|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Physiology (2002), 538.3, pp. 707-716
© Copyright 2002 The Physiological Society
DOI: 10.1113/jphysiol.2001.013046
| ABSTRACT |
|---|
|
|
|---|
Subtype 3 of the ryanodine receptor (RYR3) is a ubiquitous Ca2+ release channel which is predominantly expressed in smooth muscle tissues and certain regions of the brain. We show by reverse transcription-polymerase chain reaction (RT-PCR) that non-pregnant mouse myometrial cells expressed only RYR3 and therefore could be a good model for studying the role of endogenous RYR3. Expression of RYR3 was confirmed by Western blotting and immunostaining. Confocal Ca2+ measurements revealed that in 1.7 mM extracellular Ca2+, neither caffeine nor photolysis of caged Ca2+ were able to trigger any Ca2+ responses, whereas in the same cells oxytocin activated propagated Ca2+ waves. However, under conditions of increased sarcoplasmic reticulum (SR) Ca2+ loading, brought about by superfusing myometrial cells in 10 mM extracellular Ca2+, all the myometrial cells responded to caffeine and photolysis of caged Ca2+, indicating that it was possible to activate RYR3. The caffeine-induced Ca2+ responses were inhibited by intracellular application of an anti-RYR3-specific antibody. Immunodetection of RYR3 with the same antibody revealed a rather homogeneous distribution of fluorescence in confocal cell sections. In agreement with these observations, spontaneous or triggered Ca2+ sparks were not detected. In conclusion, our results suggest that under conditions of increased SR Ca2+ loading, endogenous RYR3 may contribute to the Ca2+ responses of myometrial cells.
(Received 25 July 2001; accepted after revision 2 November 2001)
Corresponding author J. Mironneau: Laboratoire de Signalisation et Interactions Cellulaires, CNRS UMR 5017, Université Bordeaux 2, 146 rue Léo Saignat, 33076 Bordeaux, France. Email: jean.mironneau{at}umr5017.u-bordeaux2.fr
| INTRODUCTION |
|---|
|
|
|---|
Three genes encoding ryanodine receptors (RYR1, RYR2 and RYR3) have been detected in mammalian tissue (Sorrentino et al. 2000). RYR1 was initially identified in skeletal muscle (Zorzato et al. 1990), RYR2 is primarily associated with cardiac and some smooth muscles (Otsu et al. 1990), and RYR3 is the most widely expressed (Giannini et al. 1992; Sorrentino & Volpe, 1993). Although each isoform may be responsible for activating Ca2+ release from internal stores, the contribution of the different RYR isoforms in Ca2+ signalling is not completely understood. Using RYR3 knockout mice, it has been reported that RYR3 may contribute with RYR1 to induce Ca2+ sparks in neonatal skeletal myocytes (Bertocchini et al. 1997). In addition, overexpression of RYR3 in dyspedic myotubes has been reported to produce Ca2+ sparks similar to those induced in frog skeletal myocytes (Ward et al. 2000). However, using an antisense strategy, it appears that in vascular myocytes, both RYR1 and RYR2 are required for Ca2+ release during Ca2+ sparks and Ca2+ waves induced by activation of L-type Ca2+ current or by application of caffeine, with no participation from RYR3 (Coussin et al. 2000). Moreover, when both RYR1 and RYR2 are inhibited with antisense oligonucleotides and under conditions of increased sarcoplasmic reticulum (SR) Ca2+ loading, RYR3 can be activated by caffeine and localized increases in [Ca2+]i (Mironneau et al. 2001).Since all these studies were performed in cell types expressing several subtypes of RYRs or in conditions of overexpression of RYR3, the physiological role of endogenous RYR3 was not clearly assessed. Previous data have reported that in cultured myometrial cells from pregnant rats and intact strips from pregnant and non-pregnant rats, caffeine is unable to induce Ca2+ release from the SR (Arnaudeau et al. 1994; Taggart & Wray, 1998), suggesting that RYR1 and/or RYR2 subtypes are not expressed in these cells. However, analysis of RYR subtypes by RT-PCR has led to conflicting results. In non-pregnant human myometrium, RYR3 seems to be expressed in isolation whereas in pregnant human myometrium, RYR2 and RYR3 have been detected (Awad et al. 1997). Moreover, in pregnant human and rat myometrium, all three RYRs have been reported (Martin et al. 1999a,b), but the effects of caffeine remain controversial. When a full-length cDNA encoding the rabbit uterine RYR3 is expressed in HEK293 cells, these cells exhibit a strong caffeine response (Chen et al. 1997), suggesting that alternative splice variants might be involved in the caffeine sensitivity of RYR3s (Miyatake et al. 1996).
In order to study the functional role of endogenous RYR3, we examined the possibility that myometrial cells from non-pregnant mouse may express only the RYR3 subtype using RT-PCR, Western blotting and immunocytochemistry. We investigated the effects of caffeine, oxytocin and [Ca2+]i jumps induced by flash photolysis of caged Ca2+ in isolated myometrial cells under conditions of normal and increased SR Ca2+ loading. We show that RYR3 is insensitive to both caffeine and increases in [Ca2+]i under conditions of normal SR Ca2+ loading but can become activated by the same agents under conditions of increased SR Ca2+ loading.
| METHODS |
|---|
|
|
|---|
Cell preparation
The investigation conforms with the European Community and French guiding principles in the care and use of animals. Authorization to perform animal experiments was obtained from the French Ministère de l'Agriculture et de la Pêche.
Non-pregnant C57BL/6 mice (20-25 g) were killed by cervical dislocation. The longitudinal muscle layer of myometrium was cut into several pieces and incubated for 10 min in low-Ca2+ (40 µM) physiological solution (HBSS), and then 0.8 mg ml-1 collagenase (EC: 3.4.24.3), 0.20 mg ml-1 pronase E (EC: 3.4.24.31) and 1 mg ml-1 bovine serum albumin were added at 37 °C for 20 min. After this time, the solution was removed and pieces of myometrium were incubated again in fresh enzyme solution at 37 °C for 20 min. Tissues were placed in a enzyme-free solution and triturated using a fire-polished Pasteur pipette to release the cells. Cells were seeded at a density of 103 cells mm-2 on glass slides. A similar protocol was used to isolate mouse duodenal myocytes, as previously reported (Morel et al. 1997). Myometrial cells were used either freshly isolated or after a short-term primary culture in medium M199 containing 2 % fetal calf serum, 2 mM glutamine, 1 mM pyruvate, 20 units ml-1 penicillin and 20 µg ml-1 streptomycin; they were kept in an incubator gassed with 95 % air and 5 % CO2 at 37 °C and used within 30 h. Normal physiological solution contained 130 mM NaCl, 5.6 mM KCl, 1 mM MgCl2, 1.7 mM CaCl2, 11 mM glucose, and 10 mM Hepes (adjusted to pH 7.4 with NaOH). For experiments that used antibodies, the myometrial cells were held at -50 mV with a standard patch clamp technique using a List EPC7 patch clamp amplifier (Darmstadt, Eberstadt, Germany). The whole-cell recording mode was performed with patch clamp pipettes of 2-5 M
resistance. The basic pipette solution contained 130 mM CsCl and 10 mM Hepes (pH 7.3 with CsOH).
Reverse transcription-polymerase chain reaction
Total RNA was extracted from mouse brain and from either freshly isolated smooth muscle cells or cultured cells within 30 h (about 100 cells) using the RNeasy mini kit (Qiagen, Hilden, Germany) following the instructions of the supplier. The reverse transcription (RT) reaction was performed using the Sensiscript RT kit (Qiagen). Total RNA was incubated with random primers (Promega, Lyon, France) at 65 °C for 5 min. After a cooling time of 15 min at 25 °C, RT mix was added and the total mixture was incubated 60 min at 37 °C. The resulting cDNA was stored at -20 °C. PCR was performed with 2 µl cDNA (0.9 µg cDNA for myometrium and duodenum or 0.6 µg cDNA for brain), 1.25 units HotStartTaq DNA polymerase (Qiagen), 1 µM of each primer and 200 µM of each deoxynucleotide triphosphate, in a final volume of 50 µl. The polymerase chain reaction (PCR) conditions were 95 °C for 15 min, then 35 cycles at 94 °C for 1 min, 60 °C (RYR1 and RYR2) or 56 °C (RYR3) for 1 min and 72 °C for 1 min and at the end of PCR, samples were kept at 72 °C for 10 min for final extension and then stored at 4 °C. Reverse transcription and PCR were performed with a thermal cycler (Eppendorf, Le Pecq, France). Amplification products were separated by electrophoresis (2 % agarose gel) and visualized by ethidium bromide staining. The minimum detection of RYR amplification products was obtained with 15 ng cDNA. Gels were photographed with EDAS 120 and analysed with KDS1D 2.0 software (Kodak Digital Science, Paris, France). Sense (s) and antisense (as) primer pairs specific for RYR1, RYR2 and RYR3 were designed on the known cloned receptor sequences as stated in the GenBank sequence database (accession numbers: X83932, X83933, X83934, respectively) with Lasergene software (DNASTAR, Madison, WI, USA). The nucleotide sequence and the length of the expected PCR products (in parentheses) for each primer pair were, respectively :
RYR1(s) GAAGGTTCTGGACAAACACGGG;
RYR1(as) TCGCTCTTGTTGTAGAA TTTGCGG (435 bp);
RYR2(s) GAATCAGTGAGTTACTGGGCATGG;
RYR2(as) CTGGTCTGAGTTCTCCAAAAGC (635 bp)
(Coussin et al. 2000);
RYR3(s) AGGTGATCAACAAGTATGGA;
RYR3(as) CAACAGATGAGCAGCAAAGA (RYR3-I: 273 bp
and RYR3-II: 614 bp) (Miyatake et al. 1996).
After electrophoresis, the amplified DNA fragments were cleaned and purified with the Qiaquick gel extraction kit (Qiagen). PCR fragments were sequenced by the Qiagen sequencing service. The deduced DNA sequences of RYR1, RYR2, RYR3-I and -II fragments were 98-99 % identical to the published sequences.
Immunoblotting
For Western blotting analysis, microsomal proteins were separated on 5 % SDS-PAGE minigels and transferred to PVDF (polyvinylidene difluoride) membranes for 70 min at 100 V in a transfer buffer containing 192 mM glycine and 25 mM Tris-HCl (pH 8.3). Microsomes were blocked for 3 h in blocking phosphate buffer solution containing 0.1 % Tween-20 and 3 % bovine serum albumin (adjusted to pH 7.4) and then incubated overnight with the primary antibody at 1 : 2500 dilution (rabbit anti-RYR3 antibody or rabbit anti-InsP3R antibody). After extensive washing, microsomes were incubated for 2 h with the secondary (anti-rabbit) antibody coupled to the peroxydase (1 : 5000 dilution). Specific antigen detection was performed using OPTI-4CN kit (Bio-Rad) to detect peroxydase activity on PVDF membranes and the Kodak EDAS 120.
Cytosolic Ca2+ measurements
For experiments that used intracellular application of antibodies or heparin, fluo 3 (60 µM) was dialysed into the cell through the patch clamp pipette. In the other experiments, cells were loaded by incubation in external physiological solution containing 4 µM fluo 3 acetoxymethylester (fluo 3 AM) for 1 h in an incubator at 37 °C. These cells were washed and allowed to cleave the dye to the active fluo 3 compound for at least 30 min. Images were acquired using the line-scan mode of a confocal Bio-Rad MRC1000 (Bio-Rad, Paris, France) connected to a Nikon Diaphot microscope. Excitation light was delivered by a 25 mW argon ion laser (Ion Laser Technology, Salt Lake City, UT, USA) through a Nikon Plan Apo
60, 1.4 NA objective lens. Fluo 3 was excited at 488 nm and emitted fluorescence was filtered and measured at 540 ± 30 nm. At the setting used to detect fluo 3 fluorescence, the resolution of the microscope was near 0.4 µm
0.4 µm
1.5 µm (x-, y- and z-axis). Images were acquired in the line-scan mode at a rate of 6 ms per scan. Scanned lines were plotted vertically and each line was added to the right of the preceding line to form the line-scan image. In these images, time increased from the left to the right, and position along the scanned line was given by vertical displacement. Fluorescence signals are expressed as pixel per pixel fluorescence ratios (F/F0), where F is the fluorescence during a response and F0 is the rest-level fluorescence of the same pixel. Image processing and analysis were performed using COMOS, TCSM and MPL software (Bio-Rad).
Caffeine, oxytocin and other stimulating substances were applied by pressure ejection from a glass pipette for the period indicated on the records. All experiments were carried out at 26 ± 1 °C.
Flash photolysis
Caged Ca2+, 1-(4,5-dimethoxy-2-nitrophenyl) EDTA, tetra(acetoxymethylester), (DMNP-EDTA AM) at 15 µM was added to the bathing solution and maintained in the presence of cells for 1 h in an incubator at 37 °C. In some experiments, DMNP-EDTA (1 mM, in the presence of 0.25 mM CaCl2) was introduced into the cell via the patch clamp pipette, with 3-4 min allowed for equilibration. Photolysis was produced by a 1 ms pulse from a xenon flash lamp (Hi-Tech Scientific, Salisbury, UK) focused to a ~2 mm diameter spot around the cell. Light was band-pass filtered using a UG11 glass between 300 and 350 mm. Flash intensity could be adjusted by varying the capacitor-charging voltage between 0 and 380 V, which corresponded to a change in the energy input into the flash lamp from 0 to 240 J. On flash photolysis, Ca2+ was released within 2-4 ms and the small percentage of conversion of the caged compound (~20 %) allows application of a second pulse without the Ca2+ response being altered (Escobar et al. 1995; Arnaudeau et al. 1997).
RYR labelling
Myometrial cells were immunostained as previously described (Boittin et al. 1999). Briefly, myocytes were incubated in the presence of the anti-RYR3-specific antibody (Giannini et al. 1995) (at 1 : 300 dilution) for 20 h at 4 °C, and with the secondary antibody (donkey anti-rabbit IgG conjugated to fluorescein isothiocyanate, diluted at 1 : 500) for 3 h at 20 °C. Thereafter, cells were mounted in Vectashield. Images of the stained cells were obtained with the Bio-Rad confocal microscope. For immunostaining, the resolution of the microscope was near 0.2 µm
0.2 µm
0.5 µm (x-, y- and z-axis).
Chemicals and drugs
Collagenase was obtained from Worthington (Freehold, NJ, USA). Fluo 3, fluo 3 AM, DMNP-EDTA and DMNP-EDTA AM were from Molecular Probes (Leiden, The Netherlands). Caffeine was from Merck (Nogent sur Marne, France). Bay K 8644 was from Bayer (Puteaux, France). Medium M199 was from ICN (Costa Mesa, CA, USA). Ryanodine and cyclopiazonic acid were from Calbiochem (Meudon, France). Fetal calf serum was from Bio Media (Boussens, France). Streptomycin, penicillin, glutamine and pyruvate were from Gibco (Cergy Pontoise, France). All primers were synthesized and purchased from Eurogentec (Seraing, Belgium). Heparin (from porcine intestinal mucosa; relative molecular mass 6000) and all other chemicals were from Sigma (St Louis, MO, USA). The polyclonal rabbit anti-RYR3-specific antibody was developed against purified glutathione-S-transferase fusion protein corresponding to the region of low homology between the transmembrane domains 4 and 5 of RYR3 (Giannini et al. 1995). The polyclonal rabbit anti-InsP3R antibody was directed against the COOH-terminal amino acids (GGVGDVLRKPS) of the rabbit InsP3R (407143-S, Calbiochem).
Data analysis
Data are expressed as means ± S.E.M.; n represents the number of tested cells. Significance was tested by means of Student's t test. P values < 0.05 were considered significant.
| RESULTS |
|---|
|
|
|---|
RYR subtypes expressed in non-pregnant mouse myometrial cells
Expression of RYR subtypes was detected in mouse brain and in smooth muscle cells from myometrium and duodenum by RT-PCR. All three RYR subtypes were present in mouse brain (Fig. 1A) and two RYR3 mRNA isoforms were detected: the upper band is compatible with RYR3-II (614 bp) and the lower band is compatible with RYR3-I (273 bp), as proposed by Miyatake et al. (1996). In contrast, only the two RYR3 mRNAs were detected in mouse myometrial cells (Fig. 1B) whereas both RYR2 and RYR3 mRNAs were detected in duodenal myocytes (Fig. 1C). Similar results were obtained from freshly isolated and cultured myometrial cells (n = 6). Figure 1D shows a Western blot analysis on samples of mouse myometrium and brain. The anti-RYR3 antibody recognized a band of ~550 kDa molecular mass corresponding to the value previously reported for RYR3 (Bertocchini et al. 1997; Sonnleitner et al. 1998), whereas the anti-InsP3 antibody recognized a band of ~250 kDa in brain and myometrium (n = 3). No cross-reactivity of the antibodies with the two proteins was detectable. Immunodetection of the RYR3s in cell confocal sections with the specific anti-RYR3 antibody (Giannini et al. 1995) revealed that these receptors were distributed in the whole sections in both freshly isolated(Fig. 2A) and cultured (Fig. 2B) myometrial cells. Compiled data in the absence and presence of the specific anti-RYR3 antibody clearly revealed the specific fluorescence in myometrial cells (Fig. 2C). These results indicate that non-pregnant mouse myometrial cells express only RYR3 and therefore, are a good model for studying the function of endogenous RYR3.
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 1. Detection of ryanodine and inositol 1,4,5-trisphosphate receptors (RYRs and InsP3Rs, respectively) in freshly dissociated mouse non-pregnant myometrial cells A-C, cDNA fragments of RYR1 (lane 1), RYR2 (lane 2) and RYR3 (lane 3) were amplified from mouse brain, myometrial and duodenal cells, respectively. The amplified DNA fragments were separated on a 2 % agarose gel and visualized by staining with ethidium bromide. Molecular size standards are indicated in base pairs (bp). Two alternatively spliced RYR3 variants, RYR3-I (273 bp) and RYR3-II (614 bp), were present in brain and smooth muscle cells. Similar results were obtained from six different mice. D, Western blot analysis on microsomes from mouse brain (150 µg protein) and myometrium (Myo; 70 µg protein), separated on 5 % SDS-PAGE with the anti-RYR3 and anti-InsP3 antibodies. Molecular mass is indicated in kilodaltons. Similar results were obtained from three different mice. | ||
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 2. Immunostaining of RYR3 in confocal cell sections of non-pregnant myometrial cells A, freshly isolated myocytes stained in the presence or absence of the specific anti-RYR3 antibody. B, staining of a cultured myometrial cell for 30 h. C, compiled data illustrating the mean fluorescence in the absence or presence of the anti-RYR3 antibody with the number of cells tested indicated in parentheses. Cells were obtained from six different mice. | ||
Confocal Ca2+ signals evoked by caffeine, oxytocin and flash photolysis of caged Ca2+
In myometrial cells, oxytocin acts through production of inositol 1,4,5-trisphosphate (InsP3) (Marc et al. 1986) and subsequent stimulation of InsP3Rs to induce Ca2+ release from the SR (Arnaudeau et al. 1994). In 1.7 mM Ca2+-containing solution (1.7 mM [Ca2+]o), both freshly isolated and cultured myometrial cells responded to application of 0.1-0.25 µM oxytocin by producing propagated Ca2+ waves (Fig. 3A). As illustrated in Fig. 4, the peak amplitudes of the oxytocin-induced Ca2+ responses, measured from a 2 µm region of the line-scan image, were similar in freshly isolated and cultured myometrial cells. For example, in cultured myometrial cells the peak amplitude of these responses was 2.24 ± 0.06 (
(F/F0), n = 65). In contrast, application of 10-50 mM caffeine was unable to induce any Ca2+ responses in the same cells which responded to oxytocin (Fig. 3A and Fig. 4). RYRs can be directly activated by an increase in [Ca2+]i in the vicinity of the receptors. In vascular myocytes, flash photolysis of Ca2+-loaded DMNP-EDTA has been shown to instantaneously elevate the [Ca2+]i within 2-4 ms and to activate Ca2+ responses (Arnaudeau et al. 1997; Boittin et al. 1998). In 1.7 mM [Ca2+]o-containing solution, flash pulses evoked Ca2+ transients in cultured myometrial cells that appeared to be uniform and rapidly declined within 500 ms (Fig. 5A). Application of 10 µM ryanodine for 5 min had no effect on these Ca2+ transients suggesting that they corresponded to Ca2+ jumps due to release of Ca2+ ions from the caged molecule (Fig. 5C).
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 3. Typical Ca2+ responses evoked by oxytocin and caffeine in mouse non-pregnant myometrial cells under conditions of normal and increased SR Ca2+ loading A, in 1.7 mM [Ca2+]o, application of 0.25 µM oxytocin induced a propagated Ca2+ response whereas in the same cell, application of 10 mM caffeine was unable to induce any Ca2+ response. B, in 10 mM [Ca2+]o for 1 h, both oxytocin (0.25 µM) and caffeine (10 mM) induced propagated Ca2+ responses in all the cells tested. Traces show (from top to bottom) substance application, line-scan fluorescence image and averaged fluorescence ratio (F/F0) from a 2 µm region of the line-scan image (indicated by vertical bar). Myocytes were loaded with fluo 3 AM and used within 30 h of primary culture. | ||
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 4. Compiled data showing the effects of oxytocin and caffeine in freshly isolated and cultured mouse non-pregnant myometrial cells Peak amplitude ( | ||
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 5. Effects of normal and increased SR Ca2+ loading on the Ca2+ responses evoked by flash photolysis of caged Ca2+ A, in 1.7 mM [Ca2+]o, typical time course of averaged fluorescence ratio (F/F0) from the entire line-scan image to application of a UV flash pulse of 37 J. B, in 10 mM [Ca2+]o, typical time course of the entire line-scan fluorescence ratio to application of a 37 J flash pulse. C, compiled data showing the effects of ryanodine (10 µM) and heparin (1 mg ml-1) applied for 5 min on the Ca2+ responses evoked by flash photolysis of caged Ca2+ (37 J flash pulses) in 1.7 mM (open bars) and 10 mM [Ca2+]o (hatched bars). Ratio of peak values in 10 and 1.7 mM [Ca2+]o in control conditions and in the presence of 1 mg ml-1 heparin or 10 µM ryanodine for 5 min (filled bars). The number of cells tested is indicated in parentheses. Asterisks indicate values significantly different from those obtained in control conditions. Except for the experiments with heparin, myocytes were loaded with fluo 3 AM and DMNP-EDTA AM and the external solution contained either 1.7 or 10 mM Ca2+. Intracellular application of heparin was performed with the patch-clamp pipette and fluo 3 and DMNP-EDTA were added to the pipette solution. Cells were obtained from three different mice and used within 30 h of primary culture. | ||
When cultured myometrial cells were incubated in 10 mM [Ca2+]o for 1 h, both the amplitude and upstroke velocity of the oxytocin-induced Ca2+ responses measured in the same cells increased significantly from 2.27 ± 0.12 (
(F/F0)) to 2.78 ± 0.16 (n = 15) and from 6.69 ± 0.70 (
(F/F0) s-1) to 9.31 ± 0.65 (n = 15), respectively (Fig. 3B and Fig. 6). Longer exposure to 10 mM [Ca2+]o did not significantly change the parameters of oxytocin-induced Ca2+ responses (n = 26). These results suggest that the SR Ca2+ content of myometrial cells is increased by the sustained elevation in extracellular [Ca2+] and may modify both amplitude and upstroke velocity of Ca2+ responses, as previously shown in vascular myocytes (Mironneau et al. 2001). To assess the role of the SR Ca2+ loading in the generation of large and fast Ca2+ responses to oxytocin, the effects of 10 µM cyclopiazonic acid were first investigated on the oxytocin-induced Ca2+ responses. Inhibition of the Ca2+ uptake capacity of the intracellular store by cyclopiazonic acid resulted in a small elevation of the basal [Ca2+]i and the suppression of the oxytocin-induced Ca2+ response in the continuous presence of cyclopiazonic acid for 5 min (n = 6 ; not shown). In a second set of experiments, oxytocin (0.25 µM) was applied in Ca2+-free, 0.5 mM EGTA-containing solution for 20 s (a time sufficient to remove voltage-dependent Ca2+ current) in cultured myocytes superfused either in 1.7 mM [Ca2+]o or 10 mM [Ca2+]o. After 20 s in Ca2+-free solution, the amplitude of the oxytocin-induced Ca2+ responses (
(F/F0)) was 2.05 ± 0.13 (n = 11) in myometrial cells pretreated with 1.7 mM [Ca2+]o and 2.51 ± 0.17 (n = 11) in cells pretreated with 10 mM [Ca2+]o, indicating an increase in Ca2+ response amplitude similar to that obtained in 1.7 mM [Ca2+]o. Taken together, these results suggest that the increased accumulation of Ca2+ in the SR is responsible for the large and fast oxytocin-induced Ca2+ responses under conditions of increased [Ca2+]o.
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 6. Compiled data showing the effects of normal and increased SR Ca2+ loading on the Ca2+ responses evoked by oxytocin and caffeine A, peak amplitude ( | ||
Under conditions of increased SR Ca2+ loading, applications of 10 mM caffeine as well as flash photolysis of caged Ca2+ induced Ca2+ responses in all the cells tested (Fig. 3B and Fig. 5). The peak amplitude and upstroke velocity of the caffeine-induced Ca2+ responses, measured from a 2 µm region of the line-scan image were 1.84 ± 0.25 (
(F/F0), n = 15) and 1.43 ± 0.45 (
(F/F0) s-1, n = 15), respectively (Fig. 6). In Ca2+-overloaded myocytes, flash photolysis of caged Ca2+ induced a large Ca2+ transient followed by a sustained plateau (Fig. 5B). The peak amplitude of the Ca2+ responses evoked by 37 J flash pulses was 2.32 ± 0.15 (n = 10; Fig. 5C). Application of 10 µM ryanodine for 5 min on Ca2+-overloaded myocytes inhibited the Ca2+ response evoked by 37 J flash pulses (Fig. 5C). The remaining Ca2+ response in Ca2+-overloaded cells pretreated with ryanodine was similar to the Ca2+ response obtained in control cells superfused in 1.7 mM [Ca2+]o (Fig. 5C). The ratio of the Ca2+ transients (peak value) obtained in 10 and 1.7 mM [Ca2+]o was estimated in control conditions and in cells pretreated with heparin (1 mg ml-1) or ryanodine (10 µM) for 5 min (Fig. 5C). The results showed that Ca2+ release induced by flash photolysis of caged Ca2+ was unaffected by heparin but blocked by ryanodine in agreement with the exclusive participation of RYRs in the Ca2+-induced Ca2+ release mechanism.
Spontaneous Ca2+ sparks were not detected in Ca2+-overloaded myometrial cells (n = 57). Various experimental conditions, such as applications of low concentrations of caffeine, ryanodine or Bay K 8644 (an L-type Ca2+ channel agonist), have been reported to trigger and increase the frequency of Ca2+ sparks in vascular myocytes (Arnaudeau et al. 1996; Coussin et al. 2000). Applications of 5 nM Bay K 8644 (n = 35), 1 µM ryanodine (n = 39; Fig. 7) or 5 mM caffeine for 1-3 min (data not shown) were ineffective in inducing the generation of Ca2+ sparks in non-pregnant mouse myometrial cells isolated from five different mice.
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 7. Typical Ca2+ responses evoked by low concentrations of Bay K 8644 and ryanodine in mouse non-pregnant myometrial cells under conditions of increased SR Ca2+ loading In 10 mM [Ca2+]o for 1 h, both 5 nM Bay K 8644 (A) and 1 µM ryanodine (B) induced homogeneous increases in [Ca2+]i without detection of localized Ca2+ events. Traces show (from top to bottom) substance application, line-scan fluorescence image and averaged fluorescence ratio from the entire line-scan image. Myocytes were loaded with fluo 3 AM and used within 30 h of primary culture. Similar results were obtained in 35-39 cells from five different mice. | ||
Effects of the anti-RYR3 antibody
In order to confirm that the Ca2+ responses induced by caffeine and flash photolysis of caged Ca2+ under conditions of increased SR Ca2+ loading were due to activation of RYR3, we tested the effects of anti-InsP3R and anti-RYR3 antibodies which have proved useful in blocking Ca2+ responses in vascular myocytes. Concentration-dependent inhibitory effects and specificity of these antibodies has been previously reported in vascular myocytes (Boittin et al. 1999; Mironneau et al. 2001). Under conditions of increased SR Ca2+ loading (in 10 mM [Ca2+]o for 1 h), intracellular applications of 10 µg ml-1 anti-InsP3R antibody for 7 min had no significant effect on the caffeine-induced Ca2+ responses (Fig. 8A) but inhibited in a concentration-dependent manner the oxytocin-induced Ca2+ responses (Fig. 8B). The specificity of this antibody was also illustrated by the absence of effect of the boiled (95 °C for 30 min) anti-InsP3R antibody on the oxytocin-induced Ca2+ response (Fig. 8B). Intracellular applications of 10 µg ml-1 anti-RYR3 antibody for 7 min slightly reduced the oxytocin-induced Ca2+ response but this effect was not significant (Fig. 8B). In contrast, the anti-RYR3 antibody inhibited in a concentration-dependent manner the caffeine-induced Ca2+ responses (Fig. 8A). Similarly, the Ca2+ responses evoked by flash photolysis of caged Ca2+ (estimated as in Fig. 5C, right panel) were unaffected by the intracellular presence of the anti-InsP3R antibody but blocked by 3 µg ml-1 anti-RYR3 antibody (data not shown). The specificity of the anti-RYR3 antibody was also illustrated by the absence of effect of the boiled (95 °C for 30 min) antibody on the caffeine-induced Ca2+ response (Fig. 8A). Taken together, these results show that in Ca2+-overloaded myometrial cells the RYR3 is responsible for the Ca2+ responses evoked by caffeine and flash photolysis of caged Ca2+.
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 8. Effects of anti-RYR3 and anti-InsP3R antibodies on caffeine- and oxytocin-induced Ca2+ responses under conditions of increased SR Ca2+ loading A, effects of 10 µg ml-1 anti-InsP3R antibody and increasing concentrations of anti-RYR3 antibody (applied intracellularly for 7 min) on the Ca2+ responses ( | ||
| DISCUSSION |
|---|
|
|
|---|
In this paper, we report that mouse non-pregnant myometrial cells express only the RYR3 isoform and that activation of this isoform by caffeine and localized increases in [Ca2+]i becomes possible under conditions of increased SR Ca2+ loading. The homogeneous distribution of RYR3s in confocal cell sections and the absence of detection of spontaneous and triggered Ca2+ sparks suggest that RYR3s do not constitute Ca2+ release units in myometrial cells.
Under conditions of normal SR Ca2+ loading (when the cells were superfused in 1.7 mM extracellular Ca2+), propagated Ca2+ waves were triggered by oxytocin whereas caffeine was ineffective in inducing any Ca2+ response in mouse non-pregnant myometrial cells. These results are in good agreement with previous data obtained in pregnant rat myometrial cells (Arnaudeau et al. 1994) or in intact myometrial strips from pregnant and non-pregnant rats (Taggart & Wray, 1998) as well as in human myometrial cells in culture (Lynn et al. 1995; Morgan & Gillespie, 1995). Similarly, in vascular myocytes where both RYR1 and RYR2 have been inhibited by an antisense oligonucleotide strategy, the remaining RYR3s were unable to produce Ca2+ sparks and waves in myocytes superfused in 1.7 mM [Ca2+]o (Coussin et al. 2000). Our results obtained in non-pregnant mouse myometrial cells revealed that (i) RYR3 was the sole subtype identified by RT-PCR and its expression was confirmed by Western blot analysis and immunolabelling; (ii) endogenous RYR3s expressed in isolation could not be activated by caffeine and [Ca2+]i jumps induced by flash photolysis of caged Ca2+ under conditions of normal SR Ca2+ loading. Similar results were obtained in freshly isolated myometrial cells as well in cultured cells within 30 h. These results are at variance with data obtained recently from pregnant rat myometrial cells where ~30 % of the cells respond to caffeine (Martin et al. 1999b). A first possibility may be that a proportion of freshly isolated pregnant rat myometrial cells shows increased SR Ca2+ loading, so that RYR3 can be activated by caffeine (as demonstrated in the present study). A second possibility may be that RYR1 or RYR2 which are known to be sensitive to caffeine, could be expressed occasionally in pregnant rat myometrial cells. For example, in pregnant human myometrial cells where both RYR2 and RYR3 are expressed, caffeine is effective in inducing Ca2+ responses (Awad et al. 1997). Although the three RYR subtypes have been detected in the whole pregnant rat myometrium (Martin et al. 1999b), it has not been demonstrated that all the RYR subtypes are expressed in myometrial cells. Moreover, identification of the RYR subtypes at the protein level is needed before concluding that these subtypes are involved in Ca2+ signalling of rat myometrial cells. Thus, our results indicate that in non-pregnant mouse myometrial cells, Ca2+ release from the SR appears to depend exclusively on the opening of InsP3-gated channels.
Elevation of extracellular [Ca2+] to 10 mM created the conditions for an increased SR Ca2+ loading, as previously reported in cardiac and vascular myocytes (Gyorke & Gyorke, 1998; Lukyanenko et al. 1999; Mironneau et al. 2001). Inhibition of Ca2+ accumulation in the SR by cyclopiazonic acid completely suppressed the oxytocin-induced Ca2+ responses, whereas removal of extracellular Ca2+ for 20 s had no effect on the enhanced oxytocin-induced Ca2+ responses in 10 mM [Ca2+]o, indicating that they were dependent on Ca2+ release from the SR. Increase in SR Ca2+ loading was illustrated by a significant enhancement in amplitude and upstroke velocity of the oxytocin-induced Ca2+ responses. Under these conditions, caffeine and photolysis of caged Ca2+ induced Ca2+ responses in all cells tested, indicating that RYR3 became activatable. Interestingly, the upstroke velocity of the caffeine-induced Ca2+ response in non-pregnant mouse myometrial cells is similar to that measured in vascular myocytes where both RYR1 and RYR2 are inactivated by injection of antisense oligonucleotides (Coussin et al. 2000), suggesting that the properties of RYR3 expressed in vascular and visceral smooth muscle cells may be similar. Immunodetection of RYR3s in mouse myometrial cells revealed a rather homogeneous fluorescence distribution in confocal cell sections suggesting that RYR3s did not form clustered units. This observation is in agreement with the absence of spontaneous and triggered Ca2+ sparks in all the cells tested in 10 mM [Ca2+]o, whatever the experimental protocols used (applications of low concentrations of Bay K 8644, ryanodine or caffeine).
The existence of several regulatory sites on the RYR protein complex arises essentially from single channel experiments on RYRs incorporated in lipid bilayers. Several reports have shown that RYR3 can be activated by low cytosolic Ca2+ concentration in the presence of 1 mM ATP (Chen et al. 1997; Murayama et al. 1999). These results support the idea that cytosolic Ca2+ and ATP may act synergistically to modify the open probability of RYR3 (Manunta et al. 2000). However, in native cells expressing only RYR3, nanomolar increases in [Ca2+]i are unable to activate RYR3. Another important modulator of RYR3 activity is luminal [Ca2+]. Increase in luminal [Ca2+] has been reported to cause changes in RYR gating (Gyorke & Gyorke, 1998; Lukyanenko et al. 1999). Recently, it has been shown that the open probability of cardiac RYR is strongly increased by raising the luminal [Ca2+] from 10 µM to 1 mM (Ching et al. 2000). This effect is removed in the presence of luminal trypsin, suggesting the existence of luminal Ca2+ binding sites located either on the RYR or on a closely associated protein which may regulate RYR gating (Ching et al. 2000). Our results confirm that luminal [Ca2+] may exert a modulation of endogenous RYR3, leading to an increased channel activity. In addition, the slow gating kinetics of recombinant RYR3 observed at nanomolar [Ca2+]i and in the presence of a physiological concentration of ATP (Manunta et al. 2000) may explain the slow upstroke velocity of caffeine-induced Ca2+ release in cells expressing only RYR3s (Coussin et al. 2000 and present study).
Expression of a full-length cDNA encoding the rabbit uterine RYR3 in HEK293 cells leads to a Ca2+ release channel sensitive to ryanodine and caffeine (Chen et al. 1997). The spliced variants described by Miyatake et al. (1996) could offer an alternative explanation for various caffeine sensitivity. Since the two RYR3 spliced variants were identified in mouse myometrial cells, which did not respond to caffeine in 1.7 mM [Ca2+]o, and in duodenal myocytes, which responded to caffeine in 1.7 mM [Ca2+]o (Morel et al. 1997), this ruled out the possibility that these spliced variants could be responsible for sensitivity to caffeine. In duodenal myocytes, it is likely that sensitivity to caffeine is related to expression of RYR2.
In conclusion, our data show the expression of RYR3 in non-pregnant mouse myometrial cells and its functional activity only under conditions of increased SR Ca2+ loading.
| REFERENCES |
|---|
|
|
|---|
| ARNAUDEAU, S., BOITTIN, F. X., MACREZ, N., LAVIE, J. L., MIRONNEAU, C. & MIRONNEAU, J. (1997). L-type and Ca2+ release channel-dependent hierarchical Ca2+ signalling in rat portal vein myocytes. Cell Calcium 22, 399-411 | [Medline] |
| ARNAUDEAU, S., LEPRÊTRE, N. & MIRONNEAU, J. (1994). Oxytocin mobilizes calcium from a unique heparin-sensitive and thapsigargin-sensitive store in single myometrial cells from pregnant rats. Pflüger's Archiv 428, 51-59 | [Medline] |
| ARNAUDEAU, S., MACREZ-LEPRÊTRE, N. & MIRONNEAU, J. (1996). Activation of calcium sparks by angiotensin II in vascular myocytes. Biochemical and Biophysical Research Communications 222, 809-815 | [Medline] |
| AWAD, S. S, LAMB, H. K., MORGAN, M. J., DUNLOP, W. & GILLEPSIE, I. J. (1997). Differential expression of ryanodine receptor RyR2 mRNA in the non-pregnant and pregnant human myometrium. Biochemical Journal 322, 777-783 | [Medline] |
| BERTOCCHINI, F., OVITT, C. E., CONTI, A., BARONE, V., SCHÖLER, R. H., BOTTINELLI, R., REGGIANI, C. & SORRENTINO, V. (1997). Requirement for the ryanodine receptor type 3 for efficient contraction in neonatal skeletal muscles. EMBO Journal 16, 6956-6963 | [Abstract/Full Text] |
| BOITTIN, F. X., COUSSIN, F., MACREZ, N., MIRONNEAU, C. & MIRONNEAU, J. (1998). Inositol 1,4,5-trisphosphate- and ryanodine-sensitive Ca2+ release channel-dependent Ca2+ signalling in rat portal vein myocytes. Cell Calcium 23, 303-311 | [Medline] |
| BOITTIN, F. X., MACREZ, N., HALET, G. & MIRONNEAU, J. (1999). Norepinephrine-induced Ca2+ waves depend on InsP3 and ryanodine receptor activation in vascular myocytes. American Journal of Physiology 277, C139-151 | [Medline] |
| CHEN, S. R. W., LI, X., EBISAWA, K. & ZHANG, L. (1997). Functional characterization of the recombinant Type 3 Ca2+ release channel (ryanodine receptor) expressed in HEK293 cells. Journal of Biological Chemistry 272, 24234-24246 | [Abstract/Full Text] |
| CHING, L. L., WILLIAMS, A. J. & SITSAPESAN, R. (2000). Evidence for Ca2+ activation and inactivation sites on the luminal side of the cardiac ryanodine receptor complex. Circulation Research 87, 201-206 | [Abstract/Full Text] |
| COUSSIN, F., MACREZ, N., MOREL, J. L. & MIRONNEAU, J. (2000). Requirement of ryanodine receptor subtypes 1 and 2 for Ca2+-induced Ca2+ release in vascular myocytes. Journal of Biological Chemistry 275, 9596-9603 | [Abstract/Full Text] |
| ESCOBAR, A. L., CIFUENTES, F. & VERGARA, J. L. (1995). Detection of Ca2+-transients elicited by flash photolysis of DM-nitrophen with a fast calcium indicator. FEBS Letters 364, 335-341 | [Medline] |
| GIANNINI, G., CLEMENTI, E., CECI, R., MARZIALI, G. & SORRENTINO, V. (1992). Expression of ryanodine receptor-Ca2+ channel that is regulated by TGF-beta. Science 257, 91-94 | |
| GIANNINI, G., CONTI, A., MAMMARELLA, S., SCROBOGNA, M. & SORRENTINO, V. (1995). The ryanodine receptor/calcium channel genes are widely and differentially expressed in murine brain and peripheral tissues. Journal of Cell Biology 128, 893-904 | [Abstract] |
| GYORKE, I. & GYORKE, S. (1998). Regulation of the cardiac ryanodine receptor channel by luminal Ca2+ involves luminal Ca2+ sensing sites. Biophysical Journal 75, 2801-2810 | [Abstract/Full Text] |
| LUKYANENKO, V., SUBRANMANIAN, S., GYORKE, I., WIESNER, T. F. & GYORKE, S. (1999). The role of luminal Ca2+ in the generation of Ca2+ waves in rat ventricular myocytes Journal of Physiology 518, 173-186. LYNN, S., MORGAN, J. M., LAMB, H. K., MEISSNER, G. & GILLESPIE, J. I | |
| MANUNTA, M., ROSSI, D., SIMEONI, I., BUTELLI, E., ROMANIN, C., SORRENTINO, V. & SCHINDLER, H. (2000). ATP-induced activation of expressed RyR3 at low free calcium. FEBS Letters 471, 256-260 | [Medline] |
| MARC, S., LEIBER, D. & HARBON, S. (1986). Carbachol and oxytocin stimulate the generation of inositol phosphates in the guinea pig myometrium. FEBS Letters 201, 9-14 | [Medline] |
| MARTIN, C., CHAPMAN, K. E., THORNTON, S. & ASHLEY, R. H. (1999a). Changes in the expression of myometrial ryanodine receptor mRNAs during human pregnancy. Biochimica et Biophysica Acta 1451, 343-352 | [Medline] |
| MARTIN, C., HYVELIN, J. M., CHAPMAN, E. K., MARTHAN, R., ASHLEY, H. R. & SAVINEAU, J. P. (1999b). Pregnant rat myometrial cells show heterogeneous ryanodine- and caffeine-sensitive calcium stores. American Journal of Physiology 277, C243-252 | [Medline] |
| MIRONNEAU, J., COUSSIN, F., JEYAKUMAR, H. L., FLEISCHER, S., MIRONNEAU, C. & MACREZ, N. (2001). Contribution of ryanodine receptor subtype 3 to Ca2+ responses in Ca2+-overloaded cultured rat portal vein myocytes. Journal of Biological Chemistry 276, 11257-11264 | [Abstract/Full Text] |
| MIYATAKE, R., FURKAWA, A., MATSUSHITA, M., IWAHASHI, K., NAKAMURA, K., ICHIKAWA, Y. & SUWAKI, H. (1996). Tissue-specific alternative splicing of mouse brain type ryanodine receptor/calcium release channel mRNA. FEBS Letters 395, 123-126 | [Medline] |
| MOREL, J. L., MACREZ, N. & MIRONNEAU, J. (1997). Specific Gq protein involvement in muscarinic M3 receptor-induced specific phosphatidylinositol hydrolysis and Ca2+ release in mouse duodenal myocytes. British Journal of Pharmacology 121, 451-458 | [Abstract] |
| MORGAN, J. M. & GILLESPIE, J. I. (1995). The modulation and characterisation of the Ca2+-induced Ca2+ release mechanism in cultured human myometrial smooth muscle cells. FEBS Letters 369, 295-300 | [Medline] |
| MURAYAMA, T., OBA, T., KATAYAMA, E., OYAMADA, H., OGUCHI, K., KOBAYASHI, M., OTSUKA, K. & OGAWA, Y. (1999). Further characterization of the type 3 ryanodine receptor (RyR3) purified form rabbit diaphragm. Journal of Biological Chemistry 274, 17297-17308 | [Abstract/Full Text] |
| OTSU, K., WILLARD, H. F., KHANNA, V. K., ZORZATO, F., GREEN, N. M. & MACLENNAN, D. H. (1990). Molecular cloning of cDNA encoding the Ca2+ release channel (ryanodine receptor) of rabbit cardiac muscle sarcoplasmic reticulum. Journal of Biological Chemistry 265, 13472-13483 | [Abstract] |
| SONNLEITNER, A., CONTI, A., BERTOCCHINI, F., SCHINDLER, H. & SORRENTINO, V. (1998). Functional properties of ryanodine receptor type 3 (RyR3) Ca2+ release channel. EMBO Journal 17, 2790-2798 | [Abstract/Full Text] |
| SORRENTINO, V., BARONE, V. & ROSSI, D. (2000). Intracellular Ca2+ release channels in evolution. Current Opinion in Genetics and Development 10, 662-667 | [Medline] |
| SORRENTINO, V. & VOLPE, P. (1993). Ryanodine receptors : how many, where and why? Trends in Pharmacological Sciences 14, 98-103 | [Medline] |
| WARD, C. W., SCHNEIDER, M. F., CASTILLO, D., PROTASI, F., WANG, Y., CHEN, S. R. W. & ALLEN, P. D. (2000). Expression of ryanodine receptor RyR3 produces Ca2+ sparks in dyspedic myotubes. Journal of Physiology 525, 91-103 | [Abstract/Full Text] |
| ZORZATO, F., FUJII, J., OTSU, K., PHILLIPS, M., GREEN, N. M., LAI, F. A., MEISSNER, G. & MACLENNAN, D. H. (1990). Molecular cloning of cDNA encoding human and rabbit forms of the Ca2+ release channel (ryanodine receptor) of skeletal muscle sarcoplasmic reticulum. Journal of Biological Chemistry 265, 2244-2256 | [Abstract] |
Acknowledgements
This work was supported by grants from Centre National de la Recherche Scientifique, Centre National des Etudes Spatiales, Pôle Aquitaine Santé, and Association Française contre les Myopathies, France.
This article has been cited by other articles:
![]() |
F. Dabertrand, N. Fritz, J. Mironneau, N. Macrez, and J.-L. Morel Role of RYR3 splice variants in calcium signaling in mouse nonpregnant and pregnant myometrium Am J Physiol Cell Physiol, September 1, 2007; 293(3): C848 - C854. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wray Insights into the uterus Exp Physiol, July 1, 2007; 92(4): 621 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Laporte, A. Hui, and I. Laher Pharmacological Modulation of Sarcoplasmic Reticulum Function in Smooth Muscle Pharmacol. Rev., December 1, 2004; 56(4): 439 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chiarella, R. Puglisi, V. Sorrentino, C. Boitani, and M. Stefanini Ryanodine receptors are expressed and functionally active in mouse spermatogenic cells and their inhibition interferes with spermatogonial differentiation J. Cell Sci., August 15, 2004; 117(18): 4127 - 4134. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Aoyama, A. Yamada, J. Wang, S. Ohya, S. Furuzono, T. Goto, S. Hotta, Y. Ito, T. Matsubara, K. Shimokata, et al. Requirement of ryanodine receptors for pacemaker Ca2+ activity in ICC and HEK293 cells J. Cell Sci., June 1, 2004; 117(13): 2813 - 2825. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Morel, L. Rakotoarisoa, L. H. Jeyakumar, S. Fleischer, C. Mironneau, and J. Mironneau Decreased Expression of Ryanodine Receptors Alters Calcium-induced Calcium Release Mechanism in mdx Duodenal Myocytes J. Biol. Chem., May 14, 2004; 279(20): 21287 - 21293. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Jiang, B. Xiao, X. Li, and S. R. W. Chen Smooth Muscle Tissues Express a Major Dominant Negative Splice Variant of the Type 3 Ca2+ Release Channel (Ryanodine Receptor) J. Biol. Chem., February 7, 2003; 278(7): 4763 - 4769. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Xiao, H. Masumiya, D. Jiang, R. Wang, Y. Sei, L. Zhang, T. Murayama, Y. Ogawa, F. A. Lai, T. Wagenknecht, et al. Isoform-dependent Formation of Heteromeric Ca2+ Release Channels (Ryanodine Receptors) J. Biol. Chem., October 25, 2002; 277(44): 41778 - 41785. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |