J Physiol Society Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 539, Number 2, 385-390, March 1, 2002 DOI: 10.1113/jphysiol.2001.014548
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
539/2/385    most recent
2001.014548v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Speake, T.
Right arrow Articles by Brown, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Speake, T.
Right arrow Articles by Brown, P. D.

Journal of Physiology (2002), 539.2, pp. 385-390
© Copyright 2002 The Physiological Society
DOI: 10.1113/jphysiol.2001.014548

Inward-rectifying anion channels are expressed in the epithelial cells of choroid plexus isolated from ClC-2 'knock-out' mice

Tracey Speake, Hidetoshi Kajita, Craig P. Smith and Peter D. Brown

School of Biological Sciences, University of Manchester, Manchester M13 9PT, UK

  ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

Choroid plexus epithelial cells express inward-rectifying anion channels which have a high HCO3- permeability. These channels are thought to have an important role in the secretion of cerebrospinal fluid. The possible relationship between these channels and the ClC-2 Cl- channel was investigated in the present study. RT-PCR, using specific ClC-2 primers, amplified a 238 bp fragment of mRNA from rat choroid plexus, which was 99 % identical to the 5' sequence of rat ClC-2. A 2005 bp clone was isolated from a rat choroid plexus cDNA library using a probe for ClC-2. The clone showed greater than 99 % identity with the sequence of rat ClC-2. Inward-rectifying anion channels were observed in whole-cell recordings of choroid plexus epithelial cells isolated from ClC-2 knock-out mice. The mean inward conductance was 19.6 ± 3.6 nS (n = 8) in controls (3 heterozygote animals), and 22.5 ± 3.1 nS (n = 10) in three knock-out animals. The relative permeability of the conductances to I- and Cl- (PI : PCl) was determined. I- was more permeant than Cl- in both heterozygotes (PI:PCl = 4.0 ± 0.9, n = 3) and knock-out animals (PI : PCl = 4.1 ± 1.4, n = 3). These results indicate that rat choroid plexus expresses the ClC-2 variant that was originally reported in other tissues. ClC-2 does not contribute significantly to inward-rectifying anion conductance in mouse choroid plexus, which must therefore express a novel inward-rectifying anion channel.

(Received 26 November 2001; accepted after revision 22 January 2002)
Corresponding author P. D. Brown: G.38 Stopford Building, School of Biological Sciences, University of Manchester, Manchester M13 9PT, UK. Email: Peter.D.Brown{at}man.ac.uk

  INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

An inward-rectifying anion channel, which is activated by protein kinase A (PKA) and has a high permeability to HCO3- has been observed in whole-cell recordings from rat fourth ventricle choroid plexus (Kibble et al. 1996). Similar channels have also been identified in Necturus, mouse and porcine choroid plexus epithelial cells (Birnir et al. 1989; Kibble et al. 1997; Kajita et al. 2000a). These channels are thought to play an important role in cerebrospinal fluid secretion by the choroid plexus, since they are the major pathway for HCO3- transport across the apical (ventricular) membrane of the choroid plexus epithelium.

Some properties of the anion channels identified in choroid plexus epithelial cells are similar to those of ClC-2 channels expressed in both epithelial and non-epithelial tissues (Thiemann et al. 1992). For example, the inward rectification of the I-V relationship, the activation kinetics at hyperpolarizing potentials (Kibble et al. 1996), and the inhibition by Cd2+ or Zn2+ (Kajita et al. 2000b) are similar to ClC-2. This similarity has led to the suggestion that the channel is ClC-2. This possibility is supported by the observation that mRNA for ClC-2 is expressed in choroid plexus epithelial cells (Smith et al. 1995). Furthermore, it has recently been reported that the inward-rectifying anion conductance in pig choroid plexus epithelial cells is reduced by anti-sense oligonucleotides to ClC-2 (Kajita et al. 2000a).

Other properties of the choroid plexus channel, however, differ significantly from those of ClC-2, e.g. the halide selectivity sequence (I- > Cl-; Kibble et al. 1996), lack of volume sensitivity (Kibble et al. 1996) and inhibition by H+ (Kajita & Brown, 1997). Three hypotheses can be envisaged which may explain these apparently contradictory observations. The first is that the channel is a spliced variant form of ClC-2. This hypothesis is supported by reports that spliced variants of ClC-2 are expressed in other epithelial tissues (Chu et al. 1996; Chu & Zeitlin, 1997; Loewen et al. 2000; Cid et al. 2000). The second hypothesis is that the channel is ClC-2, but that its properties are modified by the expression of 'accessory' proteins. This possibility is supported by the work of Park et al. (1998), who reported that the properties of ClC-2 are altered in different expression systems. The final hypothesis is that the channel is not ClC-2, and may have a unique molecular structure. The aim of the present study was to test these hypotheses. In the first part of the paper the molecular structure of ClC-2 expressed in rat choroid plexus was compared with that of rat ClC-2 and of the known spliced variants. In the second part of the paper, channel activity was examined in the choroid plexus of ClC-2 knock-out mice (Bösl et al. 2001).

  METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

RT-PCR for ClC-2 in rat choroid plexus

Adult Sprague-Dawley rats (weighing 200-250 g) were killed by an overdose of Halothane (Zeneca), and the choroid plexus was removed from the fourth ventricle. Poly-A mRNA was extracted from the choroid plexus tissue using poly-dT magnetic beads (Dynal Biotech, Oslo, Norway), following the manufacturer's instructions. mRNA (1 µg) was DNAse (Gibco) treated, and then reverse transcribed using the avian myeloblastosis virus RNA-dependent DNA polymerase (Boehringer Mannheim, Mannheim, Germany) at 42 °C for 60 min. PCR amplification was carried out using ClC-2-specific, intron spanning primers from the 5' coding region of the ClC-2 gene, as previously described by Mladini'c et al. (1999), i.e. forward primer GGAAGGGATGGAGCCTCGAG (np 39-58) and a reverse primer CCCTGGACACTAGGAACTTGT (np 277-257). PCR was performed on a programmable thermal cycler (Hybaid, Ashford, UK), using Taq polymerase (Promega, Madison, WI, USA) and adopting the same cycling conditions as Mladini'c et al. (1999). PCR products were electrophoresed on a 1.5 % agarose Tris-EDTA (pH 8.0) gel at 80 V h-1, and visualised using ethidium bromide. Bands were also excised and products characterised by automated sequencing using the dideoxynucleotide termination method

Screening a rat choroid plexus cDNA library for ClC-2

A lambdagt10 cDNA library prepared from rat choroid plexus mRNA (Duan et al. 1989), was kindly provided by Professor Gerhard Schreiber (University of Melbourne). Primary and secondary screening of the library was performed with a 32P-labelled, randomly primed 1800 bp DNA probe for ClC-2 (np 683-2483; GenBank accession number X64319), provided by Professor Thomas Jentsch (University of Hamburg, Germany). Screening was performed at low stringency; overnight hybridisation was performed at 48 °C in 10 % (w/v) dextran sulphate and 50 % (v/v) formamide. Final washes were performed at 65 °C in 0.1 % (w/v) standard saline citrate, 0.1 % (w/v) sodium dodecasulphate. Screening identified three clones, each of which was subcloned into the Not I site of pBluescript SK(-) (Stratagene, La Jolla, CA, USA), both strands were sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Foster City, CA, USA) and data were analysed using the Lasergene software (DNASTAR Inc., Madison, WI, USA).

Electrophysiological recordings from ClC-2 knock-out mouse choroid plexus

Experiments were performed on three adult control (heterozygote) mice and three knock-out animals (Bösl et al. 2001), kindly provided by Professor Thomas Jentsch. Each animal was genotyped by Professor Jentsch's laboratory before despatch. Briefly DNA was extracted from tail biopsies by a standard phenol-chloroform method. PCR was performed using a single forward primer (GGGTACAGAGTAGGAACACTTTG), and two reverse primers complementary to either the wild-type gene (AGGTTAGCCCAATGACCTTAGC) or the phosphoglycerate kinase (PGK) sequence of the targeting vector in the knock-out (CTAAAGCGCATGCTCCAGACTGCC). In the heterozygotes, products of 830 bp and 620 bp were obtained with the wild-type and PGK reverse primer, respectively. Only the PGK primer yielded a product (620 bp) in the knock-out animals.

The mice were killed by Halothane inhalation and the fourth ventricle choroid plexus removed. Tissue was stored for up to 3 h in ice-cold artificial cerebrospinal fluid, which contained (mM): 140 NaCl, 2 KCl, 1 CaCl2, 1 MgCl2, 10 glucose, 25 mannitol and 10 Hepes (pH 7.3 with NaOH). Experiments were performed on a small piece of the choroid plexus tissue secured to the base of a perfusion chamber with a stainless steel wire. The perfusion chamber was mounted on the stage of an inverted microscope (Olympus IMT-2, Japan). The conventional whole-cell recording method was applied to measure channel activity in cells of intact choroid plexus, as previously described (Kibble et al. 1996). Currents were monitored using an Axopatch-1D amplifier (Axon Instruments, Union City, CA, USA). Patch pipettes (tip resistance of 2-3 MOmega) were made from haematocrit capillary tubes (Oxford Labware, St Louis, MO, USA) using a two-stage vertical puller (Narishige PP-83, Tokyo, Japan). To eliminate any contributions from K+ channels to the whole-cell currents, experiments were performed using K+-free solutions. The control bath solution contained (mM): 140 NaCl, 1 CaCl2, 1 MgCl2, 10 glucose, 25 mannitol and 10 Hepes (pH 7.3 with NaOH, osmolality 309 ± 3 mosmol (kg H2O)-1, n = 4). The control pipette solution contained (mM): 20 NaCl, 110 sodium aspartate, 3 MgCl2, 5 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA, Sigma), 10 glucose and 10 Hepes (pH 7.3 with NaOH). To activate the inward-rectifying current, 375 nM of catalytic subunit of protein kinase A (PKA; Promega) and 5 mM ATP (sodium salt; Sigma) were dissolved in the pipette solution (osmolality 253 ± 3 mosmol (kg H2O)-1, n = 4). The selectivity of the anion conductance was examined in experiments using a bath solution in which the NaCl concentration was reduced to 110 mM, and 12 mM NaI was added (all other components as above). The pipette solution in these experiments contained (mM): 12 NaCl, 110 NaI, 3 MgCl2, 5 mM BAPTA, 10 glucose and 10 Hepes (pH 7.3). The pipette solution was always hypotonic with respect to the bath solutions, to prevent cell swelling and activation of volume-sensitive anion channels (see Kibble et al. 1997).

Command potentials were generated by computer using the pCLAMP software (version 6.0.2, Axon Instruments). A series of 1 s step pulse potentials were applied between -140 and +20 mV (at 40 mV increments) from a holding potential of -40 mV. Access resistance ranged from 6 to 12 MOmega, and series resistance compensation was not applied. All experiments were performed at room temperature (19-23 °C). In selectivity studies, the relative permeability of the channel to the test ion and Cl- (PX : PCl) was estimated from the reversal potential (Vrev) of the current-voltage (I-V) relationship using:

eq01 (1)

where RT/F = 25.5 mV at 23 °C, and [Cl-] and [X-] are the concentrations of Cl- and test ion in the intracellular (i) or extracellular (o) fluid. Data are presented as means ± S.E.M. of n observations. Statistical analysis of the data was by Student's t test for unpaired data.

  RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Expression of mRNA for ClC-2 in rat choroid plexus

PCR primers previously described to amplify mRNA for ClC-2 from the hippocampus (Mladini'c et al. 1999) were used to amplify part of the 5' mRNA sequence of ClC-2 from rat choroid plexus. Figure 1 shows that a single PCR product of 238 bp was amplified from choroid plexus (CP) and from brain (B), the positive control. The 238 bp product was sequenced, and was 99 % identical to the published sequence for rat ClC-2 (EMBL/GenBank accession number X64139; Thiemann et al. 1992). Primary and secondary screening of a rat choroid plexus cDNA library identified three independent clones, which were isolated and sequenced. The sequence of one of these clones showed greater than 99 % identity with the published sequence for ClC-2 (Theimann et al. 1992). The 2005 bp clone corresponds to bp 1039 to 3044 in the 3' terminus of the mRNA for rat ClC-2.

F1 View larger version
[in this window]
[in a new window]

Figure 1. Expression of mRNA encoding ClC-2 in rat brain (B) and choroid plexus (CP)

PCR products were obtained using specific, intron-spanning primers for ClC-2. The PCR products were of the expected size for these primers (239 bp). The data are representative of three similar experiments.

Whole-cell recording of anion channel activity in ClC-2 knock-out mice

Electrical recordings were made on fourth ventricle choroid plexus from three control (heterozygous) and three ClC-2 knock-out mice. No obvious differences in morphology were observed in the choroid plexus tissue isolated from the two groups of animals. A total of 11 recordings were made from the control tissue, and the mean whole-cell capacitance measured in these cells was 51.3 ± 2.9 pF. The capacitance of 13 cells in tissue from the knock-out animals was 50.0 ± 1.9 pF, which is not significantly different from control (P > 0.1).

Figure 2A shows whole-cell currents in choroid plexus cells from a control (+/-) and a knock-out (-/-) animal. The experiments were performed using the control bath and pipette solutions. Inward-rectifying currents were observed in cells from both animals. The currents were of a similar magnitude and displayed similar kinetics, i.e. slight time dependent activation at Vm = -140 and -100 mV. The I-V relationship in Fig. 2B plots the mean currents from eight control (filled square) and 10 knock-out cells (circle). There were no significant differences between the currents measured in the control and knock-out cells at any potential (P > 0.1). The mean Vrev in control cells was -12 ± 2 mV, giving a relative permeability of aspartate- to Cl- (PAsp : PCl) of 0.6 ± 0.1 (Table 1). Similar values were obtained for the cells from knock-out animals (Vrev = -9 ± 3 mV; PAsp : PCl = 0.7 ± 0.1, P > 0.1). Figure 2C shows that there were no significant differences (P > 0.1) between the mean conductance for inward currents (Gin) or outward currents (Gout), in the control or knock-out animals.

F2 View larger version
[in this window]
[in a new window]

Figure 2. Inward-rectifying anion currents are observed in choroid plexus epithelial cells from control (heterozygous; +/-) and ClC-2 knock-out (-/-) mice

A, current profiles recorded from +/- and -/- mice. Experiments were performed using K+-free solutions (i.e. control electrode and bath solutions). Cells were maintained at a holding potential of -40 mV, and 1 s step potentials applied from -140 to +20 mV (at 40 mV increments). The dotted line indicates zero current. B, current-voltage relationships (means ± S.E.M.), recorded from eight control cells from three mice (filled square), and 10 'knock-out' cells from three mice (circle). C, mean conductances (and S.E.M.) for inward (Gin : Vm = -140 to -100 mV) and outward (Gout: Vm = -20 to +20 mV) current in control (filled column; n = 8) and knock-out mice (open column; n = 10).

tab1

One of the properties that distinguish the choroid plexus channel from ClC-2 is the halide selectivity (PI > PCl in choroid plexus; PCl > PI in ClC-2). Experiments were therefore performed to measure the relative permeability of the channel to I- and Cl- (PI: PCl ) in cells from control and knock-out animals. Figure 3A shows current profiles recorded using the 110 mM I- electrode solution. Inward-rectifying currents were observed in both the control (+/-) and knock-out (-/-) tissue. Figure 3B shows the mean I-V relationship from three control (filled square) and three knock-out animals. No significant differences (P > 0.1) were observed between the currents in the two groups at any potential. Table 1 shows that Vrev was similar in the control and knock-out animals (P > 0.1). The channels in both experimental groups were therefore more permeable to I- than Cl-.

F3 View larger version
[in this window]
[in a new window]

Figure 3. I- permeability of the inward rectifying conductance in mouse choroid plexus

A, current profiles (Vm = -140 to 20 mV) recorded from choroid plexus from control (+/-) and ClC-2 knock-out mice (-/-), with the 110 mM I- pipette solution, and the 12 mM I- bath solution. B, current-voltage relationships recorded in cells from control (filled square; n = 3) and knock-out mice (circle; n = 3).

  DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

ClC-2 expression in choroid plexus

In this study the relationship between the inward-rectifying anion channel in choroid plexus and ClC-2 was examined. To test the hypothesis that the channel is a spliced variant of ClC-2, the mRNA sequence of the ClC-2 expressed in rat choroid plexus was determined. Sequence data from both the 5' and 3' regions were obtained by RT-PCR (238 bp) and from a partial clone (2005 bp) isolated from a cDNA library, respectively. The sequence obtained was virtually identical (99 %) to that of ClC-2 in other tissues isolated from the rat. Furthermore, the data include sequences from, and show no differences to, regions in which spliced variants have previously been reported, e.g. exon 2 in guinea-pig (Cid et al. 2000), exon 13 in rat (Chu & Zeitlin, 1997; Loewen et al. 2000) and exon 20 in rat (Chu et al. 1996). These data therefore strongly suggest that the ClC-2 expressed in rat choroid plexus is identical in sequence to the ClC-2 first cloned from rat heart and brain (Thiemann et al. 1992). Thus, the differences in properties between the rat choroid plexus channel and ClC-2 cannot be explained by the expression of a spliced-variant of ClC-2.

The inward-rectifying anion channel in mouse choroid plexus is not ClC-2

To test whether ClC-2 makes any contribution to the inward-rectifying anion current in choroid plexus experiments were performed on ClC-2 knock-out mice (Bösl et al. 2001). No differences could be determined in the morphology of the choroid plexus from ClC-2 knock-out mice, i.e. the surface area of the choroid plexus epithelial cells (determined from the whole-cell capacitance assuming 1 µF cm-2), was identical in the control (5130 µm2) and knock-out animals (5000 µm2). These values for cell area are also very similar to those previously reported for mouse choroid plexus (Kibble et al. 1997), and rat choroid plexus (Kotera & Brown, 1994). An inward-rectifying anion conductance was observed in choroid plexus cells isolated from the control mice. The conductance exhibited slight time-dependent activation at extreme hyperpolarizing potentials and was more permeable to I- than Cl- , suggesting that the conductance in mouse choroid plexus is similar to that in rat and pig (Kibble et al. 1996; Kajita 2000a). Inward-rectifying anion currents were also observed in the ClC-2 knock-out mice, and there were no significant differences between the inward or outward conductances measured in the control and knock-out animals. These observations suggest that ClC-2 channels do not make a major contribution to the inward-rectifying anion conductance in choroid plexus epithelial cells. Another novel inward-rectifying anion channel must therefore be involved.

This conclusion is clearly at odds with the results of Kajita et al. (2000a), who reported that the magnitude of the inward-rectifying conductance was reduced in pig choroid plexus cells transfected with ClC-2 antisense oligonucleotides. A possible explanation for these contradictory observations is that in wild-type animals the inward-rectifying currents are carried by a combination of ClC-2 and a novel channel. Thus, in the antisense-treated cells the ClC-2 current could be reduced and the residual carried by the novel channels. In the knock-out animals, however, there may be compensation for the lack of ClC-2 with an increase in the expression of the novel channel. This explanation, however, seems unlikely given that the halide selectivity sequence (PI > PCl ) was identical in the control and knock-out animals, whereas, if ClC-2 did contribute to the conductance in control animals an increased PI might be expected in the knock-out animals, because ClC-2 is less permeable to I- than Cl- (Thiemann et al. 1992). A more likely explanation for the results of Kajita et al. (2000a), is that the antisense oligonucleotides had a non-specific effect on protein expression. Kajita et al. (2000a) did not control for this possibility, since they did not demonstrate that the reduction of inward-rectifying current was correlated to a reduction of ClC-2 protein expression. Thus, in conclusion it appears that ClC-2 does not make a significant contribution to the inward-rectifying conductance in choroid plexus epithelial cells.

The identity of the inward-rectifying channel in choroid plexus

If ClC-2 is not involved, what channel protein carries the inward-rectifying conductance? Inward-rectifying conductances have been observed in a variety of other cell types, e.g. T84 cells (Fritsch & Edelman, 1996), salivary gland duct cells (Komwatana et al. 1994) and acinar cells (Park et al. 1998), astrocytes (Ferroni et al. 1997) and neurones (Staley, 1994; Clark et al. 1998). In most of these cells the channel properties are consistent with those of ClC-2. However, in others the properties differ sufficiently from those of ClC-2 to suggest that other inward-rectifying channels may be responsible, e.g. in salivary duct cells the channels are activated by cell shrinkage rather than swelling (Komwatana et al. 1995). The lack of any volume sensitivity and a difference in halide permeability in the choroid plexus channel, however, distinguish it from the channel in salivary ducts. The inward-rectifying anion conductance observed in Xenopus oocytes has properties most similar to the choroid plexus channel (Kowdley et al. 1994). However, the molecular structure this channel has not yet been determined.

In conclusion, mRNA for ClC-2 is expressed in choroid plexus epithelial cells, but ClC-2 probably does not contribute to the whole-cell anion conductance in these cells. The inward-rectifying anion channel in choroid plexus must therefore be a novel, and as yet unidentified, protein.

  REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

BIRNIR, B., LOO, D. D. F., BROWN, P. D. & WRIGHT, E. M. (1989). Whole-cell currents in Necturus choroid plexus. FASEB Journal 2, A1722
BÖSL, M. R., STEIN, V., HÜBNER, C., ZDEBIK, A. A., JORDT, S. E., MUKHOPADHYAY, A. K., DAVIDOFF, M. S., HOLSTEIN, A. F. & JENTSCH, Y. J. (2001). Male germ cells and photoreceptors, both dependent on close cell-cell interaction, degenerate upon ClC-2 Cl- channel disruption. EMBO Journal 20, 1289-1299 [Abstract/Full Text]
CHU, S., MURRAY, C. B., LIU, M. M. & ZEITLIN, P. L. (1996). A short ClC-2 transcript is produced by exon skipping. Nucleic Acids Research 24, 3453-3457 [Abstract/Full Text]
CHU, S. & ZEITLIN, P. L. (1997). Alternative mRNA splice variants of the rat ClC-2 chloride channel gene are expressed in lung: genomic sequence and organization of ClC-2. Nucleic Acids Research 25, 4153-4159 [Abstract/Full Text]
CID, L. P., NIEMEYER, M.-I., RAMÍREZ, A. & SEPÚLVEDA, F. V. (2000). Splice variants of a ClC-2 chloride channel with differing functional characteristics. American Journal of Physiology 279, C1198-C1210
CLARK, S., JORDT, S. E., JENTSCH, T. J. & MATHIE, A. (1998). Characterization of the hyperpolarization-activated chloride current in dissociated rat sympathetic neurons. Journal of Physiology 506, 665-678 [Abstract/Full Text]
DUAN, W., COLE, T. & SCHREIBER, G. (1989). Cloning and nucleotide sequencing of transthyretin (prealbumin) cDNA from rat choroid plexus and liver. Nucleic Acid Research 17, 3979
FERRONI, S., MARCHINI, C., NOBILE, M. & RAPISARDA, C. (1997). Characterization of an inwardly rectifying chloride conductance expressed by cultured rat cortical astrocytes. Glia 21, 217-227 [Medline]
FRITSCH, J. & EDELMAN, A. (1996). Modulation of the hyperpolarization-activated Cl- current in human intestinal T84 epithelial cells by phosphorylation. Journal of Physiology 490, 115-128 [Abstract]
KAJITA, H. & BROWN, P. D. (1997). Inhibition of the inward-rectifying Cl- channel in the rat choroid plexus by a decrease in extracellular pH. Journal of Physiology 498, 703-707 [Abstract]
KAJITA, H., OMORI, K. & MATSUDA, H. (2000a). The chloride channel ClC-2 contributes to the inwardly rectifying Cl- conductance in cultured porcine choroid plexus epithelial cells. Journal of Physiology 523, 313-324 [Abstract/Full Text]
KAJITA, H., WHITWELL, C. & BROWN, P. D. (2000b). Properties of the inward-rectifying Cl- channel in rat choroid plexus: regulation by intracellular messengers and inhibition by divalent cations. Pflügers Archiv 440, 933-940 [Medline]
KIBBLE, J. D., TRESIZE, A. E. O. & BROWN, P. D. (1996). Properties of the cAMP-activated Cl- conductance in choroid plexus cells isolated from the rat. Journal of Physiology 496, 69-80 [Abstract]
KIBBLE, J. D., GARNER, C., KAJITA, H., COLLEDGE, W. H., EVANS, M. J., RADCLIFF, R. & BROWN, P. D. (1997). Whole-cell Cl- conductances in mouse choroid plexus epithelial cells do not require CFTR expression. American Journal of Physiology 272, C1899-1907 [Medline]
KOMWATANA, P., DINUDOM, A., YOUNG, J. A. & COOK, D. I. (1994). Characterization of the Cl- conductance in the granular duct cells of mouse mandibular glands. Pflügers Archiv 428, 641-647 [Medline]
KOMWATANA, P., DINUDOM, A., YOUNG, J. A. & COOK, D. I. (1995). Osmotic sensitivity of the hyperpolarization-activated Cl- current in mouse mandibular duct cells. Cell Physiology and Biochemistry 5, 243-251
KOTERA, T. & BROWN, P. D. (1994). Evidence for two types of K+ current in rat choroid plexus epithelial cells. Pflügers Archiv 427, 317-324 [Medline]
KOWDLEY, G. C., ACKERMAN, S. J., JOHN, J. E., JONES, L. R & MOORMAN, J. R. (1994). Hyperpolarisation-activated chloride currents in Xenopus oocytes. Journal of General Physiology 103, 217-230 [Abstract]
LOEWEN, M. E., MACDONALD, D. W., GASPAR, K. J. & FORSYTH, G. W. (2000). Isoform-specific exon skipping in a variant form of ClC-2. Biochimica et Biophysica Acta 1493, 284-288 [Medline]
MLADINI'C, M., BECCHETTI, A., DIDELON, F., BRADBURY, A. & CHERUBINI, E. (1999). Low expression of the ClC-2 chloride channel during postnatal development: a mechanism for the paradoxical depolarising action of GABA and glycine in the hippocampus. Proceedings of the Royal Society B 266, 1207-1213
PARK, K., ARREOLA, J., BEGENISICH, T. & MELVIN, J. E. (1998). Comparison of voltage-activated Cl- channels in rat parotid acinar cells with ClC-2 in a mammalian expression system. Journal of Membrane Biology 163, 87-95 [Medline]
SMITH, R. L., CLAYTON, G. H., WILCOX, C. L., ESCUDEO, K. W. & STALEY, K. J. (1995). Differential expression of an inwardly rectifying chloride conductance in rat brain neurons: a potential mechanism for cell-specific modulation of postsynaptic inhibition. Journal of Neuroscience 15, 4057-4067 [Abstract]
STALEY, K. (1994). The role of an inwardly rectifying chloride conductance in postsynaptic inhibition. Journal of Neurophysiology 72, 273-284 [Medline]
THIEMANN, A., GRÜNDER, S., PUSCH, M. & JENTSCH, T. J. (1992). A chloride channel widely expressed in epithelial and non-epithelial cells. Nature 356, 57-60 [Medline]

Acknowledgements

We thank Professor Thomas Jentsch and Dr Valentin Stein for providing the ClC-2 knock-out mice, and for their critical reading of the manuscript. This work was supported by the Wellcome Trust (Grants 047180/Z/96 and 055111/Z/98). Dr Craig Smith is a Royal Society Fellow.


This article has been cited by other articles:


Home page
J. Neurosci.Home page
D. Boassa, W. D. Stamer, and A. J. Yool
Ion channel function of aquaporin-1 natively expressed in choroid plexus.
J. Neurosci., July 26, 2006; 26(30): 7811 - 7819.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. A. Zdebik, J. E. Cuffe, M. Bertog, C. Korbmacher, and T. J. Jentsch
Additional Disruption of the ClC-2 Cl- Channel Does Not Exacerbate the Cystic Fibrosis Phenotype of Cystic Fibrosis Transmembrane Conductance Regulator Mouse Models
J. Biol. Chem., May 21, 2004; 279(21): 22276 - 22283.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Catalan, I. Cornejo, C. D. Figueroa, M. I. Niemeyer, F. V. Sepulveda, and L. P. Cid
ClC-2 in guinea pig colon: mRNA, immunolabeling, and functional evidence for surface epithelium localization
Am J Physiol Gastrointest Liver Physiol, October 1, 2002; 283(4): G1004 - G1013.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Nehrke, J. Arreola, H.-V. Nguyen, J. Pilato, L. Richardson, G. Okunade, R. Baggs, G. E. Shull, and J. E. Melvin
Loss of Hyperpolarization-activated Cl- Current in Salivary Acinar Cells from Clcn2 Knockout Mice
J. Biol. Chem., June 21, 2002; 277(26): 23604 - 23611.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
539/2/385    most recent
2001.014548v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Speake, T.
Right arrow Articles by Brown, P. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Speake, T.
Right arrow Articles by Brown, P. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS