells. Using GFP-tagged mClC-5 we have localized mClC-5 to acidic endosomes in mIMCD-3 cells. This work has enabled, for the first time, assessment of the location and likely function of mClC-5 in a native renal epithelial cell. Some of the present data have appeared in abstract form (Stewart et al. 1999; Sayer, 1999).
|
METHODS |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Tissue culture
mIMCD-3 cells (murine renal epithelial cell line) were cultured in 50:50 v/v Ham's F-12 and Dulbecco's modified Eagle's medium with 2 g l-1 glucose, 10 % v/v fetal calf serum (FCS), 2 mM L-glutamine and 30 mg ml-1 gentamicin, and CHO-K1 cells (Chinese hamster ovary cell line, K1 subclone) were cultured in Ham's F-12, 10 % v/v FCS and 2 mM L-glutamine at 37 °C and 5 % CO2. Cells were seeded onto 13 mm glass coverslips at a density of 30 000 cells cm-2 and used for experiments 1-3 days later.
RNA preparation
Adult Balb/c female mice were killed by cervical dislocation according to Schedule 1 of the Animals (Scientific Procedures) Act 1986, in accordance with University of Newcastle upon Tyne Animal Ethical Committee procedures. Kidneys were dissected and frozen in liquid N2. Tissue was ground, RNAzol B (Biogenesis Ltd, Poole, UK) added, then homogenized. Total RNA was isolated via a phenol- chloroform extraction protocol and poly A+ RNA was extracted using oligo dT cellulose resin (Pharmacia Biotech, St Albans, UK). mIMCD-3 cell layers were washed with phosphate buffered saline (PBS), then exposed to lysis buffer (200 mM NaCl, 200 mM Tris-HCl pH 7.5, 1.5 mM MgCl2, 4.7 µM disodium EDTA, 2 % SDS, 1 µg proteinase K). Poly A+ RNA was extracted using oligo dT cellulose resin (Pharmacia Biotech).
Molecular biology
Gene specific primer pairs for full-length mClC-5 (Tanaka et al. 1999) were 5' ATCATGGACTTCTTGGAGGAGCCA 3' and 5' CTAGTTGAAGAGAATGGAATCAGG 3' (2238 bp). An alternative reverse primer 5' CGTTGAAGAGAATGGAATCAGGG 3' omits the wild type stop codon and allowed for in-frame T/A cloning into expression vector pcDNA3.1/CT-GFP. Internal primers 5' GTCGAGGTACTCATTGTGACG 3' and 5' GCAGCCCCAACCATGGCATA 3' recognized a 452 bp mClC-5 product. Poly A+ RNA from murine kidney and mIMCD-3 cells was used as the template for RT reactions (Marathon cDNA Amplification Kit, Clontech Laboratories, Basingstoke, UK). The internal and full-length mClC-5 PCR products were obtained using Expand (Taq DNA polymerase/ Pwo DNA polymerase) enzyme (Boehringer Mannheim). Full-length mouse kidney mClC-5 was cloned into expression vector pcDNA3.1/CT-GFP (Invitrogen, Grøningen, The Netherlands). Recombinants were screened, expanded, purified then directly sequenced (BigDye Terminator Cycle Sequencer, ABI Prism, CA, USA) to confirm orientation and fidelity. DNA sequence analysis software (Corpet, 1998) compared nucleotide sequences cloned from whole kidney and mIMCD-3 mRNA. The following constructs were produced: sense ClC-5 (SClC5) construct (full-length wild type murine ClC-5, including C-terminal stop codon); antisense ClC-5 (ASClC5) construct (full-length reverse orientation mClC-5 (stop codon reached after 259 bp translation)); ClC-5-GFP fusion protein (mClC-5-GFP) construct (full-length ClC-5, omitting stop codon and cloned in-frame with Super GFP at the C-terminus); and control GFP (CGFP) construct (vector encoding Super GFP, Invitrogen). Constructs mClC-5-GFP and pIRES2-EGFP (Clontech) were both digested with restriction enzymes Nhe I and Sac II. The digested mClC-5 insert was religated into pIRES2- EGFP to produce an additional (biscistronic) construct (BClC5GFP). In a similar manner, mClC-5 insert was also digested and religated into pcDNA3.1/myc-His(A) (Invitrogen) using restriction enzymes Kpn I and Xba I, producing mClC-5-myc-His for use as an alternative epitope tag. Recombinants were screened for insert by PCR then sequenced to confirm reading frame and orientation.
Transfection
Cells were plated onto glass coverslips and cultured for 24 h. mIMCD-3 cells and CHO-K1 cells were transfected using Effectene and Supafect Transfection reagents (Qiagen, Crawley, UK), respectively, as per manufacturers protocol. For patch-clamp experiments CGFP was transfected alone (mock-transfection) or co-transfected with either construct ASClC5 or SClC5 DNA (µg) at a ratio of 1:3 (CGFP:ASClC5 or CGFP:SClC5). As an alternative to co-transfection BClC5GFP was transfected alone. For localization experiments mClC-5-GFP or mClC-5-myc-His was transfected into mIMCD-3 and CHO-K1 cells.
Localization of GFP-tagged constructs and immunocytochemistry
Positive transfectants were identified by their green fluorescence at 24 h post-transfection and imaged by confocal laser scanning microscopy (CLSM) using a Leica TCS NT system. Plasma membrane localization was achieved by pre-incubating cells at 4 °C for 30 min, followed by a 2 min incubation with tetramethyl rhodamine-5-isothiocyanate (TRITC)-conjugated wheat germ agglutinin (TRITC- WGA; Sigma; 50 µg ml-1) prior to methanol fixation. Colocalization experiments were carried out by incubation of live cells with LysoTracker Red (Molecular Probes; 50 ng ml-1) for 30 min at 37 °C and 5 % CO2 and imaged both with and without methanol fixation. Propidium iodide (Sigma) at a concentration of 25 µg ml-1 incubated with fixed cells for 10 min was used for nuclear staining. Cells transfected with mClC-5-myc-His were fixed in 2 % paraformaldehyde, permeabilized with 0.1 % Triton X-100 and blocked by 30 min incubation with 3 % horse serum in PBS. Positively transfected cells were identified using an anti-myc-IgG FITC-conjugated antibody (Sigma). Untreated mIMCD-3 cells were fixed and blocked in an identical manner then incubated with PEP5A1, anti-ClC-5, antibody (1:500) overnight at 4 °C. FITC-conjugated goat antibodies to rabbit IgG (Sigma) were used for secondary detection. Control experiments omitted the primary antibody.
Electrophysiology
Coverslips were placed in a tissue bath mounted on a Nikon Diaphot inverted microscope (Nikon, UK) and viewed using phase contrast optics. Current recordings were made at 30 °C or room temperature from either single cells or cells in small clusters, using fast (ruptured-patch, fWCR) or slow (perforated-patch, sWCR) configurations of the whole-cell patch-clamp technique (Hamill et al. 1981; Horn & Marty, 1988). Positive transfectants were identified by green fluorescence when visualized using UV illumination with a standard FITC filter set. All experiments on transfected cells were performed blind.
Pipettes were pulled from borosilicate glass and had resistances, after fire polishing, of 3-6 M
. Seal resistances were typically between 5 and 20 G. Whole-cell currents were measured with an EPC-7 (sWCR) or EPC-9 (fWCR) patch-clamp amplifier (HEKA Electronics, Lambrecht, Germany). The cells were clamped to a holding potential of 0 mV and the current responses to 20 mV depolarizing and hyperpolarizing voltage pulses were measured between ±80 or ±100 mV. Voltage steps lasted between 0.5 and 1.0 s depending on the experiment. Input capacitance was routinely measured for each cell and compensated for by circuitry built into the EPC-7 and EPC-9. Voltage stimulation and data acquisition were achieved using a CED 1401 interface (CED, Cambridge, UK) or a 16-bit DA and AD converter (ITC-16, Instrutech, Port Washington, USA), controlled by a PC, using the CED or Pulse (HEKA Electronics) software, respectively. Data were filtered at 1 kHz by an 8-pole Bessel filter and sampled at 2 kHz. Data were analysed using CED software or PulseFit and PulseTools (HEKA Electronics).
Mean currents were normalized and expressed as current densities (pA pF-1) and measured at the reversal potential (Erev) ± 60 mV, while inhibition values were calculated at Erev ± 80 or ± 100 mV. All I-V plots were fitted with fourth order polynomials using a Microsoft Quickbasic program or SigmaPlot (SPSS Science Software, Chicago, IL, USA). Voltages were corrected for junction potentials using the JPCalc program (JPCalc v.2.02, P. H. Barry). See Shindo et al. (1996) for further details.
The Goldman equation was used to calculate the relative cation to chloride permeability (eqn (1)) and the relative anion selectivity (eqn (2)), where X- is an anion, and R, T, z and F have their usual meanings):
| (1) |
| (2) |
Solutions and chemicals
The pipette solution for sWCR contained (mM): 10.0 NaCl, 130.0 KCl, 2.0 MgCl2, 10.0 Hepes, pH 7.2 (osmolality 273 ± 2 mosmol kg-1; Cl- content, 143 ± 1 mM). For fWCR the pipette solution contained (mM): 10.0 NaCl, 130.0 CsCl, 2.0 MgCl2, 10.0 Hepes, 5.0 EGTA, pH 7.2 (osmolality 279 ± 3 mosmol kg-1; Cl- content, 144 ± 1 mM). The standard NaCl-rich bath solution contained (mM): 137.0 NaCl, 5.4 KCl, 2.8 CaCl2, 1.2 MgSO4, 0.3 NaH2PO4, 0.3 KH2PO4, 14.0 Tris base, 5.0 glucose, pH 7.4 (299 ± 1 mosmol kg-1; Cl- content, 160 ± 1 mM). Anion/cation selectivity of currents was determined by replacing NaCl (100 mM) in the standard bath solution with an osmotically equivalent amount of mannitol. The resulting shift in reversal potential (Erev) was used to calculate Pcation/PCl (see eqn (1)). For relative anion-permeability studies, 100 mM NaCl was replaced with sodium aspartate (see eqn (2)), unless indicated otherwise. The chloride channel blocker 4,4'-diisothiocyanato-stilbene-2,2'-disulphonic acid (DIDS) was made up as a 50 mM stock solution in dimethylsulphoxide (DMSO) on the day of experiments and then diluted to a final concentration of 100-500 µM. Nystatin (Calbiochem), used in the slow whole-cell experiments, was dissolved in DMSO to form a 40 mM stock solution and diluted in pipette solution to form a working concentration of 150-300 µM.
Statistics
All results are given as means ± S.E.M. with n being the number of observations. Significance was tested at the 5 % level using ANOVA (Tukey's multiple test) and Student's t test (paired or unpaired as appropriate) using Instat (v.2.02, Graphpad Software).
|
RESULTS |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Endogenous expression of mClC-5 in mIMCD-3 cells
Figure 1 shows RT-PCR of mIMCD-3 mRNA using full-length and internal primer pairs for ClC-5. PCR products of the expected sizes (full length 2.2 kb, internal 452 bp) were observed. With the RT sample used for the internal mClC-5 primer pair (Fig. 1B) a PCR reaction over an identical number of amplification cycles was performed for 
-actin, thus confirming significant mClC-5 expression and excluding the possibility of over amplification to yield the observed mClC-5 product. Identical mClC-5 PCR products were obtained for mRNA extracted from whole mouse kidney (not shown). All PCR products were cloned and sequenced and a comparison of the full-length cDNA sequence of ClC-5 from mIMCD-3 cells confirmed 100 % identity to mClC-5 cloned from mouse kidney and 100 % identity to the published mouse ClC-5 sequence (GenBank accession number AF134117). These data confirm endogenous mClC-5 mRNA expression in mIMCD-3 cells.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 1. Constitutive expression of mClC-5 mRNA in mIMCD-3 cells Agarose gel electrophoresis of reverse transcriptase polymerase chain reaction (RT-PCR) products using mIMCD-3 mRNA template. A, lane 1, RT control omitted reverse transcriptase enzyme. Lane 2, PCR control used H2O instead of mIMCD-3 mRNA template. M, 100 bp DNA size marker. Lane 3, full-length (2238 bp) mClC-5. B, M, 100 bp DNA size marker. Lane 1, internal mClC-5 (452 bp). Lane 2, internal | ||
Transfection of CHO-K1 cells with mClC-5
In order to investigate the biophysical characteristics of mClC-5, we first performed transient transfection of the CHO-K1 cell line and studied these cells using both fast and slow whole-cell patch-clamp current recordings. This cell line was used to characterize the properties of ClC-5 in the original description of this conductance (Sakamoto et al. 1996). In mock-transfected (GFP alone) CHO-K1 cells, using fast whole-cell recording conditions designed to block endogenous K+ conductances (Cs+-rich pipette solution - see Methods), whole-cell currents were small and voltage independent (Fig. 2Aa), with a current density at 60 mV of 2.2 ± 1.3 pA pF-1 (n = 15). This was not significantly different to control (untreated) cells (1.4 ± 0.8 pA pF-1, n = 25). Figure 2Ab shows that under identical recording conditions, strongly outwardly rectifying currents could be detected in cells co-transfected with mClC-5 and GFP or with biscistronic vector BClC5GFP (see Methods). From a holding potential of 0 mV, whole-cell currents exhibited clear voltage-dependent activation at membrane potentials greater than 40 mV and currents reached steady-state levels within 300-350 ms following the voltage step. The currents were markedly rectifying with little evidence of inward current flow (Fig. 2Ad, upward triangles). Reducing extracellular Cl- concentration 10-fold (aspartate replacement) (Fig. 3Aa and b), decreased outward current by ~50 % (to 15.5 ± 3.0 pA pF-1, n = 5) consistent with a Cl--selective current (Fig. 3Ac). Application of 0.5 mM DIDS to the bathing solution (Fig. 2Ac and d, downward triangles) had no effect on current size (control 58.8 ± 3.0 pA pF-1, n = 15; plus DIDS 56.2 ± 5.6 pA pF-1, n = 4). These biophysical properties are characteristic of ClC-5 (Lloyd et al. 1996; Friedrich et al. 1999; Dowland et al. 2000). DIDS insensitivity as reported for murine ClC-5 (present data) has also been observed for porcine ClC-5 (Dowland et al. 2000). This insensitivity to DIDS, however, is opposite to that found in the original description of this conductance (Sakamoto et al. 1996).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 2. Comparison of the properties of the transfected mClC-5 conductance and endogenous Ca2+-activated Cl- conductance in CHO-K1 cells Biophysical characteristics and DIDS sensitivity of fast whole-cell currents stimulated by transient transfection with mClC-5 (A) or a rise in intracellular Ca2+ (B) in CHO-K1 cells. Aa, whole-cell currents from a cell transfected with GFP control vector only. Ab, whole-cell currents from a cell co-transfected with GFP and mClC-5. Ac, effect of extracellular DIDS (500 µM) on the mClC-5 conductance. Ad, I-V relationships of the whole-cell current data in Aa ( | ||
 |
View larger version [in this window] [in a new window] |
|
|
Figure 3. Anion selectivity of transfected mClC-5 conductance and endogenous Ca2+-activated Cl- conductance in CHO-K1 cells Biophysical characteristics and Cl- selectivity of fast whole-cell currents stimulated by transient transfection with mClC-5 (A) or a rise in intracellular Ca2+ (B) in CHO-K1 cells. Aa, whole-cell currents recorded from a cell co-transfected with GFP and mClC-5. Ab, 10-fold reduction in bath [Cl-] using aspartate replacement (132.5 mM). Ac, I-V relationships of whole-cell current data in Aa ( | ||
In our fWCR experiments the free cytosolic calcium concentration was set to ~10 nM in order to inhibit any endogenous calcium-activated currents. However, Fig. 2Bb shows that very large outwardly rectifying currents could be activated if cells were exposed to ionomycin (250 nM) for several minutes in order to increase intracellular calcium. Current density increased from 1.3 ± 0.6 pA pF-1 for control cells to 498 ± 90.2 pA pF-1 after ionomycin stimulation (n = 10). At steady state these currents showed little kinetics (Fig. 2Bb) and the I-V relationship was moderately outwardly rectifying (Fig. 2Bd, upward triangles). The currents were confirmed as being anion selective since a 100 mM reduction in external NaCl reduced outward currents to 246.7 ± 87.8 pA pF-1 (n = 4) (Fig. 3Ba and b) and shifted the reversal potential by 23.7 ± 1.2 mV (Fig. 3Bc) giving a Pcation/Panion of 0.09 ± 0.05. In marked contrast to ClC-5, these ionomycin-activated currents were strongly inhibited by extracellular DIDS (Fig. 2Bc and d), and current density decreased by ~90 % to 32.2 ± 7.9 pA pF-1 (n = 4) at 80 mV, properties consistent with the presence of Ca2+-activated Cl- conductance (CaCC).
Our fWCR experiments clearly indicate that currents with the characteristic properties of mClC-5 can be detected in transfected CHO-K1 cells by choosing appropriate recording conditions. One of the goals of this present work was to determine if a ClC-5 conductance could also be detected in native mIMCD-3 cells, expressing normal levels of the protein. This is an important question to answer since it would help clarify the role of ClC-5 in these cells. However, we have recently shown that an endogenous CaCC in mIMCD-3 cells is markedly affected by the recording configuration used (Stewart et al. 2001). In this study we found that the Cl- conductance was far more stable over time, and retained responses to changes in intracellular calcium, when studied with the slow whole-cell recording mode using nystatin-perforated patches. fWCR resulted in substantial current run down and a failure to respond to calcium (Shindo et al. 1996; Stewart et al. 2001). Due to the potential problems associated with fWCR we felt it was important to use perforated-patch recordings to test for ClC-5 currents in mIMCD-3 cells. However, we wanted to first ensure that we could detect mClC-5 in the CHO-K1 cells under similar conditions.
Slow whole-current recordings from untreated CHO-K1 cells with a K+-rich pipette solution produced currents consistent with a resting K+ conductance. These currents had an Erev value of -39.0 ± 4.2 mV (n = 4, potassium equilibrium potential (EK) -81.7 mV), a current density of 36 ± 6 pA pF-1 (n = 4, at Erev +60 mV) and displayed voltage-dependent kinetics (data not shown). In contrast, the majority (6/8) of the recordings from treated, but non-fluorescent cells, had whole-cell currents with properties similar to the ionomycin-activated currents seen in fWCR. Currents were voltage independent, outwardly rectifying and had a more positive Erev (-5.6 ± 3.5 mV, n = 6, P < 0.01, unpaired t test) with a current density of 46 ± 10 pA pF-1 (n = 6) and a Pcation/PCl value of 0.33 ± 0.06 (n = 3). External application of 500 µM DIDS inhibited this conductance by 76 ± 6 % at 100 mV (n = 3). A similar, but larger current was seen in the mock-transfected cells (CGFP). This had an Erev value of -11.2 ± 6.1 mV, and a current density of 87 ± 28 pA pF-1 (n = 3). Although larger (P < 0.05, unpaired t test), the kinetics and inhibition by 500 µM DIDS (74 %, n = 2) were similar to those of non-fluorescent cells. Regardless of treatment, all cells tested subsequently responded to ionomycin, which activated the same type of voltage-independent, outwardly rectifying Cl- conductance. Current density increased from 39 ± 14 to 177 ± 35 pA pF-1 (n = 5, P < 0.05, paired t test), and Erev value shifted from -22.4 ± 10.8 to -6.1 ± 3.2 mV (n = 5), i.e. towards ECl (-2.9 mV). The ionomycin-activated current had a Pcation/PCl of 0.38 ± 0.07 (n = 3) and was inhibited by 500 µM DIDS (69 ± 6 %, n = 3). These results show that in untreated (control) cells the endogenous CaCC is not active. However, it appears that either exposing cells to transfection reagents and/or transfecting cells with GFP alone increases the activity of CaCC such that it becomes active under resting conditions.
Despite these problems with the presence of the endogenous CaCC, we found that a distinct Cl- current was present in SClC5-GFP co-transfected cells (Fig. 4A). All transfected cells studied (n = 9) displayed a Cl- current that was outwardly rectifying and exhibited time-dependent activation at membrane potentials > 60 mV (Fig. 4A). These whole-cell currents had a current density of 94 ± 12 pA pF-1, an Erev value of -6.6 ± 3.6 mV (n = 9) and a Pcation/PCl of 0.23 ± 0.05, (n = 3). Furthermore, mClC5-transfected whole-cell currents were relatively insensitive to 500 µM DIDS (inhibition of 32 ± 8 % at 60 mV (Fig. 4B and C). The extent of this DIDS inhibition was significantly less than that observed for basal and ionomycin-activated Cl--selective currents (P < 0.05, ANOVA). The DIDS-sensitive component of mClC-5 currents (31 ± 7 pA pF-1 at Erev of +100 mV) probably corresponds to the presence of a small endogenous CaCC component.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 4. Identification of mClC-5 in transfected CHO-K1 cells using slow whole-cell current recordings A, whole-cell currents from a fluorescent cell co-transfected with mClC-5 and GFP. B, effect of extracellular DIDS (500 µM) on the mClC-5 conductance. C, I-V relationships of the whole-cell current data shown in A (plot C) and B (plot D). Currents were obtained between ±100 mV. The steady-state I-V relationships were plotted using the current present 300 ms into the voltage steps. | ||
Localization of mClC-5-GFP in transfected CHO-K1 cells
CLSM of CHO-K1 cells, transfected with mClC-5-GFP construct, revealed a distinct punctate pattern of green fluorescence at or near the plasma membrane, with additional cytoplasmic fluorescence present in the perinuclear region (Fig. 5A). In order to confirm the plasma membrane localization, unfixed cells were pre-incubated with a fluorescent lectin marker at 4 °C, to prevent rapid endocytosis. Figure 5B and C clearly indicates that mClC-5-GFP and TRITC-WGA are co-localized at the cell periphery, consistent with localization at the plasma membrane. This localization implies that CHO-K1 cells are able to traffic mClC-5 to the plasma membrane and is entirely consistent with the electrophysiological data from SClC5-transfected CHO-K1 cells (Figs 2-4).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 5. Localization of mClC-5 in CHO-K1 and mIMCD-3 cells Confocal laser scanning microscope images (mid-cell single xy sections) of methanol fixed CHO-K1 cells (A and B) and mIMCD-3 cells (D and E), paraformaldehyde fixed mIMCD-3 cells (G-I) and unfixed mIMCD-3 cells (J-L). A and D, mClC-5-GFP-transfected cells counter-stained with propidium iodide (red) to show nucleus. B and E, mClC-5-GFP-transfected cells were incubated for 2 min with TRITC-conjugated wheat germ agglutinin (TRITC-WGA) (red) at 4 °C to stain the plasma membrane and minimize internalization (see Methods). C and F, quantification of pixel intensity along cell diameter (blue bar, B and E) for mClC-5-GFP (green) and TRITC-WGA (red). Note colocalization of markers in C at the plasma membrane (marked by *) in CHO-K1 cells but not in mIMCD-3 cells (F). G, mClC-5-myc-His-transfected cell identified by anti-myc-IgG FITC-conjugated antibody, nuclei counter-stained with propidium iodide. H and I, untreated mIMCD-3 cells demonstrating endogenous expression of ClC-5 using PEP5A1 anti-ClC-5 antibody (omitted in control, I) detected with goat anti-rabbit IgG FITC-conjugated secondary antibody. J, K and L, mIMCD-3-transfected with mClC-5-GFP and preincubated with LysoTracker Red for 30 min prior to visualization. J, mClC-5-GFP localization; K, LysoTracker Red localization; L, overlay of J and K. (All scale bars 10 µm.) | ||
Intrinsic mIMCD-3 Cl- currents
Since ClC-5 mRNA could be readily detected in mIMCD-3 cells, we used the slow whole-cell patch-clamp recording technique to determine if currents with the biophysical properties of ClC-5 (see above) were present. Of 87 mIMCD-3 cells studied, 93 % exhibited whole-cell currents that were Cl- selective. The remaining 7 % of cells had currents that were not Cl- selective, and are not discussed further. There were three distinct patterns of Cl--selective whole-cell current observed, based on biophysical properties, and all three were observed in single cells and in cells from confluent cell areas.
The majority of mIMCD-3 Cl--selective cells, 65 % (53/81), had whole-cell currents which exhibited an outwardly rectifying I-V relationship with no apparent time- or voltage-dependent kinetics (ORtindep). Figure 6A shows a representative whole-cell current recording of ORtindep, while the steady-state I-V relationship is shown in Fig. 6B. Overall, the mean Erev value was -8.1 ± 1.1 mV and current density was 301 ± 28 and -193 ± 17 pA pF-1 (n = 53). Figure 6B shows that replacing 100 mM NaCl from the bath solution with mannitol caused a positive shift in Erev, with a mean change from 12 cells of 16.2 ± 1.0 mV (Pcation/PCl value of 0.22 ± 0.03), confirming that these currents were predominantly anion selective. Replacing 100 mM bath chloride with aspartate caused an 18.8 ± 1.5 mV shift in Erev value, giving a PAsp/PCl value of 0.17 ± 0.05.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 6. Properties of the major intrinsic whole-cell Cl- current, ORtindep, present in mIMCD-3 cells A, whole-cell Cl- current ORtindep; B, Cl- selectivity of ORtindep, shown by the positive shift in the Erev value upon changing standard NaCl bath solution (S) to reduced NaCl solution (R), in which 100 mM NaCl had been replaced by mannitol. C and D, ORtindep before (C) and after (D) addition of DIDS (100 µM). | ||
A minor population of mIMCD-3 Cl--selective cells displayed currents other than ORtindep. Twenty per cent of cells also had currents which exhibited an OR I-V relationship, but displayed time-dependent inactivation at positive (
80 mV) membrane potentials (ORtdep1). These currents had a mean Erev value of -10.6 ± 1.6 mV (n = 16), a current density of 189 ± 28 and -117 ± 17 pA pF-1 (n = 16) and a Pcation/PCl value of 0.22 ± 0.05 (n = 3). The final 15 % of cells exhibited a linear I-V relationship, with no time- or voltage-dependent kinetics (linear). These currents had a mean Erev value of -9.4 ± 3.3 mV (n = 12), a current density of 222 ± 49 and -215 ± 48 pA pF-1 (n = 12) and a Pcation/PCl value of 0.2 ± 0.02 (n = 5). Therefore all three types of currents in mIMCD-3 cells show biophysical properties which differ from those of mClC-5 expressed in CHO-K1 cells, suggesting mClC-5 does not produce an endogenous plasma membrane Cl- conductance in renal mIMCD-3 cells.
Effect of DIDS on mIMCD-3 slow whole-cell currents
In addition to its distinct biophysical properties, the present data show that mClC-5 from transfected CHO-K1 cells is insensitive to the Cl- channel blocker DIDS. We therefore determined the sensitivity of the three endogenous chloride-selective mIMCD-3 currents to externally applied DIDS using slow whole-cell recordings. ORtindep was significantly inhibited by DIDS (Fig. 6C and D). DIDS (500 µM) produced an inhibition of outward current of 90 ± 2 % (n = 4). The minor mIMCD-3 Cl- currents were also both sensitive to DIDS. For ORtdep1, 500 µM DIDS produced an inhibition of 64 ± 9 % (n = 3), and for the linear current the inhibition was 59 % (n = 2). Thus under equivalent experimental conditions to mClC-5-transfected CHO-K1 cells, the DIDS sensitivity of mIMCD-3 chloride-selective currents is distinct from that seen with ClC-5.
Characterization of whole-cell currents in mClC-5-transfected mIMCD-3 cells
To investigate further the role of mClC-5 in mIMCD-3 cells, cells were transfected with CGFP alone or co-transfected with CGFP and SClC5 or ASClC5. Forty-four out of forty-eight fluorescent cells studied (92 %) displayed ORtindep currents. This pattern was not different to non-fluorescent (NF) cells studied adjacent to transfectants, where 19 out of 22 cells (86 %) displayed this current. ORtindep current density in NF cells did not vary between treatment groups: ASClC5, 364 ± 54 and -169 ± 30 pA pF-1, n = 9; SClC5, 320 ± 77 and -173 ± 40 pA pF-1, n = 7; CGFP, 363 ± 33 and -188 ± 37 pA pF-1, n = 3 (P > 0.05, ANOVA). In contrast, the result in fluorescent cells (Fig. 7A) suggested that SClC5 increased the size of ORtindep currents, while ASClC5 had no effect. Figure 7B shows that the effect of SClC-5 transfection on ORtindep current density was evident 24 h post-transfection (P < 0.01, unpaired t test), but not 48 h post-transfection (P > 0.70, unpaired t test).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 7. The effect of mClC-5 transfection on the current density of ORtindep whole-cell Cl- current in mIMCD-3 cells GFP-expressing cells co-transfected with ASClC5 (anti-sense ClC-5), SClC5 (sense ClC-5) or CGFP (control GFP) constructs (24-48 h post-transfection, A), and 24 and 48 h post-transfection (B). Current densities (pA pF-1) were calculated at Erev +60 mV (left-hand columns) and Erev -60 mV (right-hand columns) and represent means ± S.E.M. | ||
In order to determine whether the apparent increase in ORtindep at 24 h post-transfection resulted from the presence of mClC-5 currents, the effect of DIDS was assessed. Figure 8A and B illustrates whole-cell ORtindep currents in an ASClC5 transfectant and a SClC5 transfectant, respectively, 24 h post-transfection, and show both were markedly inhibited by DIDS. In SClC5 transfectants, 500 µM DIDS inhibited ORtindep currents by 82 ± 5 and 63 ± 8 % (n = 3). A similar inhibition was achieved by 500 µM DIDS in ASClC5 transfectants (79 ± 9 and 58 ± 10 %, n = 3, P > 0.90, unpaired t test compared to SClC5; Fig. 8C). Thus the use of DIDS in SClC5 transfectants did not reveal any whole-cell currents with the time- and voltage-dependent kinetics typical of mClC-5, again strongly suggesting that mClC-5 was not expressed in the plasma membrane. In addition, currents of SClC5-transfected cells also had similar PAsp/PCl ratios compared to ASClC5 cells (Fig. 8D, SClC5 transfectants 0.24 ± 0.13, n = 3; ASClC5 transfectants 0.20 ± 0.07, n = 4, P > 0.80, unpaired t test).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 8. The effect of 500 µM DIDS upon ORtindep slow whole-cell Cl- currents present in mIMCD-3 cells, 1 day after transfection with either anti-sense or sense mClC-5 A, whole-cell current exhibited by an ASClC5 transfectant; B, whole-cell current exhibited by a SClC-5 transfectant (left, control; right, 500 µM DIDS). C, summary of the effects of 500 µM DIDS (left, Erev +100 mV and right, Erev -100 mV). D, relative chloride selectivity of ORtindep currents 24 h after transfection, represented by PAsp/PCl. Whole-cell currents obtained between ±100 mV. | ||
Localization of mClC-5 in transfected mIMCD-3 cells
In contrast to CHO-K1 cells, mIMCD-3 cells transfected with the mClC-5-GFP construct (Fig. 5D) showed fluorescence which was largely confined to intracellular, vesicular-like structures. In order to investigate the possibility that mClC-5 was present at the plasma membrane, unfixed cells were preincubated with TRITC-WGA at 4 °C. Figure 5E and F clearly indicates that mClC-5-GFP and TRITC-WGA are not extensively colocalized, mClC-5-GFP being most marked within intracellular endosomes. In contrast to CHO-K1 cells there is also little colocalization at the cell periphery (compare Fig. 5C and F); colocalization only being evident in a limited number of punctate (vesicular) structures close to the plasma membrane. These data are entirely consistent with the whole-cell patch-clamp data which failed to reveal any significant contribution of mClC-5-type currents to the whole-cell currents even at depolarizing cell potentials.
In order to eliminate the possibility that the C-terminal GFP altered trafficking of the mClC-5-GFP fusion protein we compared the cellular distribution of mClC-5- GFP to a C-terminal myc-His-tagged mClC-5 (Fig. 5G). This confirmed a predominantly intracellular distribution. Figure 5H and I shows that endogenous ClC-5 distribution, determined using the specific anti-ClC-5 antibody PEP5A1 (see Methods), is also similar, being restricted to intracellular endomembranes.
Using LysoTracker Red to identify acidic endosomes in mIMCD-3 cells, mClC-5-GFP fusion protein fluorescence colocalized to a sub-set of acidic compartments (Fig. 5J, K and L). A minor proportion of acidic vesicles did not show mClC-5-GFP fluorescence (Fig. 5L).
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
mClC-5 is expressed in mIMCD-3 cells, a fact confirmed by RT-PCR, cloning and sequencing. This provides further evidence that collecting duct cells may play a role in the pathophysiology of Dent's disease and also establishes that mIMCD-3 cells may be a useful model in which to further study ClC-5 function.
By expression of murine ClC-5 at the plasma membrane in CHO-K1 cells we find that mClC-5 is associated with the appearance of a DIDS-insensitive, strongly outwardly rectifying (OR) Cl- conductance. This is in agreement with the majority of previous studies describing the biophysical characteristics of ClC-5 conductances with these characteristics and an anion selectivity sequence of Cl- > I-. These functional data are therefore important in validating knockout mouse models in which ClC-5 is deleted (Luyckx et al. 1999; Piwon et al. 2000; Wang et al. 2000). However, the original report using CHO-K1 cells showed that ClC-5 expression produced an OR Cl- conductance which was inhibited significantly by DIDS and had a relative anion selectivity of I- > Cl- (Sakamoto et al. 1996). Here we report the presence of an OR, DIDS-sensitive, Cl- conductance in CHO-K1 cells that is strongly activated by ionomycin in the presence of external calcium. The properties of this intrinsic Cl- conductance are similar to those of a new family of Ca2+-activated Cl- conductances e.g. mClCA1 (Gandhi et al. 1998). Transfection with control GFP construct appeared to be associated with raised levels of this intrinsic conductance. Our results now provide a likely reason for the unusual characteristics previously reported for ClC-5 when expressed in CHO-K1 cells (Sakamoto et al. 1996), i.e. raised levels of an endogenous Cl- conductance partially masked the ClC-5 conductance. A precedent for this was seen with ClC-5 expressed in Xenopus oocytes. Here, Lindenthal et al. (1997) also originally reported DIDS sensitivity and I- > Cl- selectivity, only later to realize that stimulation of an endogenous Cl- conductance had obscured typical ClC-5 characteristics of DIDS insensitivity and Cl- > I- selectivity (Schmieder et al. 1998).
Investigation of native mIMCD-3 cells using the slow whole-cell configuration of the patch-clamp technique showed that the majority of whole-cell currents were Cl- selective, in agreement with previous fWCR (Shindo et al. 1996), and a more recent work using sWCR (Stewart et al. 2001). All three endogenous Cl- currents in mIMCD-3 cells possessed biophysical properties that were clearly distinct from mClC-5 expressed in CHO-K1 cells. The present results also show that mClC-5 was essentially insensitive to inhibition by DIDS in contrast to the endogenous Cl--selective currents in mIMCD-3 cells measured under equivalent recording conditions. It therefore appears highly unlikely that ClC-5 is represented by any of the intrinsic mIMCD-3 whole-cell Cl- currents. Direct CLSM imaging of the ClC-5-GFP fusion protein confirmed that little ClC-5 protein was present at the plasma membrane of mIMCD-3 cells, the majority being intracellular.
Transfection of mIMCD-3 cells with anti-sense mClC-5 had no effect on either the size or properties of the major intrinsic Cl- current ORtindep. Transfection with sense mClC-5 did not produce additional OR Cl- conductances with typical ClC-5 characteristics. However, mClC-5 overexpression did transiently increase the size of ORtindep without altering its properties. This may indicate a possible physiological role for ClC-5 in the regulation of plasma membrane Cl- conductances, similar to that seen in Xenopus oocytes (Lindenthal et al. 1997).
There was a marked difference in intracellular distribution of the ClC-5-GFP fusion protein between CHO-K1 cells and renal epithelial mIMCD-3 cells, a fact strongly supported by the electrophysiological evidence. mClC-5-GFP is retained within intracellular vesicular structures in mIMCD-3 cells. Additional control experiments using N-terminal GFP-tagged mClC-5 (not shown) and immunocytochemical experiments using C-terminal myc-His-tagged mClC-5 both confirm this intracellular location. In addition, mIMCD-3 cells endogenously express ClC-5 and immunocytochemical localization of the protein shows that with normal levels of protein it is still confined to intracellular endomembranes. mIMCD-3 cells are likely to provide the appropriate renal cellular environment (correct chaperones and targeting machinery) which may explain the difference in location observed with CHO-K1 cells. In contrast, the heterologous CHO-K1 expression system may allow mClC-5-GFP to reach the plasma membrane via the default pathway. Motif analysis (Pfam http://www.sanger.ac.uk/Pfam/) of the primary structure of mClC-5 indicates that the protein does not possess any identifiable plasma membrane retention motifs. However, two cystathionine beta-synthase (CBS) domains (Ponting, 1997) are present in the carboxyl termini of all eukaryotic ClC homologues and Jentsch and colleagues have shown that mutations in these domains destroyed proper function and localization of a yeast chloride channel homologue Gef1p (Schwappach et al. 1998). Recent work has also identified a PY-like motif between the two CBS domains of ClC-5, which may act as an endosomal internalization signal and when disrupted lead to increased plasma membrane expression and increased currents in Xenopus oocytes (Schwake et al. 2001).
A likely role for ClC-5 is to act as a Cl- conductance providing intravesicular counter-ion transport for the vacuolar H+-ATPase pump, thereby permitting effective intravesicular acidification. It is already known that ClC-5 colocalizes with the proton pump in the proximal tubule of both rat (Günther et al. 1998) and mouse (Sakamoto et al. 1999) kidney. We have now demonstrated that mClC-5 has an intracellular location and colocalizes with acidic vesicular compartments in mIMCD-3 cells. Interestingly, our studies found a subset of acidic compartments that did not appear to colocalize with ClC-5, similar to findings in mouse proximal tubular epithelia (Sakamoto et al. 1999). Defective acidification of intracellular organelles has already been shown in cystic fibrosis (CF; Barasch et al. 1991), another chloride channel disorder. Intriguingly, CF patients show a renal tubular defect of microscopic nephrocalcinosis (Katz et al. 1988) which is evident in kidneys of neonates and at the time of birth in affected individuals. Expression of cystic fibrosis transmembrane conductance regulator (CFTR) mRNA has been demonstrated throughout the length of the rat and human nephron, with varying levels (Morales et al. 1996). Whether CFTR is important in a specific subset of acidic endosomal compartments in the IMCD or other nephron segments has not yet been established. However, it does allow speculation that 'rescue' Cl- channels may preserve function in the presence of ClC-5 mutations.
The hypercalciuria seen in Dent's disease is typically mild (Wrong et al. 1994) and therefore this alone may not explain the predominance of nephrocalcinosis and nephrolithiasis seen in these patients. In transgenic mice with reduced ClC-5 expression (Luyckx et al. 1999), hypercalciuria may not result from a primary renal defect, but may be secondary to either an elevation in 1,25 dihydroxy vitamin D or intestinal hyperabsorption of calcium. Importantly, defects in another chloride channel, ClC-KB, seen in Type III Bartter's syndrome produces hypercalciuria, but patients rarely develop nephrocalcinosis or calculi (Simon et al. 1997). Thus, a collecting duct pathology, in association with hypercalciuria, may explain further the Dent's disease phenotype.
The mechanism by which ClC-5 disruption leads to nephrocalcinosis and kidney stones is unknown. However, our current data which show the localization of ClC-5 within acidic endosomes of model collecting-duct cells suggest a common intracellular role, even in intercalated cells of the collecting duct (Sakamoto et al. 1999). We propose a hypothesis of abnormal endocytic handling of calcium crystals within the collecting duct. Renal tubular fluid within the later portions of the collecting duct is supersaturated with calcium and oxalate crystals and the presence of hypercalciuria would exacerbate this effect. These ions nucleate and form microcrystals. How these crystals are then retained to cause calculi/nephrocalcinosis in susceptible individuals is not known. Recently it has been shown that calcium microcrystals may adhere to epithelial cell surfaces and are then internalized by endocytosis and dissoluted within acidic endosomes (Lieske et al. 1999; Sorokina & Kleinman, 1999). This intracellular dissolution may form an important defensive step against pathological renal calcification.
In conclusion, a combined microscopic and electrophysiological approach has confirmed the absence of a significant plasma membrane Cl- conductance mediated by mClC-5 in a renal cell line endogenously expressing mClC-5; instead mClC-5 is colocalized with acidic endosomes. A common cellular defect (defective acidification in endosomes) may therefore explain the different tubular disorders of Dent's disease dependent upon differing luminal environments.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
| BARASCH, J., KISS, B., PRINCE, A., SAIMAN, L., GRUENERT, D. & AL-AWQATI, Q. (1991). Defective acidification of intracellular organelles in cystic fibrosis. Nature 352, 70-73 | [Medline] |
| CORPET, F. (1998). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research 16, 10881-10890 | [Abstract] |
| DELPIRE, E., RAUCHMAN, M. I. M., BEIER, D. R., HEBERT, S. C. & GULLANS, S. R. (1994). Molecular cloning of a putative basolateral Na+-K+-2Cl- cotransporter from mouse (mIMCD-3) cells. Journal of Biological Chemistry 269, 25677-25683 | [Abstract] |
| DEVUYST, O., CHRISTIE, P. T., COURTOY, P. J., BEAUWENS, R. & THAKKER, R. V. (1999). Intra-renal and subcellular distribution of the human chloride channel, ClC-5, reveals a pathophysiological basis for Dent's disease. Human Molecular Genetics 8, 247-257 | [Abstract/Full Text] |
| DOWLAND, L. K., LUYCKX, V. A., ENCK, A. H., LECLERCQ, B. & YU, A. S. L. (2000). Molecular cloning and characterization of an intracellular chloride channel in the proximal tubule cell line, LLC-PK1. Journal of Biological Chemistry 275, 37765-37773 | [Abstract/Full Text] |
| FISHER, S. E., BLACK, G. C., LLOYD, S. E., HATCHWELL, E., WRONG, O., THAKKER, R. V. & CRAIG, I. W. (1994). Isolation and partial characterization of a chloride channel gene which is expressed in kidney and is a candidate for Dent's disease (an X-linked hereditary nephrolithiasis). Human Molecular Genetics 3, 2053-2059 | [Abstract] |
| FRIEDRICH, T., BREIDERHOFF, T. & JENTSCH, T. J. (1999). Mutational analysis demonstrates that ClC-4 and ClC-5 directly mediate plasma membrane currents. Journal of Biological Chemistry 274, 896-902 | [Abstract/Full Text] |
| GANDHI, R., ELBLE, R. C., GRUBER, A. D., SCHREUR, K. D., JI, H.-L., FULLER, C. M. & PAULI, B. U. (1998). Molecular and functional characterization of a calcium-sensitive chloride channel from mouse lung. Journal of Biological Chemistry 273, 32096-32101 | [Abstract/Full Text] |
| GÜNTHER, W., LUCHOW, A., CLUZEAUD, F., VANDEWALLE, A. & JENTSCH, T. J. (1998). ClC-5, the chloride channel mutated in Dent's disease, colocalizes with the proton pump in endocytotically active kidney cells. Proceedings of the National Academy of Sciences of the USA 95, 8075-8080 | [Abstract/Full Text] |
| HAMILL, O. P., MARTY, A., NEHER, E., SAKMANN, B. & SIGWORTH, F. J. (1981). Improved patch clamp techniques for high resolution current recording from cells and cell-free membrane patches. Pflügers Archiv 391, 85-100 | [Medline] |
| HORN, R. & MARTY, A. (1988). Muscarinic activation of ionic currents measured by a new whole-cell recording method. Journal of General Physiology 92, 145-159 | [Abstract] |
| JENTSCH, T. J., GUNTHER, W., PUSCH, M. & SCHWAPPACH, B. (1995). Properties of voltage-gated chloride channels of the ClC gene family. Journal of Physiology 482, S19-S25 | |
| KATZ, S. H., KRUEGER, L. J. & FALKNER, B. (1988). Microscopic nephrocalcinosis in cystic fibrosis. New England Journal of Medicine 319, 263-266 | [Abstract] |
| LIESKE, J. C., DEGANELLO, S. & TOBACK, F. G. (1999). Cell-crystal interactions and kidney stone formation. Nephron 81 (suppl. 1), 8-17 | [Medline] |
| LINDENTHAL, S., SCHMIEDER, S., EHRENFELD, J. & WILLS, N. K. (1997). Cloning and functional expression of a ClC Cl- channel from the renal cell line A6. American Journal of Physiology 273, C1176-1185 | [Medline] |
| LLOYD, S. E., GÜNTHER, W., PEARCE, S. H. S., THOMPSON, A., BIANCHI, M. L., BOSIO, M., CRAIG, I. W., FISHER, S. E., SCHEINMAN, S. J., WRONG, O., JENTSCH, T. J. & THAKKER, R. V. (1997). Characterisation of renal chloride channel, ClCN5, mutations in hypercalciuric nephrolithiasis (kidney stones) disorders. Human Molecular Genetics 6, 1233-1239 | [Abstract/Full Text] |
| LLOYD, S. E., PEARCE, S. H., FISHER, S. E., STEINMEYER, K., SCHWAPPACH, B., SCHEINMAN, S. J., HARDING, B., BOLINO, A., DEVOTO, M., GOODYER, P., RIGDEN, S. P., WRONG, O., JENTSCH, T. J., CRAIG, I. W. & THAKKER, R. V. (1996). A common molecular basis for three inherited kidney stone diseases. Nature 379, 445-449 | [Medline] |
| LUYCKX, V. A., GODA, F. O., MOUNT, D. B., NISHIO, T., HALL, A., HEBERT, S. C., HAMMOND, T. G. & YU, A. S. (1998). Intrarenal and subcellular localization of rat ClC5. Amercian Journal of Physiology 275, F761-769 | |
| LUYCKX, V. A., LECLERCQ, B., DOWLAND, L. K. & YU, A. S. (1999). Diet-dependent hypercalciuria in transgenic mice with reduced ClC5 chloride channel expression. Proceedings of the National Academy of Sciences of the USA 96, 12174-12179 | [Abstract/Full Text] |
| MO, L., HELLMICH, H. L., FONG, P., WOOD, T., EMBESI, J. & WILLS, N. K. (1999). Comparison of amphibian and human ClC-5: similarity of functional properties and inhibition by external pH. Journal of Membrane Biology 168, 253-264 | [Medline] |
| MORALES, M. M., CARROL, T. P., MORITA, T., SCHWIEBERT, E. M., DEVUYST, O., WILSON, P. D., LOPES, A. G., STANTON, B. A., DIETZ, H. C., CUTTING, G. R. & GUGGINO, W. B. (1996). Both the wild type and a functional isoform of CFTR are expressed in kidney. American Journal of Physiology 270, F1038-1048 | [Medline] |
| OBERMÜLLER, N., GRETZ, N., KRIZ, W., REILLY, R. F. & WITZSALL, R. (1998). The swelling activated chloride channel ClC-2, the chloride channel ClC-3 and ClC-5, a chloride channel mutated in kidney stone disease, are expressed in distinct subpopulations of renal epithelial cells. Journal of Clinical Investigation 109, 635-642 | |
| PIWON, N., GÜNTHER, W., SCHWAKE, M., BÖSL, M. R. & JENTSCH, T. J. (2000). ClC-5 Cl--channel disruption impairs endocytosis in a mouse model for Dent's disease. Nature 408, 369-373 | [Medline] |
| PONTING, C. P. (1997). CBS domains in ClC chloride channels implicated in myotonia and nephrolithiasis (kidney stones). Journal of Molecular Medicine 75, 160-163 | [Medline] |
| RAUCHMAN, M. I., NIGAM, S. K., DELPIRE, E. & GULLANS, S. R. (1993). An osmotically tolerant inner medullary collecting duct cell line from an SV40 transgenic mouse. American Journal of Physiology 265, F416-424 | [Medline] |
| SAKAMOTO, H., KAWASAKI, M., UCHIDA, S., SASAKI, S. & MARUMO, F. (1996). Identification of a new outwardly rectifying Cl- channel that belongs to a subfamily of the ClC Cl- channels. Journal of Biological Chemistry 271, 10210-10216 | [Abstract/Full Text] |
| SAKAMOTO, H., SADO, Y., NAITO, I., KWON, T., INOUE, S., ENDO, K., KAWASAKI, M., UCHIDA, S., NIELSEN, S., SASAKI, S. & MARUMO, F. (1999). Cellular and subcellular immunolocalization of ClC-5 channel in mouse kidney: colocalization with H+-ATPase. American Journal of Physiology 277, F957-965 | [Medline] |
| SANSOM, S. C., MOUGOURIS, T., ONO, S. & DUBOSE, T. D. JR (1994). ATP-sensitive K+-selective channels in inner medullary collecting duct cells. American Journal of Physiology 267, F489-496 | [Medline] |
| SAYER, J. (1999). Localisation of ClC-5-GFP fusion protein in mouse inner medullary collecting duct (mIMCD-3) cells. Journal of Physiology 520.P, 3P | |
| SCHMIEDER, S., LINDENTHAL, S., BANDERALI, U. & EHRENFIELD, J. (1998). Characterization of the putative chloride channel xClC-5 expressed in Xenopus laevis oocytes and comparison with endogenous chloride currents. Journal of Physiology 511, 379-393 | [Abstract/Full Text] |
| SCHWAKE, M., FRIEDRICH, T. & JENTSCH, T. J. (2001). An internalization signal in ClC-5, an endosomal Cl--channel mutated in Dent's disease. Journal of Biological Chemistry 276, 12049-12054 | [Abstract/Full Text] |
| SCHWAPPACH, B., STOBRAWA, S., HECHENBERGER, M., STEINMEYER, K. & JENTSCH, T. J. (1998). Golgi localization and functionally important domains in the NH2 and COOH terminus of the yeast ClC putative chloride channel Gef1p. Journal of Biological Chemistry 273, 15110-15118 | [Abstract/Full Text] |
| SHINDO, M., SIMMONS, N. L. & GRAY, M. A. (1996). Characterization of whole cell chloride conductances in a mouse inner medullary collecting duct cell line mIMCD-3. Journal of Membrane Biology 149, 21-31 | [Medline] |
| SIMON, D. B., BINDRA, R. S., MANSFIELD, T. A., NELSON-WILLIAMS, C., MENDONCA, E., STONE, R., SCHURMAN, S., NAYIR, A., ALPAY, H., BAKKALOGLU, A., RODRIGUEZ-SORIANO, J., MORALES, J. M., SANJAD, S. A., TAYLOR, C. M., PILZ, D., BREM, A., TRACHTMAN, H., GRISWOLD, W., RICHARD, G. A., JOHN, E. & LIFTON, R. P. (1997). Mutations in the chloride channel gene, ClCNKB, cause Bartter's syndrome type III. Nature Genetics 17, 171-178 | [Medline] |
| SOROKINA, E. A. & KLEINMAN, J. G. (1999). Cloning and preliminary characterization of a calcium-binding protein closely related to nucleolin on the apical surface of inner medullary collecting duct cells. Journal of Biological Chemistry 274, 27491-27496 | [Abstract/Full Text] |
| STEINMEYER, K., SCHWAPPACH, B., BENS, M., VANDEWALLE, A. & JENTSCH, T. J. (1995). Cloning and functional expression of rat ClC-5, a chloride channel related to kidney disease. Journal of Biological Chemistry 270, 31172-31177 | [Abstract/Full Text] |
| STEWART, G. S., SIMMONS, N. L. & GRAY, M. A. (1999). Whole-cell chloride conductances in a mouse inner medullary collecting duct cell line (mIMCD-3). Journal of Physiology 515.P, 162P | |
| STEWART, G. S., GLANVILLE, M., AZIZ, O., SIMMONS. N. L. & GRAY, M. A. (2001). Regulation of an outwardly rectifying chloride conductance in renal epithelial cells by external and internal calcium. Journal of Membrane Biology 180, 49-64 | [Medline] |
| TANAKA, K., FISHER, S. E. & CRAIG, I.W. (1999). Characterization of novel promoter and enhancer elements of the mouse homologue of the Dent disease gene, ClCN5, implicated in X-linked hereditary nephrolithiasis. Genomics 58, 281-292 | [Medline] |
| WALDEGGER, S. & JENTSCH, T. J. (2000). From tonus to tonicity: physiology of ClC chloride channels. Journal of the American Society of Nephrologists 11, 1331-1339 | |
| WANG, S. S., DEVUYST, O., GOURTOY, P. T., WANG, X. T., WANG, H., WANG, X., THAKKER, R. V., GUGGINO, S. & GUGGINO, W. B. (2000). Mice lacking renal chloride channel, ClC-5, are a model for Dent's disease, a nephrolithiasis disorder associated with defective receptor mediated endocytosis. Human Molecular Genetics 9, 2937-2945 | [Abstract/Full Text] |
| WRONG, O. M., NORDEN, A. G. W. & FEEST, T. G. (1994). Dent's disease; a familial proximal renal tubular syndrome with low-molecular-weight proteinuria, hypercalciuria, nephrocalcinosis, metabolic bone disease, progressive renal failure and a marked male predominance. Quarterly Journal of Medicine 87, 473-493 |
Acknowledgements
We thank T. J. Jentsch for the PEP5A1 anti-ClC-5 antibody. We thank K. Tanaka for sharing mClC-5 sequence prior to publication. We gratefully acknowledge the support of the Northern Counties Kidney Research Fund (J.A.S.), the National Kidney Research Fund (J.A.S., G.S.S. and S.H.B.) and the Wellcome Trust (S.H.S.P.). We thank M. Glanville for advice on the generation of molecular reagents.
J. A. Sayer and G. S. Stewart contributed equally to this work.
Corresponding author
N. L. Simmons: Department of Physiological Sciences, Medical School, Framlington Place, University of Newcastle upon Tyne, Newcastle upon Tyne NE2 4HH, UK.
Email: n.l.simmons{at}ncl.ac.uk
This article has been cited by other articles:
|
|
 |
|
  M. Ludwig, B. Utsch, and L. A. H. Monnens Recent advances in understanding the clinical and genetic heterogeneity of Dent's disease Nephrol. Dial. Transplant., October 1, 2006; 21(10): 2708 - 2717. [Full Text] [PDF]
|
|
|
|
 |
|
 P.-C. Pham, O. Devuyst, P.-T. Pham, N. Matsumoto, R. N. G. Shih, O. D. Jo, N. Yanagawa, and A. M. Sun Hypertonicity increases CLC-5 expression in mouse medullary thick ascending limb cells Am J Physiol Renal Physiol, October 1, 2004; 287(4): F747 - F752. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Isnard-Bagnis, N. Da Silva, V. Beaulieu, A. S. L. Yu, D. Brown, and S. Breton Detection of ClC-3 and ClC-5 in epididymal epithelium: immunofluorescence and RT-PCR after LCM Am J Physiol Cell Physiol, January 1, 2003; 284(1): C220 - C232. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||
), Ab (
) and Ac (
) recorded after 0.8 s following the voltage step (indicated in Aa to Ac). Ba, basal whole-cell currents from an untreated CHO-K1 cell. Bb, whole-cell current after ionomycin stimulation (250 nM). Bc, effect of extracellular DIDS (500 µM) on the ionomycin-stimulated conductance. Bd, I-V relationships of whole-cell current data in Ba (