|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J Physiol (2003), 549.1, pp. 65-74
© Copyright 2003 The Physiological Society
DOI: 10.1113/jphysiol.2003.039859
| ABSTRACT |
|---|
|
|
|---|
Potassium channels play an important role in controlling the excitability of urinary bladder smooth muscle (UBSM). Here we describe the biophysical, pharmacological and molecular properties of the mouse UBSM voltage-gated K+ current (IK(V)). The IK(V) activated, deactivated and inactivated slowly with time constants of 29.9 ms at +30 mV, 131 ms at -40 mV and 3.4 s at +20 mV. The midpoints of steady-state activation and inactivation curves were 1.1 mV and -61.4 mV, respectively. These properties suggest that IK(V) plays a role in regulating the resting membrane potential and contributes to the repolarization and after-hyperpolarization phases of action potentials. The IK(V) was blocked by tetraethylammonium ions with an IC50 of 5.2 mM and was unaffected by 1 mM 4-aminopyridine. RT-PCR for voltage-gated K+ channel (KV) subunits revealed the expression of Kv2.1, Kv5.1, Kv6.1, Kv6.2 and Kv6.3 in isolated UBSM myocytes. A comparison of the biophysical properties of UBSM IK(V) with those reported for Kv2.1 and Kv5.1 and/or Kv6 heteromultimeric channels demonstrated a marked similarity. We propose that heteromultimeric channel complexes composed of Kv2.1 and Kv5.1 and/or Kv6 subunits form the molecular basis of the mouse UBSM IK(V).
(Received 20 January 2003; accepted after revision 13 March 2003; first published online 4 April 2003)
| INTRODUCTION |
|---|
|
|
|---|
The urinary bladder, a hollow organ that is composed of smooth muscle and an inner urothelial lining, functions to store urine produced by the kidneys and to void that urine from the body. The wall of the bladder, the detrusor, relaxes in response to bladder filling and contracts during voiding. Abnormal detrusor contractility is a major underlying cause of urinary incontinence, which affects millions of individuals (Payne, 1999).
The basic mechanisms controlling detrusor contractility remain incompletely understood. A key determinant of contractility is the membrane potential of the underlying urinary bladder smooth muscle (UBSM). UBSM membrane potential regulates the entry of Ca2+ through voltage-dependent Ca2+ channels, and thereby the contractile state of the UBSM. K+ channels play a critical role in controlling the membrane potential acting as the major hyperpolarizing influence (Nelson & Quayle, 1995; Karicheti & Christ, 2001).
Ca2+ entry through voltage-dependent Ca2+ channels is responsible for the upstroke of the UBSM action potential, whereas K+ channels mediate the repolarizing phase (Klockner & Isenberg, 1985; Heppner et al. 1997). Of the large family of mammalian K+ channels, the large-conductance and small-conductance Ca2+-activated K+ channels have been implicated in controlling the repolarization and after-hyperpolarization of the action potential, respectively (Fujii et al. 1990; Heppner et al. 1997). ATP-sensitive K+ channels, which are regulated by muscarinic receptor agonists (Bonev & Nelson, 1993), modulate action potential frequency (Petkov et al. 2001). Voltage-gated K+ channels (KV) are probable candidates mediating repolarization of the UBSM action potential and in regulating the resting membrane potential. KV have a prominent role in shaping action potentials in other smooth muscle tissues (Koh et al. 1999; Cole & Clement-Chomienne, 2000), as well as in cardiac myocytes and neurons (Nerbonne, 2000; Vincent et al. 2000).
KV have been characterized in isolated smooth muscle myocytes of vascular (Beech & Bolton, 1989; Robertson & Nelson, 1994; Aiello et al. 1995; Smirnov et al. 2002), gastrointestinal (Carl, 1995; Koh et al. 1999), airway (Boyle et al. 1992; Waldron et al. 1998), myometrial (Knock et al. 1999), gall bladder (Jaggar et al. 1998) and urinary bladder tissues (Davies et al. 2002). Smooth muscle IK(V) exhibits a large diversity of biophysical and pharmacological properties (reviewed by Cole & Clement-Chomienne, 2000). The diversity of IK(V) properties contributes in a significant manner to shaping the multitude of electrical activities observed in different smooth muscle preparations.
Differences in IK(V) properties are achieved by the tissue-specific expression and assembly patterns of members of the KV superfamily, which comprises families Kv1-Kv11. Kv1-Kv4 families produce functional channels by homo- or heterotetrameric assembly of members within a given family (Cole & Clement-Chomienne, 2000; Nerbonne, 2000). Members of the Kv5-Kv11 family do not form functional channels when expressed alone, but co-assemble with members of the Kv2 family, thereby increasing the diversity of Kv2 family channels (Post et al. 1996; Patel et al. 1997; Salinas et al. 1997; Kramer et al. 1998; Zhu et al. 1999; Ottschytsch et al. 2002).
In this paper we provide the first characterization of the biophysical, pharmacological and molecular properties of the mouse UBSM IK(V). We demonstrate the expression of Kv2.1, Kv5.1, Kv6.1, Kv6.2 and Kv6.3 subunits within isolated UBSM myocytes. The properties of heteromultimeric channels formed by these subunits make them prime candidates for the molecular basis underlying the native UBSM IK(V) and, therefore, are potential therapeutic targets for the modulation of detrusor function in the treatment of urinary incontinence.
| METHODS |
|---|
|
|
|---|
Urinary bladder myocyte isolation
B6129 mice approximately 8 weeks of age were killed by intraperitoneal injection of a lethal dose of pentobarbital (150 mg (kg body wt)-1)under the approval of the Office of Animal Care Management at the University of Vermont. Urinary bladders were then removed and placed in dissection/digestion solution containing (mM): 55 NaCl, 5.6 KCl, 2 MgCl2, 80 sodium glutamate, 10 glucose and 10 Hepes, pH 7.3. Bladders were then dissected free of fat and connective tissue and the urethra and ureter sphincters were removed. The bladders were cut open, rinsed free of urine and the urothelium removed. The remaining detrusor smooth muscle was then cut into 2 mm squares, digested for 20-25 min with 1 mg ml-1 papain (Worthington, Lakewood, NJ, USA), 1 mg ml-1 dithioerythreitol (DTE), followed by 8 min digestion in 1 mg ml-1 collagenase Type II (Sigma, St Louis, MO, USA) in the presence of 100 µM CaCl2 at 37 °C. Single detrusor myocytes were then obtained by gentle trituration of the digested tissue using a narrow-bore, fire-polished Pasteur pipette.
Electrophysiology
Detrusor myocytes were placed into a 0.5 ml electrophysiology chamber and left to settle and adhere to the bottom for 20-30 min prior to recording with the perforated-patch configuration at 22 °C (Horn & Marty, 1988). The bath and pipette solutions contained the following (mM): 134 NaCl, 6 KCl, 1 MgCl2, 2 CaCl2, 10 glucose and 10 Hepes, pH 7.4 (NaOH), and 110 potassium aspartate, 30 KCl, 10 NaCl, 1 MgCl2, 0.05 EGTA, 200 µg ml-1 amphotercin B and 10 Hepes, pH 7.2 (KOH), respectively. Tetraethylammonium chloride (TEA+) and 4-aminopyridine (4-AP) were obtained from Sigma, dissolved in bath solution and maintained at a pH of 7.4. The effects of blockers were tested by Student's paired t test and deemed significant when a P < 0.05 was obtained. The average whole-cell capacitance and series resistance of the UBSM myocytes used in this study was 45.3 ± 2.9 pF and 12.2 ± 0.7 M
, respectively (n = 21).
Molecular biology
Myocytes were isolated as described above and left to settle at the bottom of the chamber for 5 min, prior to individual selection by suction into a wide-bore pipette. UBSM myocytes were then expelled into a 1.5 ml conical tube and pelleted at 1000 g. A Poly-A-Pure kit (Ambion, Austin, TX, USA) was utilized to isolate mRNA from mouse brain and UBSM tissue, as well as from enzymatically isolated UBSM myocytes. Primers for Kv2.1 and Kv2.2 were essentially as described by Epperson et al. (1999). Primers for Kv5.1, Kv6.1, Kv6.2 and Kv6.3 were designed based on the sequences of multiple species present in GenBank and aligned utilizing Multi Alin (Corpet, 1988). Primer pair sequences used are as follows: Kv2.1 TGGACATCGTGGTGGAGAA, CAGATA CTCTGATCCCGAG (1192 base pairs, bp); Kv2.2 GAACTCCGA GACTGTAACACG, CAACTCATTGTAACTCCGCCTG (820 bp); Kv5.1 GCGAAGACATTGAGATCGTG, CGTCCAAGATGAGC TGCAC (393 bp); Kv6.1 CTGGACAGCGAGGATCAAG, TAC CATGTCTCCGTAGCCT (731 bp); Kv6.2 CGAACGTGTACT GTCATCA, GCTCGTGCACCTGGCTG (309 bp); Kv6.3 CAC TAGAAAGTGCTATTACAT, CAGGGACCAGATCATCTACG (731 bp). The PCR annealing temperature for each primer pair was optimized using a Mastercycler Gradient thermocycler (Eppendorf, Hamburg, Germany). RT-PCR was performed using the Retroscript kit in conjunction with SuperTaq Plus (Ambion). Thirty-five cycles were used for detection from tissue samples and 45 cycles were used for isolated myocyte experiments.
| RESULTS |
|---|
|
|
|---|
Identification of UBSM voltage-gated K+ current
To separate IK(V) from potassium currents through large-conductance (BKCa) and small-conductance (SKCa) Ca2+-activated channels, iberiotoxin (100 nM) and apamin (1 µM) were present in all recording solutions. Membrane potential depolarizations from a holding potential of -70 mV evoked an outward current at potentials positive to approximately -40 mV. Figure 1A shows representative whole-cell currents elicited by voltage steps to potentials between -70 and +30 mV. The outward current did not exhibit significant decay or inactivation during the 250 ms voltage steps. Prominent and slowly deactivating tail currents were recorded upon repolarization to -40 mV. Figure 1B and C shows average current-voltage plots of end pulse-current and peak tail-current amplitudes, respectively (n = 12). The voltage-dependent current demonstrated K+ selectivity, as changing [K+]o from 6 to 140 mM decreased outward current amplitude from 6.5 ± 0.8 pA pF-1 (6 mM K+) to 2.4 ± 0.9 pA pF-1 (140 mM K+) at +30 mV, and caused the appearance of large deactivating inward tail currents upon repolarization to -70 mV (n = 3). The rate of activation of the IK(V) increased with membrane depolarization, exhibiting a time constant of 35.6 ± 2.7 ms at +20 mV (n = 9; Fig. 1D), corresponding to the peak of the UBSM action potential. As is evident in Fig. 1A, the current deactivated slowly when repolarized to -40 mV, close to the membrane potential observed during the after-hyperpolarization phase of the action potential (Fujii et al. 1990; Heppner et al. 1997). The deactivation time constant at -40 mV was determined to be 131 ± 10 ms (n = 12; Table 1).

![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 1. UBSM whole-cell voltage-gated K+ current A, representative recording from a UBSM myocyte of whole-cell currents elicited by 250 ms depolarizing steps from a holding potential of -70 mV to potentials between -70 and +30 mV. B and C, average end pulse and tail current current-voltage plots, respectively, expressed as current densities (n = 12). D, activation time constants as a function of membrane potential (n = 9). | ||
IK(V) availability
To estimate the steady-state availability of the UBSM IK(V), a double-pulse protocol was utilized (Fig. 2). The membrane potential was stepped from a holding potential of -80 mV to potentials between -120 and + 10 mV for 15 s (at the end of which current inactivation has essentially reached a steady state), prior to stepping to +10 mV for 250 ms to determine the current available at the end of each preceding pulse. The IK(V) inactivated very slowly even at positive membrane potentials. At +20 mV, the current decayed with an inactivation time constant of 3.4 ± 0.2 s (n = 11; Table 1). Steady-state inactivation increased steeply with membrane depolarization, exhibiting a slope factor (k) of 11.9 ± 1.2 mV. The midpoint of the inactivation curve was -61.4 ± 1.2 mV (n = 6; Fig. 2C, squares). The UBSM IK(V) did not completely inactivate, reaching a maximum steady state of inactivation at approximately -30 mV, with 14 % of the total current remaining available. These results indicate that the IK(V) reaches maximal steady state inactivation within the range of the resting membrane potential reported for UBSM (between -30 mV and -40 mV; Callahan & Creed, 1981; Fujii et al. 1990; Heppner et al. 1997; Petkov et al. 2001).
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 2. UBSM IK(v) availability A, representative recording from a UBSM myocyte of whole-cell currents elicited by 15 s depolarizing pulses from a holding potential of -80 mV to potentials between -120 and +10 mV, followed by a 250 ms step to +10 mV. B, amplified view of the second voltage pulse to +10 mV shown in A. C, UBSM IK(V) steady-state activation curve plotted as normalized tail current amplitudes from Fig. 1C ( | ||
Steady-state activation properties of the IK(V) were determined from the voltage dependence of the tail currents (Fig. 1C). The activation curve had a midpoint (V0.5) and slope factor (k) of 1.1 ± 1.3 mV and 13.7 ± 1.0 mV (n = 12), respectively (Fig. 2C, circles). Therefore, membrane depolarization from the resting membrane potential to approximately +20 mV, as occurs during the action potential (Callahan & Creed, 1981; Fujii et al. 1990; Heppner et al. 1997; Petkov et al. 2001) should cause a significant increase in IK(V) (~ 10.5-fold, see Discussion).
IK(V) pharmacology
The ability of the KV blockers TEA+ and 4-AP to inhibit the UBSM IK(V) was assessed. TEA+ caused a dose-dependent block of the current with an IC50 of 5.2 mM (Fig. 3). In contrast, the UBSM IK(V) was insensitive to 0.5 and 1 mM 4-AP (Fig. 3C), and demonstrated a potentiation of end pulse-current and peak tail-current amplitudes with concentrations of 5 and 10 mM 4-AP (Fig. 3). Potentiation by 10 mM 4-AP did not alter the steady-state activation properties (control, V0.5 = 2.3 ± 2.8 mV, k = 13.2 ± 2.2 mV; 10 mM 4-AP, V0.5 = -1.0 ± 1.8 mV, k = 11.9 ± 1.8 mV), the activation time constants (control, 26.0 ± 3.0 ms; 10 mM 4-AP, 22.8 ± 2.6 ms at +30 mV) or the deactivation time constants (control, 150 ± 29 ms; 10 mM 4-AP, 112 ± 13 ms at -40 mV) of the current (P > 0.05, n = 6).
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 3. TEA+ and 4-AP sensitivity of UBSM IK(V) A and B, representative recordings of the effect of 5 mM TEA+ and 5 mM 4-AP, respectively, on UBSM IK(V) whole-cell current. The voltage protocol used is the same as in Fig. 1A. C, dose-response curves for TEA+ and 4-AP. We found no effect of 0.5 and 1 mM 4-AP (n = 3, P > 0.05), potentiation by 5 and 10 mM 4-AP (n = 3 and 6, respectively, P < 0.05) and inhibition at all concentrations of TEA+ IC50 5.2 mM (n = 3-8, P < 0.05). | ||
Molecular basis of the UBSM IK(V)
The pharmacological and biophysical properties of the UBSM IK(V) are inconsistent with the reported properties for Kv1, Kv3 (Tables 1-3) and Kv4 currents (Fiset et al. 1997; Nerbonne, 2000). The properties more closely resemble currents attributable to the expression of subunits forming Kv2 channels (Tables 1-3). These properties include block by low millimolar TEA+, slow deactivation and negative steady-state inactivation (Tables 1-3). We therefore performed RT-PCR on mouse UBSM to determine the expression pattern of the Kv2 channel subunits that form channels consistent with the properties of the UBSM IK(V). We used subunit-selective primers for Kv2.1, Kv2.2, and for modulatory subunits Kv5.1, Kv6.1, Kv6.2 and Kv6.3, which do not form functional channels when expressed alone (Post et al. 1996; Salinas et al. 1997; Kramer et al. 1998; Ottschytsch et al. 2002). RT-PCR experiments were performed using mRNA isolated from UBSM tissue dissected free of the urothelium and connective tissue. The expression of mRNA for all six subunits Kv2.1, Kv2.2, Kv5.1, Kv6.1, Kv6.2 and Kv6.3 was detected in UBSM tissue, and in the mouse brain tissue that was used as a positive control (Fig. 4A-F, respectively). Negative control experiments performed in the absence of the reverse transcriptase enzyme (-RT, Fig. 4) demonstrated an absence of the specifically amplified products. All UBSM PCR products were sequenced directly to confirm their identity and are consistent with results obtained in at least three of these experiments.
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 4. RT-PCR for Kv2 subunits from mouse brain and UBSM tissue A, Kv2.1, 1192 bp. B, Kv2.2, 820 bp. C, Kv5.1, 393 bp. D, Kv6.1, 731 bp. E, Kv6.2, 309 bp. F, Kv6.3, 731 bp. All products were obtained in both brain and bladder tissues when the reverse transcriptase enzyme was included (+RT), but not when the enzyme was left out of the reaction (-RT). | ||
Due to the presence of other contaminating cell types within the detrusor muscle layer, such as neurons, vascular myocytes, endothelial cells and fibroblasts, which may lead to the detection of subunits expressed in cell types other than UBSM, we also performed RT-PCR on freshly isolated UBSM myocytes. UBSM myocytes were individually selected by the same criteria used for electrophysiological experiments, and mRNA was isolated for RT-PCR. UBSM myocytes were determined to express mRNA for Kv2.1, Kv5.1, Kv6.1, Kv6.2 and Kv6.3 (Fig. 5). Kv2.2 channel subunit mRNA was not detected in isolated myocytes, even after the initial PCR sample was subjected to a second round of amplification. A lack of genomic DNA contamination in mRNA isolated from myocytes was confirmed by RT-PCR for glyceraldehyde phosphate dehydrogenase (GAPDH), which was not observed in control reactions lacking the reverse transcriptase enzyme (-RT, Fig. 5C). RT-PCR products from UBSM myocytes were sequenced to confirm their identity and were obtained from at least three separate cell preparations that included myocytes from two mice each. These results demonstrate that UBSM expresses mRNA for Kv2.1, Kv5.1, Kv6.1, Kv6.2 and Kv6.3.
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 5. RT-PCR for Kv2 subunits from UBSM myocytes A, Kv2.1, 1192 bp; Kv6.1, 731 bp; Kv6.2, 309 bp; Kv6.3, 731 bp. B, Kv5.1, 393 bp. C, GAPDH was obtained when the reverse transcriptase enzyme was included (+RT), but not when the enzyme was left out of the reaction (-RT). | ||
| DISCUSSION |
|---|
|
|
|---|
Physiological role of KV in UBSM
KV play a central role in nerve and muscle (Cole & Clement-Chomienne, 2000; Nerbonne, 2000; Vincent et al. 2000). Despite the potential importance of KV in UBSM, little is known about their properties. Here we provide the first biophysical, pharmacological and molecular characterization of IK(V) in mouse UBSM. The IK(V) has a number of unique characteristics that suggest roles in regulating the resting membrane potential, action potential repolarization and after-hyperpolarization.
The resting membrane potential of UBSM has been reported to be between -40 and -30 mV, and UBSM action potentials are brief (~10-25 ms), with a peak of approximately +20 mV (Callahan & Creed, 1981; Fujii et al. 1990; Heppner et al. 1997; Petkov et al. 2001). Action potentials are followed by relatively long after-hyperpolarizations lasting hundreds of milliseconds (Callahan & Creed, 1981; Fujii et al. 1990; Heppner et al. 1997; Petkov et al. 2001). Figure 6 shows the average IK(V) magnitude in a UBSM myocyte at different time points during a typical action potential. Based on the data reported here at a resting potential of -30 mV, the steady-state IK(V) would be approximately 2 pA (Fig. 6). Membrane potential depolarization from -30 to +20 mV should increase the IK(V) to ~21 pA at 25 ms after depolarization (Fig. 6). This increase in KV activity, along with the increase in BKCa activity, and inactivation of voltage-dependent Ca2+ channels would contribute to the repolarization of the action potential. However, unlike BKCa, the rate of deactivation of KV is slow in UBSM (time constant of 131 ms at -40 mV). Thus, it is anticipated that the IK(V) should decrease slowly and should contribute to the after-hyperpolarization, decaying along a similar time course to the after-hyperpolarization recovery (Fig. 6).
![]() |
View larger version [in this window] [in a new window] |
|
|
Figure 6. IK(V) magnitude during the UBSM action potential Average UBSM myocyte IK(V) at different time points during a typical UBSM action potential ( | ||
Pharmacology of UBSM IK(V)
The mouse UBSM IK(V) is sensitive to block by TEA+ with an IC50 of 5.2 mM, insensitive to 1 mM 4-AP and is activated by 5 and 10 mM 4-AP. The outward K+ current in guinea-pig UBSM myocytes is also sensitive to TEA+ (20 mM) and is not blocked by 4-AP (5 mM; Klockner & Isenberg, 1985). These experiments on guinea-pig UBSM were performed in the absence of large- and small-conductance K+ channel blockers, and therefore did not discriminate between different types of K+ channels. Nonetheless, this study demonstrated that 20 mM TEA+ almost entirely blocked the outward K+ current, while 5 mM 4-AP had no effect. In contrast, human UBSM IK(V) is blocked by 1 mM 3,4-diaminopyridine, suggesting a potential role for Kv1 channels in mediating the current (Davies et al. 2002). The lack of 4-AP block demonstrated here for the mouse UBSM IK(V) is consistent with the lack of effect reported for the guinea-pig outward K+ current, but is inconsistent with the reported block by 3,4-diaminopyridine of the human IK(V) and may represent species-specific differences in UBSM IK(V) properties.
In mouse colonic myocytes, two components of the IK(V) have been documented, a transient outward component and a delayed rectifier component (Koh et al. 1999). 4-AP blocks the transient outward component while increasing the delayed rectifier. The colonic delayed-rectifier component is sensitive to TEA+ and demonstrates a half-maximal steady-state inactivation of -58 mV (Koh et al. 1999). These are properties similar to those reported here for the UBSM IK(V). In addition, a similar IK(V) activated by 4-AP has been demonstrated in gastric (Amberg et al. 2002) and in myometrial smooth muscle cells (Knock et al. 1999). Therefore, the delayed-rectifier IK(V) observed in colonic, gastric and myometrial smooth muscle cells bears some similarity to the UBSM IK(V). The lack of 4-AP block reported here for the mouse UBSM IK(V) strongly argues against the participation of Kv1 channels underlying the current.
Molecular nature of UBSM IK(V)
The biophysical and pharmacological properties of the mouse UBSM IK(V) are inconsistent with the reported properties of the Kv1, Kv3 (Tables 1-3) and Kv4 (Fiset et al. 1997; Nerbonne, 2000) family members. The UBSM IK(V) is slowly inactivating (C-type, time constant 3.4 s at +20 mV) and therefore is not mediated by fast-inactivating (A-type, time constants < 200 ms) KV channel subunits Kv1.4, Kv1.7 (Kalman et al. 1998; Nerbonne 2000), Kv3.3, Kv3.4 (Rudy et al. 1999) Kv4.1, Kv4.2 or Kv4.3 (Fiset et al. 1997; Nerbonne, 2000). The slowly inactivating Kv3 family members Kv3.1 and Kv3.2 are blocked by 4-AP and by TEA+, both with an IC50 of less than 200 µM, which is inconsistent with the UBSM IK(V) pharmacology (Table 3). Kv3.1 and Kv3.2 channels also demonstrate faster activation and deactivation kinetics (Table 1) as well as a more positive activation threshold (~-10 mV) than the UBSM IK(V) (reviewed by Rudy et al. 1999). Kv1.2 and Kv1.5 have been implicated as mediators of the 4-AP-sensitive current in vascular (Kerr et al. 2001; Thorneloe et al. 2001) and gastrointestinal (Hart et al. 1993; Overturf et al. 1994) smooth muscles. Kv1 family members are 4-AP sensitive at submillimolar IC50 values (Table 3; Stuhmer et al. 1989; Grissmer et al. 1994; Cole & Clement-Chomienne, 2000); this is in contrast to the UBSM IK(V), which is not inhibited by 1 mM 4-AP (Fig. 3). Kv1 family members also demonstrate steady-state inactivation at more positive membrane potentials and faster activation and deactivation kinetics than the UBSM IK(V) (Tables 1 and 2; Stuhmer et al. 1989; Martel et al. 1998).
It has been shown that Kv2.1 is the predominant KV channel isoform expressed in rat urinary bladder. Kv2.1 mRNA expression was determined to be approximately 24-fold higher than the combined expression levels of the other mRNA detected, that of Kv1.2 and Kv1.5 (Ohya et al. 2000). Homomultimeric channels formed by Kv2 family subunits Kv2.1 and Kv2.2 have reported IC50 values for TEA+ and 4-AP block in the ranges of 2-8 mM and 1-17 mM, respectively (Table 3). The TEA+ sensitivity of Kv2.1 and Kv2.2 homomultimers is consistent with the IC50 for TEA+ block of UBSM IK(V) reported here of 5.2 mM (Table 3). However, steady-state inactivation, deactivation kinetics and lack of block by 4-AP of the UBSM IK(V) are inconsistent with homomultimeric channels formed by Kv2.1 or Kv2.2 (Tables 1-3).
More recently, electrically silent Kv subunit families Kv5-Kv11 have been discovered that do not form functional channels when expressed on their own, but co-assemble with Kv2.1 and Kv2.2 subunits to produce channels that are distinct from those formed by Kv2.1 or Kv2.2 alone (Post et al. 1996; Patel et al. 1997; Salinas et al. 1997; Kramer et al. 1998; Ottschytsch et al. 2002). Kv5 and Kv6 are members of the electrically silent families that are capable of evoking a large negative shift in the steady-state inactivation of Kv2.1- and Kv2.2-containing channels (Salinas et al. 1997; Kramer et al. 1998; Ottschytsch et al. 2002; Table 2). The half-maximal steady-state inactivation values reported for these heteromultimeric channels are consistent with the value of -61 mV reported here for the UBSM IK(V) (Table 2). Steady-state activation of the UBSM IK(V) demonstrates a half-maximal value of 1.1 mV, which is mid-range of that reported for Kv2.1 (between 10 mV and -1.7 mV), is more negative than Kv2.1/Kv5.1 (18 mV) and is more positive than Kv2.1/Kv6.1 (-9.4 mV; Table 2). It seems possible that the half-maximal steady-state activation value of a given heteromultimeric channel will be dependent on the stoichiometry of Kv2.1, Kv5.1 and Kv6.1 channel subunits.

Kv5 and Kv6 subunits slow the deactivation kinetics of Kv2 channels, yielding deactivation time constants similar to the value for the UBSM IK(V) of 131 ms at -40 mV (Table 1). The activation time constant of heteromultimeric channels composed of Kv2.1 and Kv6.1 subunits (29 ms at +30 mV) is the same as that reported here for the UBSM IK(V), whereas Kv2.1/Kv5.1 heteromultimeric and Kv2.1 homomultimeric channels are faster activating (Table 1). The inactivation time constant of the UBSM IK(V) (3.4 s at +20 mV) is similar to Kv2.1 and Kv2.1/Kv5.1 (~3 s) and faster than Kv2.1/Kv6.1 (~11.5 s). Together, the inactivation, activation and deactivation kinetics of UBSM IK(V) demonstrate similarities to those reported for heteromultimeric channels composed of Kv2.1 and Kv5 or Kv6 family members (Table 1), which we have demonstrated by RT-PCR to be expressed in UBSM myocytes (Fig. 5). To the best of our knowledge this is the first documented expression of Kv5 and Kv6 family members in smooth muscle. It has been suggested that Kv2.1 channels exhibit reduced sensitivity to 4-AP when co-expressed with Kv6.2 (Zhu et al. 1999). Therefore, heteromultimeric assembly of Kv2.1 with Kv6 subunits could account for the lack of 4-AP inhibition of the UBSM IK(V) observed here (Fig. 3).
In summary, we propose that the UBSM IK(V) reflects K+ efflux through heteromultimeric channel assemblies of Kv2.1 and Kv5.1 and/or Kv6 subunits. This proposal is based on: (1) the similar biophysical properties of the UBSM whole-cell IK(V) compared to expressed heteromultimeric channels composed of Kv2.1 and Kv5.1 and/or Kv6 subunits (Fig. 1 and Fig. 2, Tables 1 and 2); (2) the lack of IK(V) block by the Kv2.1 homomultimeric blocker 4-AP (Fig. 3) and (3) the expression of Kv2.1, Kv5.1, Kv6.1, Kv6.2 and Kv6.3 in isolated UBSM myocytes (Fig. 5). Furthermore, we propose that the unique kinetic properties of this current enable it to contribute to the resting membrane potential, as well as to the repolarization and after-hyperpolarization phases of the action potential (Fig. 6).
| REFERENCES |
|---|
|
|
|---|
| Aiello EA, Walsh MP & Cole WC (1995). Phosphorylation by protein kinase A enhances delayed rectifier K+ current in rabbit vascular smooth muscle cells. Am J Physiol 268, H926-934 | [Medline] |
| Amberg GC, Baker SA, Koh SD, Hatton WJ, Murray KJ, Horowitz B & Sanders KM (2002). Characterization of the A-type potassium current in murine gastric antrum. J Physiol 544, 417-428 | [Abstract/Full Text] |
| Beech DJ & Bolton TB (1989). Two components of potassium current activated by depolarization of single smooth muscle cells from the rabbit portal vein. J Physiol 418, 293-309 | [Abstract] |
| Bonev AD & Nelson MT (1993). Muscarinic inhibition of ATP-sensitive K+ channels by protein kinase C in urinary bladder smooth muscle. Am J Physiol 265, C1723-1728 | [Medline] |
| Boyle JP, Tomasic M & Kotlikoff MI (1992). Delayed rectifier potassium channels in canine and porcine airway smooth muscle cells. J Physiol 447, 329-350 | [Abstract] |
| Callahan SM & Creed KE (1981). Electrical and mechanical activity of the isolated lower urinary tract of the guinea-pig. Br J Pharmacol 74, 353-358 | [Abstract] |
| Carl A, (1995). Multiple components of delayed rectifier K+ current in canine colonic smooth muscle. J Physiol 484, 339-353 | [Abstract] |
| Clement-Chomienne O, Ishii K, Walsh MP & Cole WC (1999). Identification, cloning and expression of rabbit vascular smooth muscle Kv1. 5 and comparison with native delayed rectifier K+ current. J Physiol 515, 653-667 | [Abstract/Full Text] |
| Cole WC & Clement-Chomienne O (2000). Properties, regulation and role of potassium channels in smooth muscle. In Advances in Organ Biology, vol. 8, ed. Barr L & Christ GJ, pp. 247-317. JAI Press, Stamford, Connecticut, USA | |
| Corpet F, (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16, 10881-10890 | [Abstract] |
| Critz SD, Wible BA, Lopez HS & Brown AM (1993). Stable expression and regulation of a rat brain K+ channel. J Neurochem 60, 1175-1178 | [Abstract] |
Davies AM, Batchelor TJ, Eardley I & Beech DJ (2002). Potassium channel Kv 1 subunit expression and function in human detrusor muscle. J Urol 167, 1881-1886 |
[Medline] |
Epperson A, Bonner HP, Ward SM, Hatton WJ, Bradley KK, Bradley ME, Trimmer JS & Horowitz B (1999). Molecular diversity of Kv - and -subunit expression in canine gastrointestinal smooth muscles. Am J Physiol 277, G127-136 |
[Medline] |
| Fiset C, Clark RB, Shimoni Y & Giles WR (1997). Shal-type channels contribute to the Ca2+-independent transient outward K+ current in rat ventricle. J Physiol 500, 51-64 | [Abstract] |
| Fujii K, Foster CD, Brading AF & Parekh AB (1990). Potassium channel blockers and the effects of cromakalim on the smooth muscle of the guinea-pig bladder. Br J Pharmacol 99, 779-785 | [Abstract] |
| Grissmer S, Nguyen AN, Aiyar J, Hanson DC, Mather RJ, Gutman GA, Karmilowicz MJ, Auperin DD & Chandy KG (1994). Pharmacological characterization of five cloned voltage-gated K+ channels, types Kv1. 1, 1.2, 1.3, 1.5, and 3.1, stably expressed in mammalian cell lines. Mol Pharmacol 45, 1227-12234 | |
| Hart PJ, Overturf KE, Russell SN, Carl A, Hume JR, Sanders KM & Horowitz B (1993). Cloning and expression of a Kv1. 2 class delayed rectifier K+ channel from canine colonic smooth muscle. Proc Natl Acad Sci U S A 90, 9659-9663 | [Abstract] |
| Heppner TJ, Bonev AD & Nelson MT (1997). Ca2+-activated K+ channels regulate action potential repolarization in urinary bladder smooth muscle. Am J Physiol 273, C110-117 | [Medline] |
| Horn R & Marty A (1988). Muscarinic activation of ionic currents measured by a new whole-cell recording method. J Gen Physiol 92, 145-159 | [Abstract] |
| Hulme JT, Coppock EA, Felipe A, Martens JR & Tamkun MM (1999). Oxygen sensitivity of cloned voltage-gated K+ channels expressed in the pulmonary vasculature. Circ Res 85, 489-497 | [Abstract/Full Text] |
| Hwang PM, Glatt CE, Bredt DS, Yellen G & Snyder SH (1992). A novel K+ channel with unique localizations in mammalian brain: molecular cloning and characterization. Neuron 8, 473-481 | [Medline] |
| Jaggar JH, Mawe GM & Nelson MT (1998). Voltage-dependent K+ currents in smooth muscle cells from mouse gallbladder. Am J Physiol 274, G687-693 | [Medline] |
| Jarolimek W, Soman KV, Alam M & Brown AM (1996). Structure-activity relationship of quaternary ammonium ions at the external tetraethylammonium binding site of cloned potassium channels. Mol Pharmacol 49, 165-171 | [Abstract] |
| Kalman K, Nguyen A, Tseng-Crank J, Dukes ID, Chandy G, Hustad CM, Copeland NG, Jenkins NA, Mohrenweiser H, Brandriff B, Cahalan M, Gutman GA, Chandy KG (1998). Genomic organization, chromosomal localization, tissue distribution, and biophysical characterization of a novel mammalian Shaker-related voltage-gated potassium channel, Kv1. 7. J Biol Chem 273, 5851-5857 | [Abstract/Full Text] |
| Karicheti V & Christ GJ (2001). Physiological roles for K+ channels and gap junctions in urogenital smooth muscle: implications for improved understanding of urogenital function, disease and therapy. Curr Drug Targets 2, 1-20 | [Medline] |
| Kerr PM, Clement-Chomienne O, Thorneloe KS, Chen TT, Ishii K, Sontag DP, Walsh MP & Cole WC (2001). Heteromultimeric Kv1. 2-Kv1.5 channels underlie 4-aminopyridine-sensitive delayed rectifier K+ current of rabbit vascular myocytes. Circ Res 89, 1038-1044 | [Abstract/Full Text] |
| Kirsch GE & Drewe JA (1993). Gating-dependent mechanism of 4-aminopyridine block in two related potassium channels. J Gen Physiol 102, 797-816 | [Abstract] |
| Klockner U & Isenberg G (1985). Action potentials and net membrane currents of isolated smooth muscle cells (urinary bladder of the guinea-pig). Pflugers Arch 405, 329-339 | [Medline] |
| Knock GA, Smirnov SV & Aaronson PI (1999). Voltage-gated K+ currents in freshly isolated myocytes of the pregnant human myometrium. J Physiol 518, 769-781 | [Abstract/Full Text] |
| Koh SD, Ward SM, Dick GM, Epperson A, Bonner HP, Sanders KM, Horowitz B & Kenyon JL (1999). Contribution of delayed rectifier potassium currents to the electrical activity of murine colonic smooth muscle. J Physiol 515, 475-487 | [Abstract/Full Text] |
| Kramer JW, Post MA, Brown AM & Kirsch GE (1998). Modulation of potassium channel gating by coexpression of Kv2. 1 with regulatory Kv5.1 or Kv6.1 alpha-subunits. Am J Physiol 274, C1501-1510 | [Medline] |
| Martel J, Dupuis G, Deschenes P & Payet MD (1998). The sensitivity of the human Kv1. 3 (hKv1.3) lymphocyte K+ channel to regulation by PKA and PKC is partially lost in HEK 293 host cells. J Membr Biol 161, 183-196 | [Medline] |
| Nelson MT & Quayle JM (1995). Physiological roles and properties of potassium channels in arterial smooth muscle. Am J Physiol 268, C799-822 | [Medline] |
| Nerbonne JM, (2000). Molecular basis of functional voltage-gated K+ channel diversity in the mammalian myocardium. J Physiol 525, 285-298 | [Abstract/Full Text] |
| Ohya S, Tanaka M, Watanabe M & Maizumi Y (2000). Diverse expression of delayed rectifier K+ channel subtype transcripts in several types of smooth muscles of the rat. J Smooth Muscle Res 36, 101-115 | [Medline] |
| Ottschytsch N, Raes A, Van Hoorick D & Snyders DJ (2002). Obligatory heterotetramerization of three previously uncharacterized Kv channel alpha-subunits identified in the human genome. Proc Natl Acad Sci U S A 99, 7986-7991 | [Abstract/Full Text] |
| Overturf KE, Russell SN, Carl A, Vogalis F, Hart PJ, Hume JR, Sanders KM & Horowitz B (1994). Cloning and characterization of a Kv1. 5 delayed rectifier K+ channel from vascular and visceral smooth muscles. Am J Physiol 267, C1231-1238 | [Medline] |
| Patel AJ, Lazdunski M & Honore E (1997). Kv2. 1/Kv9.3, a novel ATP-dependent delayed-rectifier K+ channel in oxygen-sensitive pulmonary artery myocytes. EMBO J 16, 6615-6625 | |
| Payne CK, (1999). Advances in nonsurgical treatment of urinary incontinence and overactive bladder. Campbell's Urol Updates 1, 3-14 | |
| Petkov GV, Heppner TJ, Bonev AD, Herrera GM & Nelson MT (2001). Low levels of KATP channel activation decrease excitability and contractility of urinary bladder. Am J Physiol Integr Comp Physiol 280, R1427-1433 | |
| Post MA, Kirsch GE & Brown AM (1996). Kv2. 1 and electrically silent Kv6.1 potassium channel subunits combine and express a novel current. FEBS Lett 399, 177-182 | [Medline] |
| Robertson BE & Nelson MT (1994). Aminopyridine inhibition and voltage dependence of K+ currents in smooth muscle cells from cerebral arteries. Am J Physiol 267, C1589-1597 | [Medline] |
| Rudy B, Chow A, Lau D, Amarillo Y, Ozaita A, Saganich M, Moreno H, Nadal MS, Hernandez-Pineda R, Hernandez-Cruz A, Erisir A, Leonard C & Vega-Saenz De Miera E (1999). Contributions of Kv3 channels to neuronal excitability. Ann N Y Acad Sci 868, 304-343 | [Abstract/Full Text] |
| Russell SN, Overturf KE & Horowitz B (1994). Heterotetramer formation and charybdotoxin sensitivity of two K+ channels cloned from smooth muscle. Am J Physiol 267, C1729-1733 | [Medline] |
Salinas M, Duprat F, Heurteaux C, Hugnot JP & Lazdunski M (1997). New modulatory subunits for mammalian Shab K+ channels. J Biol Chem 272, 24371-24379 |
[Abstract/Full Text] |
| Schmalz F, Kinsella J, Koh SD, Vogalis F, Schneider A, Flynn ER, Kenyon JL & Horowitz B (1998). Molecular identification of a component of delayed rectifier current in gastrointestinal smooth muscles. Am J Physiol 274, G901-911 | [Medline] |
| Shi G, Kleinklaus AK, Marrion NV & Trimmer JS (1994). Properties of Kv2. 1 K+ channels expressed in transfected mammalian cells. J Biol Chem 269, 23204-23211 | [Abstract] |
| Smirnov SV, Beck R, Tammaro P, Ishii T & Aaronson PI (2002). Electrophysiologically distinct smooth muscle cell subtypes in rat conduit and resistance pulmonary arteries. J Physiol 538, 867-878 | [Abstract/Full Text] |
| Stuhmer W, Ruppersberg JP, Schroter KH, Sakmann B, Stocker M, Giese KP, Perschke A, Baumann A & Pongs O (1989). Molecular basis of functional diversity of voltage-gated potassium channels in mammalian brain. EMBO J 8, 3235-3244 | [Abstract] |
| Thorneloe KS, Chen TT, Kerr PM, Grier EF, Horowitz B, Cole WC & Walsh MP (2001). Molecular composition of 4-aminopyridine-sensitive voltage-gated K+ channels of vascular smooth muscle. Circ Res 89, 1030-1037 | [Abstract/Full Text] |
| Vincent A, Lautermilch NJ & Spitzer NC (2000). Antisense suppression of potassium channel expression demonstrates its role in maturation of the action potential. J Neurosci 20, 6087-6094 | [Abstract/Full Text] |
| Waldron GJ, Sigurdsson SB, Aiello EA, Halayko AJ, Stephens NL & Cole WC (1998). Delayed rectifier K+ current of dog bronchial myocytes: effect of pollen sensitization and PKC activation. Am J Physiol 275, L336-347 | [Medline] |
| Yue L, Wang Z, Rindt H & Nattel S (2000). Molecular evidence for a role of Shaw (Kv3) potassium channel subunits in potassium currents of dog atrium. J Physiol 527, 467-478 | [Abstract/Full Text] |
Zhu XR, Netzer R, Bohlke K, Liu Q & Pongs O (1999). Structural and functional characterization of Kv6. 2 a new -subunit of voltage-gated potassium channel. Receptors Channels 6, 337-350 |
[Medline] |
Acknowledgements
This study was supported by a National Institutes of Health (NIH) grant to M.T.N. (NIH DK53832). K.S.T. was the recipient of an Alberta Heritage Foundation for Medical Research (AHFMR) Fellowship and a Heart and Stroke Foundation of Canada Fellowship. We thank Dr T. Heppner for helpful discussions on UBSM action potentials. We thank Dr G. Herrera and Dr G. Petkov for critical comments on the manuscript.
This article has been cited by other articles:
![]() |
S. M. Brown, L. M. Bentcheva-Petkova, L. Liu, K. L. Hristov, M. Chen, W. F. Kellett, A. L. Meredith, R. W. Aldrich, M. T. Nelson, and G. V. Petkov {beta}-Adrenergic relaxation of mouse urinary bladder smooth muscle in the absence of large-conductance Ca2+-activated K+ channel Am J Physiol Renal Physiol, October 1, 2008; 295(4): F1149 - F1157. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Layne, M. Werner, D. Hill-Eubanks, and M. Nelson NFATc3 regulates BK channel function in murine urinary bladder smooth muscle Am J Physiol Cell Physiol, September 1, 2008; 295(3): C611 - C623. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Thorneloe, A. C. Sulpizio, Z. Lin, D. J. Figueroa, A. K. Clouse, G. P. McCafferty, T. P. Chendrimada, E. S. R. Lashinger, E. Gordon, L. Evans, et al. N-((1S)-1-{[4-((2S)-2-{[(2,4-Dichlorophenyl)sulfonyl]amino}-3-hydroxypropanoyl)-1-piperazinyl]carbonyl}-3-methylbutyl)-1-benzothiophene-2-carboxamide (GSK1016790A), a Novel and Potent Transient Receptor Potential Vanilloid 4 Channel Agonist Induces Urinary Bladder Contraction and Hyperactivity: Part I J. Pharmacol. Exp. Ther., August 1, 2008; 326(2): 432 - 442. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Thorneloe, A. M. Knorn, P. E. Doetsch, E. S. R. Lashinger, A. X. Liu, C. T. Bond, J. P. Adelman, and M. T. Nelson Small-conductance, Ca2+-activated K+ channel 2 is the key functional component of SK channels in mouse urinary bladder Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2008; 294(5): R1737 - R1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Guan, T. Tkatch, D. J. Surmeier, W. E. Armstrong, and R. C. Foehring Kv2 subunits underlie slowly inactivating potassium current in rat neocortical pyramidal neurons J. Physiol., June 15, 2007; 581(3): 941 - 960. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Amberg and L. F. Santana Kv2 channels oppose myogenic constriction of rat cerebral arteries Am J Physiol Cell Physiol, August 1, 2006; 291(2): C348 - C356. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. V. Straub and M. T. Nelson Molecular Coding of Kv1 Channels to Oppose Myogenic Constriction Circ. Res., July 7, 2006; 99(1): 13 - 14. [Full Text] [PDF] |
||||
![]() |
N. Ottschytsch, A. L Raes, J.-P. Timmermans, and D. J Snyders Domain analysis of Kv6.3, an electrically silent channel J. Physiol., November 1, 2005; 568(3): 737 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Werner, P. Zvara, A. L. Meredith, R. W. Aldrich, and M. T. Nelson Erectile dysfunction in mice lacking the large-conductance calcium-activated potassium (BK) channel J. Physiol., September 1, 2005; 567(2): 545 - 556. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Thorneloe, A. L. Meredith, A. M. Knorn, R. W. Aldrich, and M. T. Nelson Urodynamic properties and neurotransmitter dependence of urinary bladder contractility in the BK channel deletion model of overactive bladder Am J Physiol Renal Physiol, September 1, 2005; 289(3): F604 - F610. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Herrera, B. Etherton, B. Nausch, and M. T. Nelson Negative feedback regulation of nerve-mediated contractions by KCa channels in mouse urinary bladder smooth muscle Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2005; 289(2): R402 - R409. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. V. Petkov and M. T. Nelson Differential regulation of Ca2+-activated K+ channels by {beta}-adrenoceptors in guinea pig urinary bladder smooth muscle Am J Physiol Cell Physiol, June 1, 2005; 288(6): C1255 - C1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tertyshnikova, R. J. Knox, M. J. Plym, G. Thalody, C. Griffin, T. Neelands, D. G. Harden, L. Signor, D. Weaver, R. A. Myers, et al. BL-1249 [(5,6,7,8-Tetrahydro-naphthalen-1-yl)-[2-(1H-tetrazol-5-yl)-phenyl]-amine]: A Putative Potassium Channel Opener with Bladder-Relaxant Properties J. Pharmacol. Exp. Ther., April 1, 2005; 313(1): 250 - 259. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Meredith, K. S. Thorneloe, M. E. Werner, M. T. Nelson, and R. W. Aldrich Overactive Bladder and Incontinence in the Absence of the BK Large Conductance Ca2+-activated K+ Channel J. Biol. Chem., August 27, 2004; 279(35): 36746 - 36752. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-E. Andersson and A. Arner Urinary Bladder Contraction and Relaxation: Physiology and Pathophysiology Physiol Rev, July 1, 2004; 84(3): 935 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Thorneloe and M. T. Nelson Properties of a tonically active, sodium-permeable current in mouse urinary bladder smooth muscle Am J Physiol Cell Physiol, June 1, 2004; 286(6): C1246 - C1257. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |