HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 540/2/425    most recent 2001.013847v1 Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Khiroug, S. S. Articles by Yakel, J. L. Search for Related Content PubMed PubMed Citation Articles by Khiroug, S. S. Articles by Yakel, J. L.

Journal of Physiology (2002), 540.2, pp. 425-434
© Copyright 2002 The Physiological Society
DOI: 10.1113/jphysiol.2001.013847

Rat nicotinic ACh receptor 7 and 2 subunits co-assemble to form functional heteromeric nicotinic receptor channels

Serguei S. Khiroug, Patricia C. Harkness*, Patricia W. Lamb, Sterling N. Sudweeks, Leonard Khiroug, Neil S. Millar* and Jerrel L. Yakel

	ABSTRACT

Top Abstract Introduction Methods Results Discussion References

Rat hippocampal interneurons express diverse subtypes of functional nicotinic acetylcholine receptors (nAChRs), including 7-containing receptors that have properties unlike those expected for homomeric 7 nAChRs. We previously reported a strong correlation between expression of the 7 and of the 2 subunits in individual neurons. To explore whether co-assembly of the 7 and 2 subunits might occur, these subunits were co-expressed in Xenopus oocytes and the functional properties of heterologously expressed nAChRs were characterized by two-electrode voltage clamp. Co-expression of the 2 subunit, both wild-type and mutant forms, with the 7 subunit significantly slowed the rate of nAChR desensitization and altered the pharmacological properties. Whereas ACh, carbachol and choline were full or near-full agonists for homomeric 7 receptor channels, both carbachol and choline were only partial agonists in oocytes expressing both 7 and 2 subunits. In addition the EC₅₀ values for all three agonists significantly increased when the 2 subunit was co-expressed with the 7 subunit. Co-expression with the 2 subunit did not result in any significant change in the current-voltage curve. Biochemical evidence for the co-assembly of the 7 and 2 subunits was obtained by co-immunoprecipitation of these subunits from transiently transfected human embryonic kidney (TSA201) cells. These data provide direct biophysical and molecular evidence that the nAChR 7 and 2 subunits co-assemble to form a functional heteromeric nAChR with functional and pharmacological properties different from those of homomeric 7 channels. This co-assembly may help to explain nAChR channel diversity in rat hippocampal interneurons, and perhaps in other areas of the nervous system.

(Resubmitted 14 November 2001; accepted after revision 15 January 2002)
Corresponding author J. L. Yakel: NIEHS, F2-08, PO Box 12233, 111 T.W. Alexander Drive, Research Triangle Park, NC 27709, USA. Email: yakel{at}niehs.nih.gov

	INTRODUCTION

Top Abstract Introduction Methods Results Discussion References

Neuronal nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels that are widely expressed in the central and peripheral nervous system where they are involved in a variety of physiological processes, including cognition and development (Jones et al. 1999). Furthermore, dysfunctions in nAChRs may be a factor in a variety of neurodegenerative diseases including Alzheimer's disease (Paterson & Nordberg, 2000; Court et al. 2001; Dani, 2001), and in ageing (Jones et al. 1999). For example in Alzheimer's disease, the extensive accumulation of the -amyloid peptide (A_1-42) has been proposed to lead to the progressive loss of cognitive function, and A_1-42 has recently been shown to inhibit nAChR function in rat hippocampal neurons (Liu et al. 2001; Pettit et al. 2001). In the brain, nAChRs are known to function both at presynaptic sites (i.e. to regulate the release of neurotransmitter) and postsynaptic sites (i.e. to mediate fast excitatory synaptic transmission) (Wonnacott, 1997; Jones et al. 1999). Currently there are at least 11 different nAChR subunits known to be widely expressed in the rat nervous system; nine of these (2-7 and 2-4) are expressed in the adult rat CNS (McGehee & Role, 1995; Boyd, 1997; Elgoyhen et al. 2001). To enhance our understanding of the biophysical and pharmacological properties of functional nAChRs, we must understand how these subunits assemble to form functional channels.

Rat hippocampal interneurons express diverse subtypes of functional nAChRs (Alkondon et al. 1997; Jones & Yakel, 1997; Frazier et al. 1998; McQuiston & Madison, 1999; Ji & Dani, 2000). While the majority of these nAChRs contain the 7 subunit, the properties of these 7-containing receptors are not identical to the observed properties of recombinant homomeric 7 receptors; in particular these native 7-containing receptors desensitize more slowly and have a smaller single channel conductance (Shao & Yakel, 2000; Sudweeks & Yakel, 2000). This suggests the possibility that 7-containing nAChRs expressed in rat hippocampal interneurons are not homomeric assemblies of 7 subunits. It had been previously thought that mammalian 7 subunits mostly form homomeric receptors as no direct evidence for co-assembly had been reported (McGehee & Role, 1995; Chen & Patrick, 1997; Drisdel & Green, 2000). In addition the properties of native chick 7 nAChRs often do not match those of heterologously expressed homomeric 7 nAChRs (Anand et al. 1993; Yu & Role, 1998a; Girod et al. 1999), and 7-containing heteromeric chick nAChRs can be formed in heterologous expression systems (Girod et al. 1999; Palma et al. 1999). Multiple functional subtypes of 7-containing nAChRs have been reported in rat intracardiac ganglion and superior cervical ganglion neurons (Cuevas & Berg, 1998; Cuevas et al. 2000) and chick sympathetic neurons (Yu & Role, 1998a), suggesting further the possibility for heteromeric 7-containing nAChRs. Combining patch-clamp electrophysiological and single-cell RT-PCR analysis, we previously reported (Sudweeks & Yakel, 2000) a strong correlation between expression of the 7 and 2 subunits in individual rat hippocampal interneurons.

In this study, we tested whether the rat nAChR 7 and 2 subunits can co-assemble to form a functional heteromeric nAChR channel in Xenopus oocytes. Previously no evidence had been reported demonstrating the heteromeric assembly of mammalian 7-containing nAChRs. The co-expression of the 2 subunit with the 7 subunit significantly slowed the rate of desensitization as compared to homomeric 7 channels, and altered the pharmacological properties. The co-expression of the 7 subunit with a mutant form of the 2 subunit, containing a cysteine residue in place of a leucine residue in the presumed pore region, also dramatically slowed the rate of desensitization. Biochemical evidence for the co-assembly of the 7 and 2 subunits was obtained by co-immunoprecipitation of these subunits from transiently transfected human embryonic kidney (TSA201) cells. These data provide direct biophysical and molecular evidence that the rat nAChR 7 and 2 subunits co-assemble to form a functional heteromeric nAChR.

	METHODS

Top Abstract Introduction Methods Results Discussion References

RNA preparation

mRNA was transcribed in vitro from plasmids using mMessage Machine kit (Ambion Inc., Austin, TX, USA) according to conditions suggested by the manufacturer. The rat nAChR 7 and 2 plasmids were kindly provided by J. Patrick, and the 2 subunit was subcloned into pcDNA 3.1 (Invitrogen, Carlsbad, CA. USA) prior to mutagenesis. The leucine to cysteine point mutation at amino acid position 277 of the 2 subunit (numbering from protein accession no. JH0174) was made with the Stratagene (La Jolla, CA, USA) QuickChange mutation kit. The following oligonucleotide primers (synthesized by Life Technologies, Rockville, MD, USA) were used: TATTTCTGTGCTGTGCGCACTCA-CGGTGT (sense strand), and ACACCGTGAGTGCGCACAGCACAGAAATA (antisense strand). All conditions for the mutagenesis were as suggested by the manufacturer. The entire sequence of the open reading frame from the resulting plasmid was sequenced in order to confirm the presence of the desired mutation, and that no other mutations were present.

Expression in Xenopus oocytes

All experiments were carried out in accordance with guidelines approved by the National Instsitute of Environmental Health Sciences (NIEHS) Animal Care and Use Committee. Female Xenopus laevis frogs were anaesthetized by immersion in cold water containing 0.2 % ethylmetaaminobenzoate (MS-222; Sigma) for 60 min, and decapitated. Oocytes were dissected and defolliculated by treatment with collagenase B (Boehringer Mannheim, 3-4 mg ml^-1) for 2-4 h (Kriegler et al. 1999). The total amount of RNA injected for each nAChR subunit was 25 ng for the 7 subunit and either 25 or 75 ng for the 2 subunit. Experiments were performed 1-12 days after injection.

Electrophysiological recording

Current responses were obtained by two-electrode voltage-clamp recording at a holding potential of -60 mV using a GeneClamp 500 amplifier and pCLAMP 8 software (Axon Instruments, Union City, CA, USA). The bath was grounded via a silver chloride pellet; the maximum expected voltage error was estimated to be 1-2 mV. Typically traces were filtered at 0.2-1 kHz and sampled at 0.5-5 kHz. Electrodes contained 3 M KCl with 0.4 M BAPTA and had resistances of < 1 M. The slow leak of BAPTA into oocytes from the electrodes for several minutes (e.g. > 5 min) was enough to significantly reduce the IP₃ receptor-mediated Ca²⁺ signalling in Xenopus oocytes (authors' unpublished observations). Traces obtained for the quantification of the desensitization rate were usually taken 5-15 min after impaling oocytes, a time that should have allowed BAPTA to enter the oocytes to chelate the expected Ca²⁺ influx through the 7-containing nAChRs. These precautions were taken to minimize any activation of the endogenous Ca²⁺-dependent chloride conductance in Xenopus oocytes that might significantly alter the amplitude or kinetics of the nAChR-mediated responses; that this was the case was suggested by the fact that the kinetics of desensitization were stable for up to 1 h and not significantly affected by the chloride channel blocker niflumic acid (300 µM), and the reversal potential values of responses (see Results section). Carbachol, ACh, and choline (Sigma) were freshly prepared in bath solution from a frozen stock and applied either by suction of respective solutions from dishes using the OTC-20 rapid solution exchange system (ALA Scientific Instruments, Westbury, NY, USA), or via a synthetic quartz perfusion tube (0.7 mm i.d.) operated by a computer-controlled valve. With the OTC-20 system, solution exchange can be achieved in ~10 ms (Madeja et al. 1991). Only oocytes injected with 7 nAChR subunit RNA expressed functional channels; the injection of either wild-type or mutant 2 subunit RNA alone did not result in the expression of functional channels when tested using carbachol (1 mM).

Solutions

Oocytes were defolliculated in a solution containing (mM): NaCl (85.2), KCl (2), MgCl₂ (1) and Hepes (5). Recordings were performed in a solution containing (mM): NaCl (96), KCl (2), CaCl₂ (1.8), MgCl₂ (1) and Hepes (10) (pH 7.4). Oocytes were maintained in culture in the same solution, with the addition of 2.5 mM sodium pyruvate, 0.5 mM theophylline and 50 µg ml^-1 gentamicin.

cDNAs, antibodies and cell lines

Mammalian plasmid expression vectors containing rat nAChR 2 subunit cDNA (pRK5-2) and an epitope-tagged rat 7 subunit cDNA (pcDNA1neo-7^FLAG) have been described previously (Cooper & Millar, 1997; Cooper et al. 1999). Monoclonal antibody mAb270, which recognizes an extracellular epitope on the nAChR 2 subunit (Whiting & Lindstrom, 1987), was purified from the hybridoma cell line HB189 (obtained from the American Type Culture Collection, Rockville, MD, US). Monoclonal antibody mAbFLAG-M2 which recognizes an eight amino acid epitope tag (Hopp et al. 1988) introduced into the intracellular loop region of the 7 subunit (7^FLAG) (Cooper & Millar, 1997) was obtained from Scientific Imaging Systems. Mammalian cell line TSA201, a derivative of the human embryonic kidney HEK293 cell line which expresses the simian virus 40 large T-antigen, was obtained from W. Green.

Transfection, metabolic labelling and immunoprecipitation

Human TSA201 cells were cultured in Dulbecco's modified Eagle's medium (Life Technologies) containing 2 mM L-Glutamax™ (Life Technologies) plus 10 % heat-inactivated fetal calf serum (FCS) (Sigma), with penicillin (100 U ml^-1) and streptomycin (100 µg ml^-1) and were maintained in a humidified incubator containing 5 % CO₂ at 37 °C. Cells were transfected using Effectene transfection reagent (Qiagen Inc., Valencia, CA, USA) according to the manufacturer's instructions with a total of 0.6 µg plasmid DNA. In all cases where different subunit cDNA combinations were compared, the amount of each plasmid construct and the total amount of plasmid DNA used during transfection experiments was kept constant. This was achieved by including appropriate amounts of 'empty' expression plasmid (pRK5 without a cDNA insert). Cells were transiently transfected overnight in 10 cm tissue culture dishes pre-coated with poly-L-lysine (Sigma). To starve cells of methionine, cells were washed twice with, and bathed for 10 min in L-methionine- (Met) and L-cysteine- (Cys) free DMEM (Life Technologies) containing 10 mM Hepes and 3.7 g l^-1 NaHCO₃. Cells were labelled with 125 µCi 'Redivue Pro-mix' (Amersham Pharmacia Biotech, Little Chalfont, UK; a mixture of [³⁵S]methionine and [³⁵S]cysteine) in 3.5 ml of Met/Cys-free DMEM for 4 h, followed by a 2 h incubation with an additional 5 ml of complete growth medium containing normal concentrations of Cys and Met. Metabolically labelled cells were rinsed with phosphate-buffered saline, harvested and solubilized in ice-cold lysis buffer (LB) containing protease inhibitors (150 mM NaCl, 50 mM Tris-Cl pH 8.0, 5 mM EDTA, 1 % Triton X-100, 0.25 mM phenyl-methylsulfonyl fluoride, and 10 µg ml^-1 each of leupeptin, aprotinin and pepstatin). Samples were immunoprecipitated with mAb270 or mAbFLAG-M2, followed by Protein G-sepharose (Amersham Pharmacia Biotech) and analysed by SDS-polyacrylamide gel electrophoresis, as has been described (Cooper & Millar, 1997).

Data analysis

Peak currents, decay kinetics and curve fitting were measured and analysed using Clampfit (Axon Instruments,) and Origin (OriginLab Corp., Northampton, MA, USA) software. Tests of significance were determined using either Student's t test (P values less than 0.05 were considered significant), or the Fisher's least significant difference (LSD) test to make pairwise comparisons among multiple treatment groups. The variance-stabilizing logarithmic transformation was used in some of these statistical analyses. Fits were made to the Hill equation: I = I_max(xⁿ/(Kⁿ + xⁿ)), where I_max is the maximum response amplitude to agonist, x is the agonist concentration, n is the Hill coefficient, and K is the EC₅₀ value, using either Origin or the CVFIT program provided by Dr David Colquhoun (http://www.ucl.ac.uk/Pharmacology/dcpr95.html#notes). Fits to a two-component Hill equation were made using either the CVFIT program or by statisticians at NIEHS (Drs Joe Haseman and Shyamal Peddada). The performance of the two-component fit was compared with the single-component fit using the standard F statistic which compares the excess mean error sum of squares. Fits to full concentration-response curves for individual oocytes were made independently and then averaged in order to compare significant differences between groups. All agonist data was normalized to the amplitude produced from the same oocyte by a 1 mM dose of ACh; this amplitude was assigned a value of 1.0.

	RESULTS

Top Abstract Introduction Methods Results Discussion References

The rapid application of ACh, carbachol, or choline to oocytes expressing the rat 7 nAChR subunit induced inward current responses at a holding potential of -60 mV that activated rapidly, and then desensitized (i.e. inactivated) in the continued presence of agonist. An example of a carbachol- (1 mM) activated response is shown in Fig. 1A. The onset of desensitization was a biphasic process; the fast time constant of decay (_fast) averaged 0.106 ± 0.012 s (12 cells) and comprised 85 ± 2 % of the fit, and the slow time constant of decay (_slow) averaged 1.11 ± 0.15 s and comprised 13 ± 2 % of the fit (Fig. 1C and D). Co-expression of the 2 with 7 subunits also resulted in rapidly activating responses (Fig. 1B), but the rate of desensitization was significantly slower (Fig. 1C) than for the 7 subunit alone. When equal amounts of the 7 and 2 subunits (25 ng each) were injected (these will be referred to as 72 channels), the fast and slow decay phases averaged (13 cells), respectively, 0.210 ± 0.033 s (68 ± 5 % of the fit) and 1.27 ± 0.22 s (29 ± 5 % of the fit; Fig. 1B and D). The rate of the fast decay phase and the relative fractions of both phases were significantly different from those for 7 alone (Fig. 1C and D). Injecting a three times greater amount (75 ng) of 2 subunit RNA (i.e. 72(3) channels) with the 7 subunit RNA (25 ng) did not significantly alter the kinetics of desensitization versus the oocytes injected with equal amounts (i.e. 25 ng) of the 7 and 2 subunit RNA; the fast and slow decay phases averaged (10 cells; Fig. 1C and D), respectively, 0.231 ± 0.026 s (54 ± 7 % of the fit) and 1.15 ± 0.24 s (44 ± 6 % of the fit).

		View larger version [in this window] [in a new window]
Figure 1. Co-expression of the 2 along with the 7 subunit alters the kinetics of desensitization In oocytes expressing the 7 subunit alone (A) or with the 2 subunit (B), the rapid application of carbachol (1 mM; indicated by the horizontal bar) induced a rapid inward current response at a holding potential of -60 mV that rapidly desensitized. In A, the fast and slow time constants of decay were 0.088 s (89 % of the fit) and 1.37 s (11 % of the fit), respectively. In B, these values were 0.230 s (84 % of the fit) and 1.25 s (13 % of the fit). These curve fits overlay the data trace in both A and B. The relative time constant values and proportions of fit for all three groups (i.e. 7, 72, 72(3) are shown in C and D, respectively. In C and D, the asterisks denote a significant difference (P < 0.05) compared to homomeric 7 channels.

Dose-response curves for ACh, carbachol and choline for 7, 72 and 72(3) channels are shown in Fig. 2, and average EC₅₀ and Hill coefficient values are shown in Table 1. The average amplitude for ACh-activated responses (1 mM; 3-12 days after injection) for 7, 72 and 72(3) channels, respectively, was 3099 ± 105 nA (14 cells), 2602 ± 161 nA (11 cells), and 1965 ± 211 nA (5 cells). The dose- response curve for ACh (Fig. 2A) showed no significant difference when the 2 subunit was co-expressed with the 7 subunit in equal amounts. However for the 72(3) channels, there was a slight but significant increase in the EC₅₀ value without any significant change in the Hill coefficient (Table 1). Both carbachol (Fig. 2B) and choline (Fig. 2C) were nearly full agonists for 7 channels, and both had higher EC₅₀ values than for ACh. However for both 72 and 72(3) channels, carbachol and choline were only partial agonists. Carbachol (10 mM) activated responses that were only 57 % of the amplitude of ACh (10 mM) for 72 channels, and 45 % for 72(3). Choline (40 mM) activated responses that were only 58 % (72 channels) and 41 % (72(3)) of the amplitude of ACh (10 mM). The EC₅₀ values for carbachol and choline for both 72 and 72(3) channels were significantly larger than that of 7 channels; the values for 72 and 72(3) channels were not significantly different from each other (Table 1).

		View larger version [in this window] [in a new window]
Figure 2. Concentration-response curves shows altered pharmacological properties when co-expressing 7 and 2 subunits The concentration-response curves for activation by ACh, carbachol and choline are shown in A, B and C, respectively. Each point represents the average (3-6 cells) from data normalized (see Methods) to the amplitude of 1 mM ACh. The traces are one-component Hill fits (see Methods) to the averaged data.

Co-expression of the 2 with the 7 subunit did not significantly alter the shape of the current-voltage (I-V) curve (data not shown). The reversal potential values for responses for the 7, 72, and 72(3) channels were, respectively, -5 ± 1 mV (3 cells), -5 ± 2 mV (3 cells), and -7 ± 1 mV (4 cells). These values suggest that there was no significant change in ionic permeabilities when co-expressing the 2 along with the 7 subunit, and furthermore that there was probably no significant contribution of the endogenous Ca²⁺-dependent chloride conductance under our experimental recording conditions (see Methods).

Co-expressing the 7 and 2 subunits could lead to the expression of a heterogeneous population of channels, containing homomeric 7 channels and 2-containing 7 channels. Perhaps variable numbers of the 2 subunit might also exist per channel. If so, attempting to fit the concentration-response data to a single-component Hill fit might be inadequate. When the data was fitted to a two-component Hill fit (see Methods), the fits were significantly better in most cases, even for the homomeric 7 channels. This was not expected since there should be a homogeneous population of channels in these oocytes. Therefore, the significant improvement with a two-component Hill fit was not necessarily indicative of a heterogeneous population of nAChRs and thus this type of analysis was not conclusive.

The leucine at amino acid position 277 of the 2 subunit was mutated to cysteine (2^L277C) in order to use the substituted cysteine accessibility method (SCAM; Akabas et al. 1994; Kriegler et al. 1999) to test for the co-assembly of the nAChR 7 and 2 subunits. This position corresponds to the leucine at position 251 of the nicotinic 1 subunit (Akabas et al. 1994) that is thought to line the pore of the channel. However for technical reasons, this method was apparently unsuitable for rat 7-containing nAChRs. However in expressed 7 nAChRs, mutating this position alters the kinetics of desensitization (Revah et al. 1991). We co-expressed equal amounts (i.e. 25 ng each) of this mutant nicotinic 2 subunit along with the 7 subunit and tested whether carbachol-activated responses were altered. The mutant 2^L277C subunit also slowed the rate of nAChR desensitization as compared to the 7 subunit alone (Fig. 3). The fast and slow decay phases averaged (15 cells), respectively, 0.088 ± 0.015 s (41 ± 3 % of the fit) and 0.90 ± 0.1 s (52 ± 3 % of the fit). Although the time constant values were not significantly different from homomeric 7 channels, the relative fraction of the fast decay phase significantly decreased by 52 % (i.e. from 85 % to 41 %), and the fraction of the slow decay phase significantly increased by 300 % (i.e. from 13 % to 52 %). These changes in the proportions of the fast and slow decay phases resulted in an overall decrease in the rate of desensitization for 72^L277C versus homomeric 7 channels.

		View larger version [in this window] [in a new window]
Figure 3. Co-expression of mutant 2 subunit with the 7 subunit alters the kinetics of desensitization In oocytes expressing the mutant 2L277C subunit along with the 7 subunit, the rate of desensitization is slowed, compared to homomeric 7 channels. The fast and slow time constants of decay for 72L277C trace (A) were 0.136 s (40 % of the fit) and 0.542 s (57 % of the fit). The curve fit overlays the data trace. The relative change in the fast decay phase, the relative fraction of the fast decay phase, the slow decay phase, and the fraction of the slow decay phase versus expression with the wild-type 2 subunit are shown in B. The asterisks denote a significant difference (P < 0.05) compared to 72 channels.

The kinetics of desensitization for the 72^L277C channels were significantly different from those for the 72 channels. The time constant value and relative fraction of the fast decay phase significantly decreased (by 58 % and 40 %, respectively), and the relative fraction of the slow decay phase significantly increased by 79 % (i.e. from 29 % to 52 %; Fig. 3B). Comparing the kinetics of decay for the 72^L277C and 72 channels (utilizing the average values from above), the initial rate of decay (up to ~250 ms) for the 72^L277C channels was faster, but the sustained component of decay (> 250 msec) for these channels was slower than for the wild-type 72 channels. These data are also consistent with the notion that the nAChR 7 and 2 subunits co-assemble to form a functional heteromeric nAChR in Xenopus oocytes.

Further evidence for the co-assembly of the nAChR 7 and 2 subunits was obtained by co-immunoprecipitation of these subunits with subunit-specific antibodies. Due to difficulties in obtaining sufficient material from heterologous expression in oocytes, these experiments were performed by transfection of subunit cDNAs into human embryonic kidney (TSA201) cells (Fig. 4). Cells were transiently transfected with plasmid expression constructs encoding either 2 (pRK5-2) (Cooper et al. 1999) or an epitope tagged 7 subunit (pcDNA1neo-7^FLAG) (Cooper & Millar, 1997). Transfected cells were metabolically labelled (with a mixture of [³⁵S]methionine and [³⁵S]cysteine) and the subunit co-assembly examined by immunoprecipitation of subunit proteins from detergent-solubilized cell extracts. Cell lysates were immunoprecipitated with either mAb270, which recognizes an epitope on the extracellular domain of 2 (Whiting & Lindstrom, 1987), or mAbFLAG-M2, which recognizes an eight amino acid epitope tag (Hopp et al. 1988) introduced into the intracellular loop region of the 7 subunit (7^FLAG) (Cooper & Millar, 1997). Anti-2 antibody mAb270 immunoprecipitated the 2 subunit but showed no cross-reactivity with 7^FLAG. Co-precipitation of 7^FLAG by mAb270 was seen when the two subunits were co-expressed. Similarly, anti-FLAG antibody mAbFLAG-M2 immunoprecipitated 7^FLAG but showed no cross-reactivity with 2. Co-precipitation of 2 by mAbFLAG-M2 was seen when the two subunits were co-expressed. This provides direct evidence for co-assembly of the nAChR 7 and 2 subunits when expressed heterologously in a mammalian cell line. It should be noted that preliminary experiments have not detected functional nAChRs in TSA201 cells transfected with 7 and/or 2 subunits. This is not unexpected considering the considerable difficulties that have previously been encountered in detecting functional 7 nAChRs in transfected mammalian cell lines (Cooper & Millar, 1997; Kassner & Berg, 1997; Rangwala et al. 1997; Chen et al. 1998).

		View larger version [in this window] [in a new window]
Figure 4. Co-immunoprecipitation of 7 and 2 subunits Human TSA201 cells were transiently transfected with plasmid expression constructs encoding either 2 (pRK5-2) (Cooper et al. 1999) or an epitope-tagged 7 subunit (pcDNA1neo- 7FLAG) (Cooper & Millar, 1997). Co-assembly of 2 and 7FLAG was examined by immunoprecipitation of metabolically labelled subunit proteins from detergent-solubilized cells. Cell lysates were immunoprecipitated with either mAb270, which recognizes an epitope on the extracellular domain of 2 (Whiting & Lindstrom, 1987), or mAbFLAG-M2, which recognizes an eight-amino-acid epitope tag (Hopp et al. 1988) introduced into the intracellular loop region of the 7 subunit (7FLAG) (Cooper & Millar, 1997). Anti-2 antibody mAb270 immunoprecipitated the 2 subunit (lane 2) but showed no cross-reactivity with 7FLAG (lane 1). Co-precipitation of 7FLAG by mAb270 was seen when the two subunits were co-expressed (lane 3). Similarly, anti-FLAG antibody mAbFLAG-M2 immunoprecipitated 7FLAG (lane 4) but showed no cross-reactivity with 2 (lane 5). Co-precipitation of 2 by mAbFLAG-M2 was seen when the two subunits were co-expressed (lane-6). The positions of molecular weight markers are shown. Minor immunoprecipitated bands are visible above and below the main 2 band. After immunoprecipitation with the anti-2 mAb (lanes 1-3), these bands are only visible in cells transfected with 2 (lanes 2 and 3). This would suggest that they correspond to differently migrating forms of the 2 subunit. In addition, after immunoprecipitation with the anti-7 mAb (lanes 4-6), a band is visible which co-migrates with the lower molecular weight band seen in lanes 2 and 3. Since this band is visible in cells transfected with both 7 alone (lane 4) and 2 alone (lane 5), it would appear that it corresponds to a non-specific protein (which is recognized by the anti-7, but not by the anti-2 mAb). These two co-migrating bands would both be expected to be present in lane 6, which may explain the greater intensity of this low molecular weight band in this lane. In all cases cells were transfected under identical conditions and similar amounts of immunoprecipitated material was loaded. All lanes are from a single experiment and x-ray films that were exposed for the same length of time. Co-precipitation of 7 and 2 has been confirmed in two independent experiments. It should be noted that these results correspond to total (surface and intracellular) proteins.

	DISCUSSION

Top Abstract Introduction Methods Results Discussion References

We have shown that the rat nAChR 7 and 2 subunits can co-assemble to form a functional heteromeric nAChR. The co-expression of 2 with the 7 subunit in Xenopus oocytes resulted in nAChR channels with a slower rate of desensitization, and altered sensitivity to agonists. Furthermore, the 7 and 2 subunits were co-immunoprecipitated from transiently transfected human embryonic kidney (TSA201) cells. These data suggest the possibility that the 7 and 2 subunits may co-assemble in vivo, which might help to explain nAChR channel diversity in rat hippocampal interneurons, and perhaps in other areas of the nervous system as well.

Although at least nine different genes encode nAChR subunits expressed in the rat brain (2-7 and 2-4), with the potential of forming thousands of different combinations of functional channels, a few subunits are known to predominate in specific brain regions (Jones et al. 1999). For example in the hippocampus, functional data have led to the notion that the major types of channels are composed of 7 and 42 subunits (Alkondon & Albuquerque, 1993; Alkondon et al. 1997; Jones & Yakel, 1997; Frazier et al. 1998; McQuiston & Madison, 1999; Ji & Dani, 2000). However when comparing the properties of heterologously expressed channels formed from these subunits with those of native nAChRs from hippocampal recordings, it is clear that the composition of the native receptors is more complex (i.e. nAChRs are not simply composed of 42 and 7 subunits) (McQuiston & Madison, 1999; Sudweeks & Yakel, 2000). One major task, therefore, is to understand the molecular makeup of nAChRs in various brain regions. Previously we provided evidence for a link between the expression of the 7 and 2 nAChR subunits (Shao & Yakel, 2000; Sudweeks & Yakel, 2000), and hypothesized that co-assembly of these subunits might help to explain nAChR diversity in these hippocampal interneurons. Here we have shown, for the first time, that co-assembly between these two subunits from rat can occur.

Preliminary evidence for the co-assembly of the 7 and 2 subunits in a heterologous expression system utilizing chick nAChR subunits has been reported (Girod et al. 1999; Crabtree et al. 2000). When co-expressing the 7 and 2 subunits in Xenopus oocytes and measuring membrane current, the EC₅₀ value for ACh decreased 100-fold compared to homomeric 7 channels (Crabtree et al. 2000); this is clearly different from the rat 7 and 2 subunits investigated here. The chick 3 subunit was also found to co-assemble with the 7 subunit in Xenopus oocytes (Palma et al. 1999). Co-expression of the 3 subunit with the wild-type 7 subunit resulted in the cell-surface expression of heteromeric nAChRs, but these channels could not be activated by ACh. However co-expressing the 3 subunit with a mutant 7 subunit (7^L247T) resulted in functional heteromeric channels with a lower affinity for ACh, a faster rate of desensitization, a more non-linear I-V relation with a shift in E_rev, and a smaller single-channel conductance than for homomeric 7^L247T channels (Palma et al. 1999). Co-expressing a much higher ratio of 3 subunit RNA also dramatically reduced the cell-surface expression of functional receptors and the amplitude of the ACh-induced currents. It was proposed that this effect might be due to the sequestering of 73 dimers by the 3 subunit, thus hindering functional pentamer formation (Palma et al. 1999). In the current study, the amplitude of responses to ACh was not dramatically different for the rat 7, 72, and 72(3) channels. If the maximum open probability and single channel conductance values were not different for these three groups of channels, this would then suggest that for rat nAChR subunits, the 2 subunit does not appear to dramatically alter the formation of functional 7-containing channels in Xenopus oocytes. However we cannot rule out the possibility that co-expression with 2 subunits alters the efficacy of the channel response to ACh or the single channel conductance, and that there are in fact significant changes in the number of functional channels. Nevertheless in the chick, it appears likely that while subunits (i.e. 2 and 3) can co-assemble with the 7 subunit, the change in functional properties is different from that of co-assembled rat 7 and 2 subunits.

Native chick 7-containing nAChRs also exhibit diversity consistent with the notion of heteromeric 7 nAChRs. The chick 7 subunit has previously been suggested to co-assemble and form functional channels with the 5 subunit (Yu & Role, 1998b) and 8 subunit (Keyser et al. 1993) in native tissues, and perhaps with other subunits as well (Pugh et al. 1995; Yu & Role, 1998a; Girod et al. 1999). The 7 subunit is thought to contribute to the function of at least three subtypes of nAChR in embryonic chick sympathetic neurons, all distinct from heterologously expressed homomeric 7 nAChRs (Yu & Role, 1998a). We have previously shown that the 7-containing nAChRs in rat hippocampal interneurons desensitize more slowly and have a unitary single channel conductance different from that expected for homomeric 7 nAChRs (Shao & Yakel, 2000; Sudweeks & Yakel, 2000). Our observation that co-expression of 2 with the 7 subunit significantly slowed the rate of desensitization is consistent with the notion that co-assembly of the 7 and 2 subunits might occur in rat hippocampal interneurons.

When co-expressing the 7 and 2 subunits, it is possible that a heterogeneous population of channels (e.g. 7 and 72 channels) is expressed in individual oocytes. However, strong evidence to suggest that this occurred was not apparent. First, the kinetics of desensitization were biphasic both in oocytes expressing only the 7 subunit (i.e. presumed homomeric 7 channels), and in oocytes expressing both 7 and 2 subunits. A heterogeneous population of channels might be expected to result in a more complex decay phase, but this appeared not to be the case (Fig. 1). However, it should be noted that extra exponential components might not be distinguishable; this depends in part on the area of each component and on the separation of the time constant values. Second, fitting the concentration-response curves to single- and double-component Hill fits, which might be used to test for a heterogeneous population of channels, proved inconclusive. Studies other than concentration-response curves (e.g. single channel studies) might help to solve this point more rigorously.

Interestingly, expressing a higher proportion of the 2 subunit produced further shifts in pharmacological properties (Fig. 2; Table 1), without any significant change in the kinetics of desensitization. These data could suggest that certain subunit combinations are favoured. From the concentration-response curves and kinetic analysis, it seems likely that in the different batches of oocytes (i.e. 7, 72 and 72(3)), one type of channel predominated. The pharmacological differences between 7 and 72 oocytes could indicate that most of the channels in the latter case contain a 2 subunit (perhaps one), and the pharmacological differences between 72 and 72(3) oocytes could indicate that the number of 2 subunits per channel in the latter case might be higher than for 72 channels. For the nicotinic 4 and 2 subunits, four pharmacologically distinct subtypes were expressed in Xenopus oocytes by altering the ratio of the cDNAs encoding these two subunits (Zwart & Vijverberg, 1998). Perhaps a similar situation is occurring with the 7 and 2 subunits. Unlike chick 73 channels expressed in Xenopus oocytes (Palma et al. 1999), the number of 2 subunits in a rat nAChR complex appears not to affect the cooperativity of receptor activation.

In summary, we have shown that the rat nAChR 7 and 2 subunits can co-assemble to form a functional heteromeric nAChR, with altered biophysical and pharmacological properties. Thus it is becoming clear that in heterologous expression systems as well as in native tissues, the 7 nAChR subunit can and does co-assemble with other nAChR subunits. This might help to explain nAChR channel diversity in rat hippocampal interneurons, and perhaps in other areas of the nervous system as well. For example the kinetics of desensitization of native 7-containing receptors in rat hippocampal interneurons is much slower than that expected for recombinant homomeric 7 receptors (Sudweeks & Yakel, 2000). The fact that co-expression of the 2 with the 7 subunit in Xenopus oocytes slows the rate of desensitization, combined with the fact that these two subunits are significantly co-expressed in the same neurons (Sudweeks & Yakel, 2000), is consistent with the idea that the 7 and2 subunits may co-assemble in the rat hippocampal interneurons in vivo. Taken together these data lead to the conclusion that nAChR diversity, at least in the brain, is much more complex than previously imagined.

	REFERENCES

Top Abstract Introduction Methods Results Discussion References

AKABAS, M. H., KAUFMANN, C., ARCHDECON, P. & KARLIN, A. (1994). Identification of acetylcholine receptor channel-lining residues in the entire M2 segment of the alpha subunit. Neuron 13, 919-927	[Medline]
ALKONDON, M. & ALBUQUERQUE, E. X. (1993). Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. I. Pharmacological and functional evidence for distinct structural subtypes. Journal of Pharmacology and Experimental Therapeutics 265, 1455-1473	[Abstract]
ALKONDON, M., PEREIRA, E. F., BARBOSA, C. T. & ALBUQUERQUE, E. X. (1997). Neuronal nicotinic acetylcholine receptor activation modulates gamma-aminobutyric acid release from CA1 neurons of rat hippocampal slices. Journal of Pharmacology and Experimental Therapeutics 283, 1396-1411	[Abstract/Full Text]
ANAND, R., PENG, X. & LINDSTROM, J. (1993). Homomeric and native 7 acetylcholine receptors exhibit remarkably similar but non-identical pharmacological properties, suggesting that the native receptor is a heteromeric protein complex. FEBS Letters 327, 241-246	[Medline]
BOYD, R. T. (1997). The molecular biology of neuronal nicotinic acetylcholine receptors. Critical Reviews in Toxicology 27, 299-318	[Medline]
CHEN, D., DANG, H. & PATRICK, J. W. (1998). Contributions of N-linked glycosylation to the expression of a functional 7-nicotinic receptor in Xenopus oocytes. Journal of Neurochemistry 70, 349-357	[Abstract]
CHEN, D. & PATRICK, J. W. (1997). The -bungarotoxin-binding nicotinic acetylcholine receptor from rat brain contains only the 7 subunit. Journal of Biological Chemistry 272, 24024-24029	[Abstract/Full Text]
COOPER, S. T., HARKNESS, P. C., BAKER, E. R. & MILLAR, N. S. (1999). Up-regulation of cell-surface 42 neuronal nicotinic receptors by lower temperature and expression of chimeric subunits. Journal of Biological Chemistry 274, 27145-27152	[Abstract/Full Text]
COOPER, S. T. & MILLAR, N. S. (1997). Host cell-specific folding and assembly of the neuronal nicotinic acetylcholine receptor 7 subunit. Journal of Neurochemistry 68, 2140-2151	[Abstract]
COURT, J., MARTIN-RUIZ, C., PIGGOTT, M., SPURDEN, D., GRIFFITHS, M. & PERRY, E. (2001). Nicotinic receptor abnormalities in Alzheimer's disease. Biological Psychiatry 49, 175-184	[Medline]
CRABTREE, G. W., CHEN, J., RAMIREZ-LATORRE, J. A., DAVIS, T. I. & ROLE L. W. (2000). 7-containing heteromeric neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes. Society for Neuroscience Abstracts 26, 1633
CUEVAS, J. & BERG, D. K. (1998). Mammalian nicotinic receptors with 7 subunits that slowly desensitize and rapidly recover from -bungarotoxin blockade. Journal of Neuroscience 18, 10335-10344	[Abstract/Full Text]
CUEVAS, J., ROTH, A. L. & BERG, D. K. (2000). Two distinct classes of functional 7-containing nicotinic receptor on rat superior cervical ganglion neurons. Journal of Physiology 525, 735-746	[Abstract/Full Text]
DANI, J. A. (2001). Overview of nicotinic receptors and their roles in the central nervous system. Biological Psychiatry 49, 166-174	[Medline]
DRISDEL, R. C. & GREEN, W. N. (2000). Neuronal -bungarotoxin receptors are 7 subunit homomers. Journal of Neuroscience 20, 133-139	[Abstract/Full Text]
ELGOYHEN, A. B., VETTER, D. E., KATZ, E., ROTHLIN, C. V., HEINEMANN, S. F. & BOULTER, J. (2001). 10: A determinant of nicotinic cholinergic receptor function in mammalian vestibular and cochlear mechanosensory hair cells. Proceedings of the National Academy of Sciences of the USA. 98, 3501-3506	[Medline]
FRAZIER, C. J., ROLLINS, Y. D., BREESE, C. R., LEONARD, S., FREEDMAN, R. & DUNWIDDIE, T. V. (1998). Acetylcholine activates an alpha-bungarotoxin-sensitive nicotinic current in rat hippocampal interneurons, but not pyramidal cells. Journal of Neuroscience 18, 1187-1195	[Abstract/Full Text]
GIROD, R., CRABTREE, G., ERNSTROM, G., RAMIREZ-LATORRE, J., MCGEHEE, D., TURNER, J. & ROLE, L. (1999). Heteromeric complexes of 5 and/or 7 subunits. Effects of calcium and potential role in nicotine-induced presynaptic facilitation. Annals of the New York Academy of Sciences 868, 578-590	[Medline]
HOPP, T. P., PRICKETT, K. S., PRICE, V. L., LIBBY, R. T., MARCH, C. J., CERRETTI, D. P., URDAL, D. L. & CONLON, P. J. (1988). A short polypeptide marker sequence useful for recombinant protein identification and purification. Biotechnology 6, 1204-1210
JI, D. & DANI, J. A. (2000). Inhibition and disinhibition of pyramidal neurons by activation of nicotinic receptors on hippocampal interneurons. Journal of Neurophysiology 83, 2682-2690	[Abstract/Full Text]
JONES, S., SUDWEEKS. S. & YAKEL, J. L. (1999). Nicotinic receptors in the brain: correlating physiology with function. Trends in Neurosciences 22, 555-561	[Medline]
JONES, S. & YAKEL, J. L. (1997). Functional nicotinic ACh receptors on interneurones in the rat hippocampus. Journal of Physiology 504, 603-610	[Abstract]
KASSNER, P. D. & BERG, D. K. (1997). Differences in the fate of neuronal acetylcholine receptor protein expressed in neurons and stably transfected cells. Journal of Neurobiology 33, 968-982	[Medline]
KEYSER, K. T., BRITTO, L. R., SCHOEPFER, R., WHITING, P., COOPER, J., CONROY, W., BROZOZOWSKA-PRECHTL, A., KARTEN, H. J. & LINDSTROM, J. (1993). Three subtypes of -bungarotoxin-sensitive nicotinic acetylcholine receptors are expressed in chick retina. Journal of Neuroscience 13, 442-454	[Abstract]
KRIEGLER, S., SUDWEEKS, S. & YAKEL, J. L. (1999). Communication: The nicotinic 4 receptor subunit contributes to the lining of the ion channel pore when expressed with the 5-HT3 receptor subunit Journal of Biological Chemistry 274, 3934-3936. LIU, Q., KAWAI, H. & BERG, D. K
MCGEHEE, D. S. & ROLE, L. W. (1995). Physiological diversity of nicotinic acetylcholine receptors expressed by vertebrate neurons. Annual Review of Physiology 57, 521-546	[Medline]
MCQUISTON, A. R. & MADISON, D. V. (1999). Nicotinic receptor activation excites distinct subtypes of interneurons in the rat hippocampus. Journal of Neuroscience 19, 2887-2896	[Abstract/Full Text]
MADEJA, M., MUßHOFF, U. & SPECKMANN, E.-J. (1991). A concentration-clamp system allowing two-electrode voltage-clamp investigations in oocytes of Xenopus laevis. Journal of Neuroscience Methods 38, 267-269	[Medline]
PALMA, E., MAGGI, L., BARABINO, B., EUSEBI, F. & BALLIVET, M. (1999). Nicotinic acetylcholine receptors assembled from the 7 and 3 subunits. Journal of Biological Chemistry 274, 18335-18340	[Abstract/Full Text]
PATERSON, D. & NORDBERG, A. (2000). Neuronal nicotinic receptors in the human brain. Progress in Neurobiology 61, 75-111	[Medline]
PETTIT, D. L., SHAO, Z. & YAKEL, J. L. (2001). -Amyloid 1-42 peptide directly modulates nicotinic receptors in the rat hippocampal slice Journal of Neuroscience 21, RC120. PUGH, P. C., CORRIVEAY, R. A., CONROY, W. G. & BERG, D. K
RANGWALA, F., DRISDEL, R. C., RAKHILIN, S., KO, E., ATLURI, P., HARKINS, A. B., FOX, A. P., SALMAN, S. S. & GREEN, W. N. (1997). Neuronal alpha-bungarotoxin receptors differ structurally from other nicotinic acetylcholine receptors. Journal of Neuroscience 17, 8201-8212	[Abstract/Full Text]
REVAH, F., BERTRAND, D., GALZI, J.-L., DEVILLERS-THIÉRY, A., MULLE, C., HUSSY, N., BERTRAND, S., BALLIVET, M. & CHANGEUX, J.-P. (1991). Mutations in the channel domain alter desensitization of a neuronal nicotinic receptor. Nature 353, 846-849	[Medline]
SHAO, Z. & YAKEL, J. L. (2000). Single channel properties of neuronal nicotinic ACh receptors in stratum radiatum interneurons of rat hippocampal slices Journal of Physiology 527, 507-513. SUDWEEKS, S. N. & YAKEL J. L
WHITING, P. & LINDSTROM, J. (1987). Purification and characterization of a nicotinic acetylcholine receptor from rat brain. Proceedings of the National Academy of Sciences of the USA 84, 595-599	[Medline]
WONNACOTT, S. (1997). Presynaptic nicotinic ACh receptors. Trends in Neurosciences 20, 92-98	[Medline]
YU, C. R. & ROLE, L. W. (1998a). Functional contribution of the 7 subunit to multiple subtypes of nicotinic receptors in embryonic chick sympathetic neurones. Journal of Physiology 509, 651-665	[Abstract/Full Text]
YU, C. R. & ROLE, L. W. (1998b). Functional contribution of the 5 subunit to neuronal nicotinic channels expressed by chick sympathetic ganglion neurones. Journal of Physiology 509, 667-681	[Abstract/Full Text]
ZWART, R. & VIJVERBERG, H. P. (1998). Four pharmacologically distinct subtypes of 42 nicotinic acetylcholine receptor expressed in Xenopus laevis oocytes. Molecular Pharmacology 54, 1124-1131	[Abstract/Full Text]

Acknowledgements

We would like to thank D. Armstrong and C. Erxleban for advice in preparing the manuscript, J. Patrick for providing us with plasmid DNA, W. Green for providing us with TSA201 cells, Joe Haseman and Shyamal Peddada (NIEHS) for statistical advice, and Meyer Jackson, David Colquhoun, Joe Haseman and Shyamal Peddada for advice on curve fitting of concentration-response relations.

This article has been cited by other articles:

				T. J. Rowley and P. Flood Isoflurane Prevents Nicotine-Evoked Norepinephrine Release from the Mouse Spinal Cord at Low Clinical Concentrations Anesth. Analg., September 1, 2008; 107(3): 885 - 889. [Abstract] [Full Text] [PDF]

				S. V. Mathew, A. J. Law, B. K. Lipska, M. I. Davila-Garcia, E. D. Zamora, S. N. Mitkus, R. Vakkalanka, R. E. Straub, D. R. Weinberger, J. E. Kleinman, et al. {alpha}7 nicotinic acetylcholine receptor mRNA expression and binding in postmortem human brain are associated with genetic variation in neuregulin 1 Hum. Mol. Genet., December 1, 2007; 16(23): 2921 - 2932. [Abstract] [Full Text] [PDF]

				M. Kishi and J. H. Steinbach Role of the Agonist Binding Site in Up-Regulation of Neuronal Nicotinic {alpha}4beta2 Receptors Mol. Pharmacol., December 1, 2006; 70(6): 2037 - 2044. [Abstract] [Full Text] [PDF]

				R. C Klein and J. L Yakel Paired-pulse potentiation of {alpha}7-containing nAChRs in rat hippocampal CA1 stratum radiatum interneurones J. Physiol., November 1, 2005; 568(3): 881 - 889. [Abstract] [Full Text] [PDF]

				J.-Z. Guo, Y. Liu, E. M. Sorenson, and V. A. Chiappinelli Synaptically Released and Exogenous ACh Activates Different Nicotinic Receptors to Enhance Evoked Glutamatergic Transmission in the Lateral Geniculate Nucleus J Neurophysiol, October 1, 2005; 94(4): 2549 - 2560. [Abstract] [Full Text] [PDF]

				C. E. Strang, M. E. Andison, F. R. Amthor, and K. T. Keyser Rabbit retinal ganglion cells express functional {alpha}7 nicotinic acetylcholine receptors Am J Physiol Cell Physiol, September 1, 2005; 289(3): C644 - C655. [Abstract] [Full Text] [PDF]

				A. L. Obaid, M. E. Nelson, J. Lindstrom, and B. M. Salzberg Optical studies of nicotinic acetylcholine receptor subtypes in the guinea-pig enteric nervous system J. Exp. Biol., August 1, 2005; 208(15): 2981 - 3001. [Abstract] [Full Text] [PDF]

				D. Fayuk and J. L Yakel Ca2+ permeability of nicotinic acetylcholine receptors in rat hippocampal CA1 interneurones J. Physiol., August 1, 2005; 566(3): 759 - 768. [Abstract] [Full Text] [PDF]

				P. Kumar and S. Meizel Nicotinic Acetylcholine Receptor Subunits and Associated Proteins in Human Sperm J. Biol. Chem., July 8, 2005; 280(27): 25928 - 25935. [Abstract] [Full Text] [PDF]

				B. T. Hawkins, R. D. Egleton, and T. P. Davis Modulation of cerebral microvascular permeability by endothelial nicotinic acetylcholine receptors Am J Physiol Heart Circ Physiol, July 1, 2005; 289(1): H212 - H219. [Abstract] [Full Text] [PDF]

				Z. Henderson, A. Boros, G. Janzso, A. J. Westwood, H. Monyer, and K. Halasy Somato-dendritic nicotinic receptor responses recorded in vitro from the medial septal diagonal band complex of the rodent J. Physiol., January 1, 2005; 562(1): 165 - 182. [Abstract] [Full Text] [PDF]

				E. G. Severance, H. Zhang, Y. Cruz, S. Pakhlevaniants, S. H. Hadley, J. Amin, L. Wecker, C. Reed, and J. Cuevas The {alpha}7 Nicotinic Acetylcholine Receptor Subunit Exists in Two Isoforms that Contribute to Functional Ligand-Gated Ion Channels Mol. Pharmacol., September 1, 2004; 66(3): 420 - 429. [Abstract] [Full Text] [PDF]