| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Journal of Physiology (2002), 540.2, pp. 397-409
© Copyright 2002 The Physiological Society
DOI: 10.1113/jphysiol.2001.013464
1S in skeletal muscle cells |
ABSTRACT |
|---|
 TopAbstract IntroductionMethodsResultsDiscussionReferences |
|---|
Several factors, such as Ca2+, trophic factors and ageing, regulate dihydropyridine-sensitive receptor (DHPR)
(Received 29 October 2001; accepted after revision 29 January 2002)
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The skeletal muscle L-type Ca2+ channel or dihydropyridine-sensitive receptor (DHPR) is located at the infoldings of the sarcolemmal, named T-tubule, and plays a critical role in excitation-contraction coupling (Melzer et al. 1995). The DHPR consists of five subunits (1, 2, 
, 
and 
), 1 being the subunit that senses changes in membrane voltage, forms the Ca2+ conduction pore, binds to dihydropyridines and interacts with the sarcoplasmic reticulum Ca2+ release channel or RyR1 to release Ca2+ from the organelle into the myoplasm in response to membrane depolarization (Block et al. 1988; Schneider, 1994). The DHPR 1, -1S (known also as Cav1.1 11.1, 1S or CaCh1) is encoded in the human chromosome 1q31-32 by the CACNA1S gene and is expressed exclusively in skeletal muscle (Tanabe et al. 1987; Ertel et al. 2000). Besides CACNA1S, the genes CACNA1C (Cav1.2) and CACNA1D (Cav1.3) encode dihydropyridine-sensitive channels expressed in non-muscle tissues. CACNA1C (1C) has three splice variants: Cav1.2a (heart), Cav1.2b (smooth muscle) and Cav1.2c (brain, heart, pituitary and adrenal). CACNA1D (1D) is expressed in brain, pancreas, kidney, ovary and cochlea (Ertel et al. 2000). Besides the L-type, four other Ca2+ channels have been characterized electrophysiologically: T, N (CACNA1B, Cav2.2 or 1B), P/Q (CACNA1A, Cav2.1 or 1A) and R (CACNA1E, Cav2.1 or 1E) (Ertel et al. 2000). The complete amino acid sequence of the 1S subunit is more than 70 % identical to other subunits of the same family (1C and 1D), but less than 40 % identical to subunits in other families (Ertel et al. 2000) .
Due to the pivotal role of the DHPR 1S subunit in excitation-contraction coupling, its expression is of crucial importance for skeletal muscle contraction. DHPR 1S cDNA restores excitation-contraction coupling in dysgenic mice (Tanabe et al. 1988, 1990). DHPR 1S subunit expression is subject to regulation by a number of factors, including ageing (Renganathan et al. 1997a, 1998), development (Chaudari & Beam, 1993), calcium (Renganathan et al. 1999), trophic factors (Renganathan et al. 1997b, 1998; Wang et al. 1999), activity (Saborido et al. 1995) and muscle denervation (Delbono, 1992; Delbono & Stefani, 1993; Pereon et al. 1997). Recently, we have demonstrated that insulin-like growth factor-1 and age regulate DHPR 1S gene transcription in murine skeletal muscle (Zheng et al. 2001). All these factors result in changes to DHPR 1S subunit abundance. Despite the diverse modulation of channel expression, the molecular mechanisms underlying this process are not known. The characterization of the DHPR 1S 5'-flanking region will allow a better understanding of channel transcription and abundance. Although the promoter region has been sequenced for rat cardiac L- (Liu et al. 2000), N- (Kim et al. 1997), P/Q- (Takahashi et al. 1999) and R-type (Yamazaki et al. 1998) voltage-gated Ca2+ channels, the DHPR 1S 5'-flanking sequence has not been reported and the elements involved in gene transcription are not known.
In the present study, we have identified three transcription factors in the DHPR 1S 5'-flanking sequence involved in the regulation of the DHPR 1S subunit expression in muscle cells. Deletion experiments in the core of the consensus sequence for these transcription factors and antisense procedures indicate that GATA-2, CREB and SOX-5 are significant regulators of DHPR 1S transcription and DHPR 1S subunit functional expression in differentiated skeletal muscle cells.
|
METHODS |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell culture
Mouse C2C12 muscle cell line was obtained from American Type Culture Collection (ATCC, Rockville, MD, USA), cultured in standard conditions and maintained in growth medium (Dulbecco's modified Eagle's medium (DMEM) supplemented with 20 % fetal bovine serum, 100 units ml-1 penicillin and 100 µg ml-1 streptomycin). DMEM supplemented with 2 % horse serum, 100 units ml-1 penicillin and 100 µg ml-1 streptomycin was used as differentiation medium. Rat glioma C6 cell line from ATCC was maintained in DMEM supplemented with 10 % fetal bovine serum, 100 units ml-1 penicillin and 100 µg ml-1 streptomycin. DMEM supplemented with 0.5 % fetal bovine serum, 100 units ml-1 penicillin and 100 µg ml-1 streptomycin was used as a differentiation medium.
Charge movement recordings
For charge movement recordings C2C12 cells were plated on glass coverslips and mounted in a small flow-through Lucite chamber positioned on a microscope stage. Myotubes were continuously perfused with the external solution (see below) using a push-pull syringe pump (WPI, Saratoga, FL, USA). Cells were voltage clamped in the whole-cell configuration of the patch clamp technique (Hamill et al. 1981) using an Axopatch-200B amplifier (Axon Instruments, Foster City, CA, USA). Micropipettes were pulled from borosilicate glass capillaries (Boralex) using a Flaming Brown micropipette puller (P97, Sutter Instrument Co., Novato, CA, USA) to obtain electrode resistances ranging from 2 to 4 M
. The composition of the internal (pipette) solution was (mM): 140 Cs-aspartate; 5 Mg-aspartate2, 10 Cs2EGTA and 10 Hepes; pH was adjusted to 7.4 with CsOH. The high concentration of Mg2+ in the pipette solution helped to maintain the preparation stable for a longer time. The external solution contained (mM): 145 TEA-Br, 10 CaCl2, 10 Hepes and 0.001 tetrodotoxin (Beam & Knudson, 1988); pH was adjusted to 7.4 with CsOH. This solution was used for forming gigaohm seals. For charge movement recording, calcium current was blocked with a solution containing (mM): 145 TEA-Br, 2 CaCl2, 0.5 Cd2+, 0.3 La3+, 10 Hepes and 0.001-0.003 tetrodotoxin (Adams et al. 1990).
Whole-cell currents were acquired and filtered at 5 kHz with pClamp 6.04 software (Axon Instruments). A Digidata 1200 interface (Axon Instruments) was used for A-D conversion. Membrane current during a voltage pulse, P, was initially corrected by analogue subtraction of linear components. The remaining linear components were digitally subtracted online using hyperpolarizing control pulses of one-quarter test pulse amplitude (-P/4 procedure; Delbono, 1992). The four control pulses were applied before the test pulse. Charge movements were evoked by 12.5 ms depolarizing voltage steps from the holding potential (- 80 mV) to command potentials ranging from -70 to +70 mV. Intramembrane charge movements were calculated as the integral of the current in response to depolarizing pulses (charge on, Qon) and were expressed per membrane capacitance (in C F-1). The complete blockade of the inward calcium current was verified by the Qon-Qoff linear relationship. Membrane capacitance was calculated as the integral of the transient current in response to a brief hyperpolarizing pulse from -80 (holding potential) to -90 mV.
Transfection of C2C12 cell with antisense oligonucleotides
Sense and antisense oligonucleotides were synthesized and phosphorothioated in three nucleotides at both ends (IDT, Integrated DNA Technologies, Coralville, IA, USA). The following sense and antisense oligonucleotides were used:
sense for GATA-2, 5' GACCATGGAGGTGGC 3';
antisense for GATA-2, 5' GCCACCTCCATGGTC 3';
sense for SOX-5, 5' CTGACCCTGATTTAC 3';
antisense for SOX-5, 5' GTAAATCAGGGTCAG 3';
sense for CREB, 5' GAATCTGGAGCAGAC 3';
antisense for CREB, 5' GTCTGCTCCAGATTC 3'
(Imagawa et al. 1997; Lefebvre et al. 1998; Kim et al. 2001). The GenBank nucleotide sequence GATA-2 (accession number: AB000096), was used to design the sense and antisense oligonucleotides.
The oligonucleotides were transfected into cultured C2C12 myotubes using FuGENE 6 Transfection Reagent (Roche Molecular Biochemicals, Indianapolis, IN, USA) according to the manufacturer. After transfection, the dishes were gently rocked and then incubated in an atmosphere containing 10 % CO2 at 37 °C for 48 h before recordings. For luciferase reporter assay measurements in oligonucleotide-treated C2C12 cells, the Luc/P-1076 construct and oligonucleotides were transfected using CLONfectin and FuGENE6 reagent, respectively.
Rapid amplification of cDNA 5'-end (RACE)
The mouse DHPR 1S cDNA 5'-end was isolated by means of 5'-RACE experiments using a 5'-RACE System Kit (Gibco BRL, Gaithersburg, MD, USA). All the procedures were carried out according to the manufacturer's instructions. Briefly, an oligonucleotide, DHPR 1S-GSP1 (5' TAACTTGTTCCAGAATCA 3') corresponding to the mRNA sequence of mouse DHPR 1S gene (accession number L06234: nucleotides 526-543) was used to synthesize first strand cDNA by reverse transcriptase from mouse skeletal muscle total RNA. After hydrolysis of RNA with RNase Mix and purification, cDNA was subjected to oligo-dC tailing reaction with terminal deoxynucleotidyl transferase. PCR of tailed cDNA was carried out with one abridged anchor primer and DHPR 1S-GSP2 oligonucleotide (5' CAGGTATGCATCCTGATGGA 3', corresponding to nucleotides 451-470) for 35 PCR cycles. The product was subcloned into pCRII vector (Invitrogen Inc., Carlsbad, CA, USA) and sequenced.
Construction of 1S subunit promoter-luciferase fusion plasmid
The p5'5b-R1-6a plasmid containing the 5'-flanking sequence and a portion of the mouse strain SV/129 DHPR 1S gene in the pBluescript KS+ vector (Stratagene Inc., La Jolla, CA, USA) and a small amount of DNA sequence of this clone was provided by Patricia A. Powers (Department of Physiology and Biotechnology Center, University of Wisconsin, Madison, WI, USA). The 1.2 kb 5'-flanking sequence was obtained by PCR using p5'5b-R1-6a as template and the primers: sense 5' GGGGTACCTGAGGGAGGGACGAGGGAAG 3' (-1076 to -1057) and antisense 5' GGGGTACCGGCTTTCCCTGACACCCCTCT 3' (+105 to +126). The PCR product was gel purified, digested with KpnI and ligated into dephosphorylated KpnI digested pGL3-Basic (Promega Co., Madison, WI, USA). The sequence of the 1.2 kb 5'-flanking region was determined and submitted to the GenBank (accession number: AF343753).
Sequential deletion constructs were generated by PCR cloning using specific primers. The correct orientation of the constructs and sequence was confirmed by DNA sequencing (ABI Prism Cycle Sequencing, Perkin Elmer Co., Norwalk, CT, USA).
Transfection of C2C12 and C6 cells with 1S subunit promoter-luciferase fusion plasmid and dual luciferase assay
All of the plasmids used in the present work were purified with QIAfilter (Qiagen Inc., Valencia, CA, USA). Cells were plated (2 
104 cells per dish) in growth medium on 35 mm dishes till reaching 70 % confluence. For cell transfection, 2 µg of each plasmid and 200 ng of the control vector pRL-TK (Promega, WI, USA) were mixed with 2 µg CLONfectin (Clontech, Palo Alto, CA, USA) for 20 min at room temperature. The cells were incubated in DMEM with a mixture of plasmids and CLONfectin at 37 °C for 3 h and then changed to growth medium for 24 h. Cells were induced to differentiate by changing to differentiation medium and cultured for 1-7 days. Cell lysis was induced using a passive lysis buffer for dual luciferase reporter assay (Promega). Luciferase and renilla activity were measured using a luminometer (Turner 20E, Sunnyvale, CA, USA) and expressed as arbitrary units. Values for the luciferase assay were normalized to renilla luciferase activity to minimize differences in transfection efficiency for each experiment.
Site-directed mutagenesis of Luc/P-146 construct
The Luc/P-146 construct was mutated using the GeneEditor in vitro site-directed mutagenesis system (Promega). The specific primers used for deletion of core nucleotides in transcription factor binding sites in this system were:
for TATA-del,
5' GGGCAGCAGGGGCTTTACTCGCTGGGAGC 3';
for CREB-del,
5' TCCAGTCCAGCCGGATCCCCATCTGCCCC 3';
for MZF1-del,
5' CCTCGGGGGCAGATGTGTCACCGGCGGAC 3';
and for GATA-2-del,
5' AGCCGGTGACATCCCTGCCCCCGAGGAGGC 3'.
After alkaline denaturation of Luc/P-146 construct, the DNA template was hybridized with phosphorylated primers and bottom or top strand selection primer. Mutant strand was synthesized by T4 DNA polymerase and T4 DNA ligase. The mutant reactions were transformed into BMH 71-18 muts competent cells, which were selected by GeneEditor antibiotic and ampicillin once plated in LB agar. The mutant clones were transformed into JM109 competent cells and confirmed by DNA sequence.
RNase protection assay
RNase protection assays (RPA) were used to confirm the site of transcription initiation and to measure DHPR 1S mRNA concentrations in C2C12 cells and skeletal muscle. Total RNA extraction from FVB (Friend virus B-type susceptible) mouse hindlimb skeletal muscle and C2C12 cells was performed with TRI reagent RNA extraction solution (Molecular Research Center, Cincinnati, OH, USA). The probe to determine the transcription start site was cloned by PCR reaction using p5'5b-R1-6A DNA template. The sense and antisense primers were 5' AAGTCACCCCTTTACACCCA 3' (-163 to -144) and 5' ACTGAGCCTATCCTGCTGAG 3' (+20 to +39) (see Fig. 1), respectively. The PCR fragment was gel purified (Qiagen, Valencia, CA, USA) and ligated to pCRII vector (Invitrogen, Carlsbad, CA, USA). The plasmid was confirmed by DNA sequencing and linearized with KpnI (Promega). In vitro transcription probe labelling was performed with SP6 RNA polymerase (Maxiscript Kit, Ambion Inc., Austin, TX, USA) and 32P-UTP (ICN Pharmaceuticals Inc., Costa Mesa, CA, USA). The reaction was gel purified and labelled probe (2 104 c.p.m.) was hybridized at 56 °C overnight with 25 µg total RNA from mouse skeletal muscle. After RNase digestion, the protected fragment was separated on a denaturing polyacrylamide sequence gel and exposed to X-ray film. The sequence reaction of primer and control DNA M13mp18 supplied with Sequenase 2.0 DNA sequencing kit (Amersham Pharmacia Biotech, Cleveland, OH, USA) and radiolabelled RNA century Marker (Ambion, Austin, TX, USA) were loaded on the same gel as molecular weight markers.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 1. Nucleotide sequence of the mouse DHPR The transcription initiation site is indicated as +1. The position +128/130 corresponds to the translation start site. The nucleotide sequences for transcription factor binding sites are illustrated. TATA-like box and CREB, GATA-2, SOX-5, among other consensus regulatory elements, are indicated. | ||
RPA was performed with total RNA extracted from skeletal muscle and C2C12 cells. The DNA template for detecting DHPR 1S mRNA (accession number: L06234: 1461-1600 bp) in skeletal muscle and C2C12 cells was cloned by RT-PCR method in pCRII vector and linearized with BsrDI (New England Biolabs Inc., Beverly, MA, USA). DHPR 1S probe was labelled with 32P-UTP by in vitro transcription. Both the pTRI-RNA-28S antisense control template and the RNA century marker template set (Ambion) were also labelled by the in vitro transcription method using a different dilution of 32P-UTP.
Statistical analysis
Data were analysed using Student's t test or analysis of variance (ANOVA). A value of P < 0.05 was considered significant. Data are expressed as means ± S.E.M. with the number of observations (n).
|
RESULTS |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
To characterize the elements involved in the regulation of DHPR 1S expression, we cloned the 5'-flanking sequence of the DHPR 1S gene, identified the transcription factors critical for the expression of DHPR 1S promoter-luciferase fusion plasmids and determined the functional effects of antisense oligonucleotides for these transcription factors.
Structure of the 5'-flanking sequence of the DHPR 1S gene
The 1.2 kb of the skeletal muscle L-type Ca2+ channel or DHPR 1S 5'-flanking region includes the first exon of the mouse skeletal muscle 1 subunit cDNA. The transcription start site was initially determined by 5'RACE using a 500 bp fragment subcloned into pCRII and sequenced (see Methods). Subsequently, the transcription start site was defined by RPA (Fig. 2). The results indicate that a single transcription start site is located 129 bp upstream of the translation initiation codon. The 39 bp protected RNA fragment shown in Fig. 2 resulted from hybridization to a complementary sequence in the sample RNA. After hybridization, the mixture was treated with ribonucleases to degrade unhybridized probe. Specific hybridization to the sample RNA 'protected' the 39 bp fragment (+1 to +39 in Fig. 1) from enzymatic digestion. The 202 bp PCR probe was generated using the sense and antisense primers described above. This PCR fragment generated from the genomic DNA is complementary to both the 5' untranslated region of the mouse DHPR 1S mRNA sequence (accession number: L06234, 11-30 bp) and the 5'-flanking region. The direction of the antisense RNA probe is from +39 to -163 (202 nucleotides). According to either the genomic or the mRNA DHPR 1S sequence there is 87 bp (or 90 bp including ATG) from the antisense primer to the initiating ATG. Therefore, the size of the protected fragment (determined by comparison to molecular standard marker and DNA sequence), plus 87 or 90 bp, results in the position of the transcription start site (126 nucleotides upstream of the initiating ATG or 129 bp including ATG). The 5'-flanking sequence was analysed for the presence of motifs such as transcription factor binding sites using Tfsearch 1.3 software (Barnhart et al. 1998).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 2. Determination of the mouse DHPR A protected fragment was obtained using antisense probe to hybridize to total RNA from skeletal muscle (lane RPA Mu), yeast tRNA (lane RPA Yt) as negative RNA control, and without RNA (lane RPA Pb). Lanes G, A, T and C in the DNA sequence show the control M13mp18 vector sequenced with control primer (Sequenase Sequence Kit, Amersham). | ||
Figure 1 shows a TATA-like box (TAATTTTA) and consensus sequences for several transcription factors reported to be involved in key signalling pathways for muscle function. The TATA-like box, which positions RNA polymerase II for transcription initiation located at position -46 to -39, is located upstream of the transcription start site, as expected. The role of this box was established in experiments in which DHPR 1S gene transcription was abolished as a result of TATA-like region deletion (see below). The CG-repeat sequence (CCCAGCCC), found at position -148 to -139 represents a binding site for SP1. GATA-2 and CREB have been found to be directly related to the muscle cell differentiation program (Puri et al. 1997; Musaro et al. 1999). A GA-dinucleotide repeat region is found from base -924 to -873. This repeat enhances activity of the SV40 promoter (Mu & Burt, 1999). A 76 bp long GT-dinucleotide repeat region is found from base -1000 to -924. Although dinucleotide repeats have been associated with some genes (Furuta et al. 1999), their functional significance has not been determined.
Analysis of mouse L-type Ca2+ channel to DHPR 1 subunit promoter in muscle cells
Repeated RPA analysis revealed that a 140 bp protected fragment corresponding to DHPR 1S was present in total RNA samples from C2C12 myotubes as well as in a pool of young adult (5 month old) mouse skeletal muscles, but not in C2C12 cell myoblasts (Fig. 3). DHPR 1S expression in C2C12 myoblasts and myotubes was recorded in eight experiments, in which proliferating and differentiated cells corresponding to the same cell passage were analysed. These results support the idea that DHPR 1S mRNA is expressed only in differentiated C2C12 myotubes and in mouse skeletal muscle, and that differentiation provides the conditions for DHPR 1S expression.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 3. Detection of DHPR A 140 bp protected fragment obtained by specific antisense RNA probe hybridized to the same amount of total RNA (25 µg) from mouse skeletal muscle, C2C12 cell myoblasts in growth medium and C2C12 cell myotubes after 5 days in differentiation medium. The relative amount of total RNA loaded for each sample is indicated by the signal resulting from the hybridization of the 115 bp protected fragment for 28S rRNA in the same reaction. | ||
To analyse the DHPR 1S 5'-flanking region elements that may play a role in controlling DHPR 1 subunit transcription, a gene chimera was created by cloning the 5'-flanking sequence and a portion of exon 1 of the DHPR 1 subunit (-1076 to +129) upstream of a luciferase reporter gene. Chimera deletion constructs were made starting at the 5'-end of the chimera and progressing in the 3' direction. Full and deletion constructs were subcloned into pGL3/basic plasmid and transfected into mouse and rat skeletal muscle C2C12 cell line, respectively. The pGL3/basic vector containing the luciferase reporter gene and lacking the DHPR 1S DNA was used as a control. Figure 4 illustrates the full-length 5'-flanking region (-1076 to +128) luciferase reporter gene and 12 deletion constructs. The most distal 5'-end nucleotide from the transcription start site identifies each construct. These 13 constructs were studied simultaneously in several experiments.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 4. Schematic representation of DHPR Deletions at 5' and 3' ends of 5'-flanking promoter region of DHPR | ||
The expression of Luc/P-1076 is clearly dependent on cell differentiation and subtype. Figure 5A shows results of eight different experiments in which luciferase activity was recorded daily for 7 days. Luciferase activity increased to day 5 in differentiation medium and then declined on the following day. After day 5 the signal decayed significantly. The decrease in the signal after day 5 was clearly associated with dissociation of the cells from the bottom of the dish. Figure 5B shows that Luc/P-1076 expression depends on the cell subtype used for transfection. The Luc/P-1076 construct was not expressed in myoblasts or C6 cells, whereas the luciferase signal was significantly greater in C2C12 myotubes than in the glial cell line C6 (P < 0.001).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 5. Expression of the Luc/P-1076 construct in C2C12 myoblast and myotubes A, luciferase activity of the Luc/P-1076 construct transfected in C2C12 cells after different times in differentiation medium. Results were normalized to recordings in C2C12 cells incubated for 5 days in differentiation medium. B, luciferase activity in C2C12 myoblasts and myotubes and C6 glial cells transfected with the Luc/P-1076 construct. Luciferase assay was normalized to renilla activity. | ||
Figure 6 shows the relative luciferase activity recorded in the 13 5'-flanking promoters-luciferase gene constructs transfected simultaneously in C2C12 cells. Luciferase activity is much greater for Luc/P-756 and Luc/P-724 than for any of the other constructs (P < 0.001), which indicates the presence of a repressor element in the Luc/P-1076 to Luc/P-756 region. The activity of Luc/P-696, Luc/P-280, Luc/P-196 and Luc/P-146 was significantly lower than that exhibited by the constructs from Luc/P-1076 to Luc/P-724, but no significant difference was found among them. Two constructs, Luc/P-1076/-280, which lacks the -280 to +128 region, and Luc/P-26, showed negligible levels of luciferase activity.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 6. Luciferase activity of the DHPR Luciferase activity (relative to Luc/P-1076) recorded in 5 day differentiated C2C12 cells transfected with the constructs illustrated in Fig. 4. | ||
Role of GATA-2 and CREB in DHPR 1S transcription
To determine the role of specific transcription factors in DHPR 1S transcription, deletion constructs of Luc/P-146 were produced. Figure 7 shows the relative luciferase activity for four different constructs consisting of 4 bp deletions at the centre of TATA, GATA-2, MZF1 and CREB binding site sequences, respectively. Deletion of the TATA-like box completely abolishes luciferase activity (P < 0.001), which supports the conclusion that this box acts as the binding site for RNA polymerase II in the DHPR 1S promoter. Deletions in the binding sequence for GATA-2 and CREB led to significant reductions in luciferase activity (P < 0.01), underscoring the importance of these factors in DHPR 1S transcription. No role in muscle function has been described for the MZF1 transcription factor. A deletion of the MZF1 binding site did not significantly affect luciferase activity compared with Luc/P-146 (P = 0.32).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 7. Relative luciferase activity in C2C12 cells expressing Luc/P-146 and transcription factor binding site mutants A, four base pair deletions in the nucleotide binding sequence for CREB, GATA-2 and MZF1 and in TATA-like box. B, relative luciferase activity in C2C12 myotubes (5 days in differentiation medium) expressing Luc/P-146 and TATA, GATA-2, MZF1 and CREB mutants. Results are normalized to the signal recorded in cells expressing Luc/P-146. | ||
Functional effects of antisense oligonucleotides for GATA-2, CREB and SOX-5
Figure 6 suggests that, in addition to GATA-2 and CREB, there is an enhancer element located upstream in the 5'-flanking region that results in the high luciferase activity recorded for Luc/P-756 and Luc/P-724 constructs. This enhancer must be between -696 and -724, a fragment that includes the SOX-5 and HFH2 response elements shown in Fig. 1. HFH2 has been reported to act as a repressor, whereas SOX-5 is an enhancer in other systems (Lefebvre et al. 1998; Pohl & Knochel, 2001). Therefore, we focused the next series of experiments on SOX-5. To explore the role of SOX-5 in DHPR 1S expression we used the antisense oligonucleotides technique directed against the SOX-5 gene (Imagawa et al. 1997; Piedras-Rentería & Tsien, 1998) instead of the deletion approach shown in Fig. 7 due to the 90 % overlap between the consensus sequences for HFH2 and SOX-5 (see Fig. 1).
As a functional expression of the DHPR 1 subunit we recorded charge movement in differentiated myotubes incubated for 36-48 h in sense or antisense oligonucleotides for SOX-5 and the results were compared to records in control C2C12 cells not incubated in sense or antisense oligonucleotides. Although DHPR 1 subunits account for 70 % of the total nonlinear capacity of the membrane (Adams et al. 1990), we preferred the recording of charge movement to calcium current due to the direct relationship between the integral of charge movement and the levels of channel expression in the sarcolemma (Ríos & Pizarro, 1991) .
Figure 8A shows the Qon-voltage relationship for the cells treated with sense or antisense for SOX-5 and control C2C12 cells. For analysis of the voltage dependence of the charge, data points were fitted to a Boltzmann equation of the form:
 |
View larger version [in this window] [in a new window] |
|
|
Figure 8. Effects of sense and antisense oligonucleotides against SOX-5 on charge movement A, Qon-voltage relationship for C2C12 cells treated with sense or antisense oligonucleotides for SOX-5 and control C2C12 cells. For the analysis of the voltage dependence of the charge, data points were fitted to a Boltzmann equation (see text). The best fitting parameters are shown in Table 1. B-D illustrates charge movement records in the -30 to +30 mV range. Antisense oligonucleotide for SOX-5 significantly decreases the maximum charge movement at voltages more positive than 20 mV (P < 0.05 from 30 to 70 mV). Data for C2C12 cells exposed to sense oligonucleotide for SOX-5 for 2 days and control were not significantly different. The dotted line represents the baseline. Data points represent the mean ± S.E.M. of at least 15 cells per group (see Table 1). | ||
Qon = Qmax/(1 + exp[VQ1/2 - Vm]/K), (1)
where Qmax is the maximum charge, Vm is the membrane potential, VQ1/2 is the charge movement half-activation potential, and K is the steepness of the curve. The best fitting parameters for Qmax, VQ1/2 and K recorded in C2C12 cells in the presence of either sense or antisense oligonucleotides and control are shown in Table 1. Figure 8B-D illustrates charge movement in the -30 to +30 mV range corresponding to the steepest part of the curve. It is apparent that the antisense nucleotide for SOX-5 significantly decreases the maximum charge movement at voltages more positive than 20 mV without affecting the voltage distribution of the charge. No significant differences were found between C2C12 cells exposed to sense oligonucleotide for SOX-5 and control.
A similar approach was used for GATA-2 and CREB. Figure 9 and Figure 10 show the Qon-voltage relationship for C2C12 cells incubated in sense or antisense oligonucleotides for GATA-2 and CREB, respectively. The data and fitting curve to experiments in nontransfected C2C12 cells are included in Fig. 9A and Fig. 10A. Antisense either for GATA-2 or CREB significantly reduced the maximum charge movement without affecting the voltage distribution of the charge as shown in Table 1.
 |
View larger version [in this window] [in a new window] |
|
|
Figure 9. Effects of sense and antisense oligonucleotides against GATA-2 on charge movement A, Qon-voltage relationship for C2C12 cells treated with sense or antisense oligonucleotides for GATA-2. The continuous line represents the fitting curve to control experiments in C2C12 cells. For the analysis of the voltage dependence of the charge, data points were fitted to a Boltzmann equation (see text). The best fitting parameters are shown in Table 1. B and C illustrate charge movement records in the -30 to +30 mV range. Antisense oligonucleotide for GATA-2 significantly decreases the maximum charge movement at voltages more positive than 20 mV (P < 0.05 from 30 to 70 mV). Data for C2C12 cells exposed to sense oligonucleotide for GATA-2 for 2 days and control were not significantly different. The dotted line represents the baseline. Data points represent the mean ± S.E.M. of at least 15 cells per group (see Table 1). | ||
 |
View larger version [in this window] [in a new window] |
|
|
Figure 10. Effects of sense and antisense oligonucleotides against CREB on charge movement A, Qon-voltage relationship for C2C12 cells treated with sense or antisense oligonucleotides for CREB. The continuous line represents the fitting curve to control experiments in C2C12 cells. For the analysis of the voltage dependence of the charge, data points were fitted to a Boltzmann equation (see text). The best fitting parameters are shown in Table 1. B and C illustrate charge movement records in the -30 to +30 mV range. Antisense oligonucleotide for CREB significantly decreases the maximum charge movement at voltages more positive than 20 mV (P < 0.05 from 30 to 70 mV). Data for C2C12 cells exposed to sense oligonucleotide for CREB for 2 days and control were not significantly different. The dotted line represents the baseline. Data points represent the mean ± S.E.M. of at least 15 cells per group (see Table 1). | ||
Effect of antisense oligonucleotide for SOX-5, GATA-2 and CREB on DHPR 1S expression
To confirm the role of SOX-5, GATA2 and CREB in DHPR 1S expression, C2C12 cells were transfected with the Luc/P-1076 construct and then incubated with sense or antisense oligonucleotide for SOX-5. Three concentrations of the oligonucleotides were tested, 100 nM, 400 nM and 1 µM. Figure 11 shows the values normalized to the maximum luminescence signal recorded. The luminescence for cells incubated in 1 µM of any of the three antisense oligonucleotides or 400 nM CREB antisense was significantly lower than that recorded in the remaining groups (P < 0.05). Experiments with sense oligonucleotides did not differ significantly (P < 0.05).
 |
View larger version [in this window] [in a new window] |
|
|
Figure 11. Effect of antisense oligonucleotide for SOX-5, GATA-2 and CREB on DHPR Luciferase activity normalized to the maximum luminescence signal recorded in transfected C2C12 cells with the Luc/P-1076 construct and incubated with sense or antisense oligonucleotide for SOX-5, GATA-2 or CREB. Three concentrations of sense and antisense oligonucleotides (100 nM, 400 nM and 1 µM) were tested. The asterisks denote statistically significant differences (P < 0.05). Values are means ± S.E.M. of 4 experiments per group. | ||
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cloning and characterization of the 5'-flanking region of the DHPR 1S gene
The present study reports the cloning of the mouse L-type Ca2+ channel or DHPR 1S subunit gene 5'-flanking sequence and characterization of the specific sequences necessary for basal transcription and control of DHPR 1S expression. Sequence analysis revealed that the 5'-flanking region has a TATA-like box and contains elements for binding of general transcription factors. A single transcription start site was identified in the DHPR 1S subunit, in contrast to the 1C subunit, which exhibits multiple transcription start sites (Liu et al. 2000). Deletion analysis of the 5'-flanking region in the DHPR-luciferase fusion gene indicates that cis-acting regulatory elements in the proximal 96 bp appear to be essential for skeletal muscle cell-specific expression of the DHPR 1S subunit gene. The results of the present study support the idea that DHPR 1S mRNA is only expressed in mouse skeletal muscle and differentiated C2C12 myotubes but not in undifferentiated muscle cells or myoblasts. Muscle differentiation may be characterized by transcriptional activation of muscle-specific genes that could then provide the conditions for DHPR 1S expression. In particular, the muscle regulatory factor (MRF), myocytes enhancer factor 2 (MEF2) families, Pax-3 and muscle LIM protein (MLP) have been implicated in establishing the myogenic lineage as well as controlling terminal differentiation (Ludolph & Konieczny, 1995).
Deletion of the first 320 bp from the 5'-end of the promoter leads to a significant increase in luciferase activity, but a further deletion of 60 bp leads to a significant decrease. Conserved sequences for CdxA (-1074 to -1080), STATx (-1001 to -1009), p300 (-994 to -1007), MZF1 (-816 to -823 and -776 to -783) and AML-1a (-772 to -777) transcription factors are found in the first 320 nucleotides sequence of the 5'-end flanking region. p300 has been found as a factor for MyoD-dependent cell cycle arrest and muscle-specific gene transcription by directly modulating transcription as a result of interaction with components of the basal transcriptional machinery (Puri et al. 1997). A role for the dinucleotide repeat sequences (GT, GA) in DHPR 1S expression cannot be established or ruled out with the data currently available.
Role of CREB and GATA-2 consensus sequences in L-type Ca2+ channel or DHPR 1S expression
Transfection of the deletion construct Luc/P-146 in C2C12 cells resulted in luciferase activity that was not significantly different from that exhibited by the longer 5'-flanking region constructs Luc/P-196, Luc/P-280 and Luc/P-696. However, a promoter containing a deletion of the region -280 to +128 or the -26 to +128 promoter resulted in an almost complete abolition of the luciferase activity. To define the consensus sequences critical for DHPR 1S expression in the 146 bp upstream of the transcription start site, deletion constructs in the central four nucleotides of the consensus sequence for CREB, GATA-2, MZF1 and TATA-like box (TF) were created. TF resulted in a level of luciferase activity insignificantly different from the construct lacking any 5'-DHPR 1S flanking region (Luc/pGL-3-basic). This would be expected if the TATA-like box represents the binding site for TATA-binding protein (TBP) and RNA polymerase II (Nikolov et al. 1992). Ablation of one of the myeloid zinc finger consensus MZF-1 binding sequences did not significantly modify luciferase activity. The function of the remaining MZF-1 binding sequences identified in the 5'-DHPR 1S flanking region has not been explored. Deletions in the consensus binding sequences for CREB and GATA-2 resulted in significant decreases in luciferase activity. Roles for GATA-2 in skeletal myocyte hypertrophy and for CREB as a 'co-activator' able to modulate transcription have been reported (Musaro et al. 1999). The role of GATA-2 and CREB transcription factors in DHPR 1S transcription has not been described before.
Effects of SOX-5, GATA-2 and CREB on charge movement and DHPR 1S expression
Charge movements are currents arising from movement of charge molecules dwelling in the membrane (Schneider & Chandler, 1973). The integral of the recordings is directly related to the number of moving charged molecules (Ríos & Pizarro, 1991). Although several voltage-gated channels contribute to charge movement, these recordings represent mainly the activity of the DHPR 1 subunit (Adams et al. 1990). In these experiments we have seen a significant effect of antisense oligonucleotides against SOX-5, GATA-2 and CREB on charge movements, an indication that the number of DHPR 1 subunits expressed in the sarcolemma is downregulated. Whether antisense oligonucleotides act on other skeletal muscle voltage-gated ion channels is not known. This possibility cannot be ruled out at the present time.
Deletion experiments also show that GATA-2 and CREB are directly related to DHPR 1S expression. However, this approach was not applied to SOX-5 due to the overlap of the consensus sequence with HFH2 (see above). Further confirmation of the effects of SOX-5, GATA-2 and CREB on DHPR 1S was obtained by analysis of C2C12 cells expressing Luc/P-1076 and transfected with sense or antisense oligonucleotides for SOX-5, GATA-2 and CREB. The significant decrease in luciferase activity induced by 400 nM and 1 µM antisense to CREB and 1 µM antisense to SOX-5 and GATA-2 support the concept that SOX-5 as well as GATA-2 and CREB regulate the expression of DHPR 1S in skeletal muscle cells.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
| ADAMS, B. A., TANABE, T., MIKAMI, A., NUMA, S. & BEAM, K. G. (1990). Intramembrane charge movement restored in dysgenic skeletal muscle by injection of dihydropyridine receptor cDNAs. Nature 346, 569-572 | [Medline] |
| BARNHART, K. M., HARTIKKA, J., MANTHORPE, M., NORMAN, J. & HOBART, P. (1998). Enhancer and promoter chimeras in plasmids designed for intramuscular injection: a comparative in vivo and in vitro study. Human Gene Therapy 9, 2545-2553 | [Medline] |
| BEAM, K. G. & KNUDSON, C. M. (1988). Calcium currents in embryonic and neonatal mammalian skeletal muscle. Journal of General Physiology 91, 781-798 | [Abstract] |
| BLOCK, B. A., IMAGAWA, T., CAMPBELL, K. P. & FRANZINI-ARMSTRONG, C. (1988). Structural evidence for direct interaction between the molecular components of the transverse tubule/sarcoplasmic reticulum junction in skeletal muscle. Journal of Cell Biology 107, 2587-2600 | [Abstract] |
| CHAUDHARI, N. & BEAM, K. G. (1993). mRNA for cardiac calcium channel is expressed during development of skeletal muscle. Developmental Biology 155, 507-515 | [Medline] |
| DELBONO, O. (1992). Calcium current activation and charge movement in denervated mammalian skeletal muscle fibres. Journal of Physiology 451, 187-203 | [Abstract] |
| DELBONO, O. & STEFANI, E. (1993). Calcium current inactivation in denervated rat skeletal muscle fibres. Journal of Physiology 460, 173-183 | [Abstract] |
| ERTEL, E. A., CAMPBELL, K. P., HARPOLD, M. M., HOFMANN, F., MORI, Y., PEREZ-REYES, E., SCHWARTZ, A., SNUTCH, T. P., TANABE, T., BIRNBAUMER, L., TSIEN, R. W. & CATERALL, W. A. (2000). Nomenclature of voltage-gated calcium channels. Neuron 25, 533-535 | [Medline] |
| FURUTA, K., MISAO, S., TAKAHASHI, K., TAGAYA, T., FUKUZAWA, Y., ISHIKAWA, T., YOSHIOKA, K. & KAKUMU, S. (1999). Gene mutation of transforming growth factor beta1 type II receptor in hepatocellular carcinoma. International Journal of Cancer 81, 851-853 | |
| HAMILL, O. P., MARTY, A., NEHER, E., SAKMANN, B. & SIGWORTH, F. J. (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell-free patches. Pflügers Archiv 391, 85-100 | [Medline] |
| IMAGAWA, S., YAMAMOTO, M. & MIURA, Y. (1997). Negative regulation of the erythropoietin gene expression by the GATA transcription factors. Blood 89, 1430-1439 | [Abstract/Full Text] |
| KIM, D. S., JUNG, H. H., PARK, S. H. & CHIN, H. (1997). Isolation and characterization of the 5'-upstream region of the human N-type calcium channel alpha1B subunit gene. Chromosomal localization and promoter analysis. Journal of Biological Chemistry 272, 5098-5104 | [Abstract/Full Text] |
| KIM, J.-G., AMANO, O., WAKAYAMA, T., TAKAHAGI, H. & ISEKI, S. (2001). The role of cyclic AMP response element-binding protein in testosterone-induced differentiation of granular convoluted tubule cells in the rat submandibular gland. Archives of Oral Biology 46, 495-507 | [Medline] |
| LEFEBVRE, V., LI, P. & DE CROMBRUGGHE, B. (1998). A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO Journal 17, 5718-5733 | [Abstract/Full Text] |
| LIU, L., FAN, Q. I., EL-ZARU, M. R., VANDERPOOL, K., HINES, R. N. & MARSH, J. D. (2000). Regulation of DHP receptor expression by elements in the 5'-flanking sequence. American Journal of Physiology 278, H1153-1162 | |
| LUDOLPH, D. C. & KONIECZNY, S. F. (1995). Transcription factor families: muscling in on the myogenic program. FASEB Journal 9, 1595-1604 | [Abstract] |
| MELZER, W., HERRMANN-FRANK, A. & LUTTGAU, H. C. (1995). The role of Ca2+ ions in excitation-contraction coupling of skeletal muscle fibres. Biochimica et Biophysica Acta 1241, 59-116 | [Medline] |
| MU, W. & BURT, D. R. (1999). The mouse GABA-A receptor alpha-3 subunit gene and promoter. Molecular Brain Research 73, 172-180 | [Medline] |
| MUSARO, A., MCCULLAGH, K. J., NAYA, F. J., OLSON, E. N. & ROSENTHAL, N. (1999). IGF-1 induces skeletal myocyte hypertrophy through calcineurin in association with GATA-2 and NF-ATc1. Nature 400, 581-585 | [Medline] |
| NIKOLOV, D. B., HU, S. H., LU, J., GASEN, A., HOFFMAN, A., HORIKOSHI, M., CHU, N. H., ROEDER, R. G. & BURLEY, S. K. (1992). Crystal structure of TFIID TATA-box binding protein. Nature 360, 40-46 | [Medline] |
| PEREON, Y., SORRENTINO, V., DETTBARN, C., NOIREAUD, J. & PALADE, P. (1997). Dihydropyridine receptor and ryanodine receptor gene expression in long-term denervated rat muscles. Biochemical and Biophysical Research Communications 240, 612-617 | [Medline] |
| PIEDRAS-RENTERÍA, E. S. & TSIEN, R. W. (1998). Antisense oligonucleotides against alpha1E reduce R-type calcium currents in cerebellar granule cells. Proceedings of the National Academy of Sciences of the USA 95, 7760-7765 | [Abstract/Full Text] |
| POHL, B. S. & KNOCHEL, W. (2001). Overexpression of the transcriptional repressor FoxD3 prevents neural crest formation in Xenopus embryos. Mechanisms of Development 103, 93-106 | [Medline] |
| PURI, P. L., AVANTAGGIATI, M. L., BALSANO, C., SANG, N., GRAESSMANN, A., GIORDANO, A. & LEVRERO, M. (1997). p300 is required for MyoD-dependent cell cycle arrest and muscle-specific gene transcription. EMBO Journal 16, 369-383 | [Abstract/Full Text] |
| RENGANATHAN, M., MESSI, M. L. & DELBONO, O. (1997a). Dihydropyridine receptor-ryanodine receptor uncoupling in aged skeletal muscle. Journal of Membrane Biology 157, 247-253 | [Medline] |
| RENGANATHAN, M., MESSI, M. L. & DELBONO, O. (1998). Overexpression of IGF-1 exclusively in skeletal muscle prevents age-related decline in the number of dihydropyridine receptors. Journal of Biological Chemistry 273, 28 845-28 851 | [Abstract/Full Text] |
| RENGANATHAN, M., MESSI, M. L., SCHWARTZ, R. & DELBONO, O. (1997b). Overexpression of hIGF-1 exclusively in skeletal muscle increases the number of dihydropyridine receptors in adult transgenic mice. FEBS Letters 417, 13-16 | [Medline] |
| RENGANATHAN, M., WANG, Z. M., MESSI, M. L. & DELBONO, O. (1999). Calcium regulates L-type Ca2+ channel expression in rat skeletal muscle cells. Pflügers Archiv 438, 649-655 | [Medline] |
| RÍOS, E. & PIZARRO, G. (1991). Voltage sensor of excitation-contraction coupling in skeletal muscle. Physiological Reviews 71, 849-908 | [Medline] |
| SABORIDO, A., MOLANO, F., MORO, G. & MEGIAS, A. (1995). Regulation of dihydropyridine receptor levels in skeletal and cardiac muscle by exercise training. Pflügers Archiv 429, 364-369 | [Medline] |
| SCHNEIDER, M. F. (1994). Control of calcium release in functioning skeletal muscle fibers. Annual Review of Physiology 56, 463-484 | [Medline] |
| SCHNEIDER, M. F. & CHANDLER, W. K. (1973). Voltage dependent charge movement of skeletal muscle: a possible step in excitation-contraction coupling. Nature 242, 244-246 | [Medline] |
| TAKAHASHI, E., MURATA, Y., OKI, T., MIYAMOTO, N., MORI, Y., TAKADA, N., WANIFUCHI, H., WANIFUCHI, N., YAGAMI, K., NIIDOME, T., TANAKA, I. & KATAYAMA, K . (1999). Isolation and functional characterization of the 5'-upstream region of mouse P/Q-type Ca2+ channel alpha1A subunit gene. Biochemical and Biophysical Research Communications 260, 54-59 | [Medline] |
| TANABE, T., BEAM, K. G., ADAMS, B. A., NIIDOME, T. & NUMA, S. (1990). Regions of the skeletal muscle dihydropyridine receptor critical for excitation-contraction coupling. Nature 346, 567-569 | [Medline] |
| TANABE, T., BEAM, K. G., POWELL, J. A. & NUMA, S. (1988). Restoration of excitation-contraction coupling and slow calcium current in dysgenic muscle by dihydropyridine receptor complementary DNA. Nature 336, 134-139 | [Medline] |
| TANABE, T., TAKESHIMA, H., MIKAMI, A., FLOCKERZI, V., TAKAHASHI, H., KANGAWA, K., KOJIMA, M., MATSUO, H., HIROSE, T. & NUMA, S. (1987). Primary structure of the receptor for calcium channel blockers from skeletal muscle. Nature 328, 313-318 | [Medline] |
| WANG, Z. M., MESSI, M. L. & DELBONO, O. (1999). Patch-clamp recording of charge movement, Ca2+ current and Ca2+ transients in adult skeletal muscle fibers. Biophysical Journal 77, 2709-2716 | [Abstract/Full Text] |
| YAMAZAKI, K., OKI, T. & TANAKA, I. (1998). Cloning of 5'-flanking region and a polymorphic CTT trinucleotide repeat within 5'-untranslated region of mouse R-type calcium channel alpha1-subunit (Cchra1) gene, and its genetic mapping. Gene 214, 199-204 | [Medline] |
| ZHENG, Z., MESSI, M. L. & DELBONO, O. (2001). Age-dependent IGF-1 regulation of gene transcription of Ca2+ channels in skeletal muscle. Mechanisms of Aging and Development 122, 373-384 |
Acknowledgements
We thank Dr Patricia A. Powers for critically reading the manuscript and for helpful suggestions and Dr Veronique Lefebvre, Department of Biomedical Engineering of Lerner Research Institute, Cleveland Clinic Foundation, for kindly providing us with the plasmid containing L-Sox5 cDNA. This work was supported by the National Institutes of Health/National Institute on Aging grants AG/AR18755, AG13934, AG10484 and AG15820 to Osvaldo Delbono.
This article has been cited by other articles:
|
|
 |
|
  B. A. Danalache, J. Paquin, W. Donghao, R. Grygorczyk, J. C. Moore, C. L. Mummery, J. Gutkowska, and M. Jankowski Nitric Oxide Signaling in Oxytocin-Mediated Cardiomyogenesis Stem Cells, March 1, 2007; 25(3): 679 - 688. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Gouadon, R. P. Schuhmeier, D. Ursu, A. A. Anderson, S. Treves, F. Zorzato, F. Lehmann-Horn, and W. Melzer A possible role of the junctional face protein JP-45 in modulating Ca2+ release in skeletal muscle J. Physiol., April 1, 2006; 572(1): 269 - 280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Payne, Z. Zheng, E. Gonzalez, Z.-M. Wang, M. L. Messi, and O. Delbono External Ca2+-dependent excitation-contraction coupling in a population of ageing mouse skeletal muscle fibres J. Physiol., October 1, 2004; 560(1): 137 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Zheng, Z.-M. Wang, and O. Delbono Insulin-like Growth Factor-1 Increases Skeletal Muscle Dihydropyridine Receptor alpha 1S Transcriptional Activity by Acting on the cAMP-response Element-binding Protein Element of the Promoter Region J. Biol. Chem., December 20, 2002; 277(52): 50535 - 50542. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
