J Physiol Society Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 552, Number 1, 253-264, October 1, 2003 DOI: 10.1113/jphysiol.2003.048173
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
552/1/253    most recent
jphysiol.2003.048173v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Polotsky, V. Y.
Right arrow Articles by O'Donnell, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Polotsky, V. Y.
Right arrow Articles by O'Donnell, C. P.

J Physiol (2003), 552.1, pp. 253-264
© Copyright 2003 The Physiological Society
DOI: 10.1113/jphysiol.2003.048173

Intermittent hypoxia increases insulin resistance in genetically obese mice

Vsevolod Y. Polotsky, Jianguo Li, Naresh M. Punjabi, Arnon E. Rubin, Philip L. Smith, Alan R. Schwartz and Christopher P. O'Donnell

Department of Medicine, Division of Pulmonary and Critical Care Medicine, Johns Hopkins University, Baltimore, MD 21224, USA

  ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

Obstructive sleep apnoea, a syndrome that leads to recurrent intermittent hypoxia, is associated with insulin resistance in obese individuals, but the mechanisms underlying this association remain unknown. We utilized a mouse model to examine the effects of intermittent hypoxia on insulin resistance in lean C57BL/6J mice and leptin-deficient obese (C57BL/6J-Lepob) mice. In lean mice, exposure to intermittent hypoxia for 5 days (short term) resulted in a decrease in fasting blood glucose levels (from 173 ± 11 mg dl-1 on day 0 to 138 ± 10 mg dl-1 on day 5, P < 0.01), improvement in glucose tolerance without a change in serum insulin levels and an increase in serum leptin levels in comparison with control (2.6 ± 0.3 vs. 1.7 ± 0.2 ng ml-1, P < 0.05). Microarray mRNA analysis of adipose tissue revealed that leptin was the only upregulated gene affecting glucose uptake. In obese mice, short-term intermittent hypoxia led to a decrease in blood glucose levels accompanied by a 607 ± 136 % (P < 0.01) increase in serum insulin levels. This increase in insulin secretion after 5 days of intermittent hypoxia was completely abolished by prior leptin infusion. Obese mice exposed to intermittent hypoxia for 12 weeks (long term) developed a time-dependent increase in fasting serum insulin levels (from 3.6 ± 1.1 ng ml-1 at baseline to 9.8 ± 1.8 ng ml-1 at week 12, P < 0.001) and worsening glucose tolerance, consistent with an increase in insulin resistance. We conclude that the increase in insulin resistance in response to intermittent hypoxia is dependent on the disruption of leptin pathways.

(Received 27 May 2003; accepted after revision 23 July 2003; first published online 23 July 2003)
Corresponding author V. Y. Polotsky: Division of Pulmonary and Critical Care Medicine, Johns Hopkins Asthma and Allergy Center, 5501 Hopkins Bayview Circle, Baltimore, MD 21224, USA. Email: vpolots1{at}jhmi.edu

  INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

Obstructive sleep apnoea (OSA) is one of the most common complications of obesity. The prevalence of sleep-disordered breathing in individuals with a body mass index greater than 30 kg m-2 ranges from 40 % (apnoea-hypopnoea index (AHI) = 15 h-1) to 60 % (AHI = >=5 h-1; Punjabi et al. 2002). The syndrome of OSA is characterized by recurrent collapse of the upper airway during sleep leading to periods of intermittent hypoxia (IH) and fragmentation of sleep (Gastaut et al. 1966). Several cardiovascular complications have been attributed to OSA, including increased risk of systemic hypertension (Nieto et al. 2000; Peppard et al. 2000), coronary artery disease (Mooe et al. 2001; Shahar et al. 2001) and stroke (Shahar et al. 2001). Recent clinical studies suggest that insulin resistance and glucose intolerance are positively associated with OSA, independent of the degree of obesity (Strohl et al. 1994; Vgontzas et al. 2000; Ip et al. 2002; Punjabi et al. 2002). Moreover, the extent of insulin resistance was related to the severity of the hypoxic stress of OSA (Ip et al. 2002; Punjabi et al. 2002).

Although little is known about the effects of IH on metabolic function, some studies have addressed the changes in glucose and insulin homeostasis that occur during short- and long-term exposure to continuous hypoxia (i.e. high altitude). In general, short-term continuous hypoxia (2-3 days) causes acute insulin resistance (Larsen et al. 1997; Braun et al. 2001), whereas long-term continuous hypoxia (more than 6 weeks) reduces fasting blood glucose levels, but does not affect insulin resistance or glucose tolerance (Calderon et al. 1966; Davidson & Aoki, 1970; Larsen et al. 1997). The corresponding short-term and long-term effects of IH on metabolic function have not been studied previously. It is conceivable that the IH stimulus of OSA impairs glucose homeostasis and exacerbates the insulin resistance associated with obesity.

Obesity and OSA are likely to disrupt several metabolic pathways. One common pathway could involve leptin, an adipocyte-derived hormone that regulates satiety and metabolic rate (Zhang et al. 1994; Maffei et al. 1995; Considine et al. 1996; Friedman, 1998; Breslow et al. 1999), which is present in the circulation at levels that are in proportion to the degree of obesity (Considine et al. 1996) and the severity of OSA (Chin et al. 1999; Ip et al. 2000; Vgontzas et al. 2000). In addition to a CNS, or central, role in regulating food intake (Halaas et al. 1995; Schwartz et al. 1996), leptin can act peripherally to inhibit insulin secretion (Kulkarni et al. 1997; Seufert et al. 1999) and increase glucose uptake in vivo (Sivitz et al. 1997; Barzilai et al. 1997). The presence of inappropriately low levels of leptin for a given degree of adiposity has been associated with a high level of insulin resistance (Montague et al. 1997; Ravussin et al. 199; Farooqi et al. 20017). The degree of insulin resistance in obese patients with concomitant OSA may therefore be dependent on the circulating level of leptin.

The purpose of the current study was to examine the combined impact of IH and obesity on glucose tolerance and insulin resistance in the presence and absence of leptin. We hypothesized that IH in the presence of leptin deficiency exacerbates the insulin resistance associated with obesity. Our approach was to utilize an established rodent model of IH (Fletcher et al. 1992) and determine the acute (5 days) and chronic (12 weeks) effects of IH on glucose tolerance and insulin resistance. Specifically, we examined the changes in blood glucose and serum insulin levels during (a) short-term IH in the presence and absence of obesity and leptin and (b) long-term IH in a mouse model of leptin-deficient obesity.

  METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

Animals

A total of 31 wild-type, male, lean C57BL/6J mice (lean) and 59 male obese C57BL/6J-Lepob (obese) mice from Jackson Laboratory (Bar Harbor, ME, USA) were used in the study. The study was approved by the Johns Hopkins University Animal Use and Care Committee and complied with the American Physiological Society Guidelines for Animal Studies. For all blood samples, injections and surgical procedures, anaesthesia was induced and maintained with 1-2 % isoflurane administered through a facemask.

Model of intermittent hypoxia

A gas control delivery system was designed to regulate the flow of room air, nitrogen and oxygen into customized cages housing the mice. A maximum of three lean mice or two obese mice were housed continuously in a single customized cage (dimensions 27 times 17 times 17 cm) with constant access to food and water. A series of programmable solenoids and flow regulators altered the inspired oxygen fraction (FI,O2) over a defined and repeatable profile that simulated the timing and magnitude of arterial oxygen desaturation changes seen in OSA patients (Tagaito et al. 2001). During each period of IH, the FI,O2 was reduced from 20.9 to 4.8-5.0 % over a 30 s period and then rapidly reoxygenated to room air levels in the subsequent 30 s period. The use of multiple inputs into the cage produced a uniform nadir FI,O2 level throughout the cage.

Leptin replacement

In 16 obese mice, anaesthesia was induced and maintained by 1-2 % isoflurane, and a small 0.25 cm skin incision was made in the midline, just caudal to the shoulder blades. A 100 µl Alzet (Mt View, CA, USA) mini-osmotic pump (0.5 µl h-1) was inserted subcutaneously and used to deliver leptin (Amgene, Thousand Oaks, CA, USA) at a dose of 200 µg kg-1 day-1. Mice were monitored for 6-8 h under room air conditions to assure the integrity of the surgical site and the return of normal behavioural activities. After the recovery period animals were placed in the IH chamber.

Experimental design

A. Short-term exposure to IH. Sixteen lean mice, 15 obese mice, and eight obese mice with leptin replacement were placed in the IH chamber for five consecutive days. Food intake and body weight were monitored daily for each animal. All animals were kept in a controlled environment (22-24 °C with a 12 h : 12 h light : dark cycle; lights on at 08.00) on a standard chow diet with free access to water. In a separate series of animals, 15 lean mice, 14 obese mice, and eight obese mice with leptin replacement were exposed to intermittent room air (IA, control groups) for 5 days in identical chambers and were weight-matched to the IH group daily during the experiment by varying food intake (Table 1). The IH and IA states were induced from 16.00 to 08.00 (i.e. for 16 h) each day of the experiment, alternating with 8 h of constant room air. The 16 h exposure period was chosen to represent the upper end of the physiological range for IH exposure and was based on our previous work in a mouse model of sleep-disordered breathing during polysomnographically determined sleep (Tagaito et al. 2001).

tab1

B. Long-term exposure to IH in obese mice. Obese mice were exposed to either IH (n = 7) or IA (n = 7) for 12 weeks. The experiment was performed as described for short-term IH exposure (above) with the exception that IH and IA states were induced for only 12 h each day of the experiment, alternating with 12 h of constant room air. The shorter period of IH exposure was chosen to lessen any potential adverse cardiovascular outcomes (Fletcher et al. 1992) associated with long-term IH in the obese mice.

Sample collection and intraperitoneal glucose tolerance test (IPGTT)

All blood samples and tissue collections were performed under 1-2 % isoflurane anaesthesia 6 h after the cessation of either IH or IA. A retro-orbital sinus puncture was performed for glucose and insulin measurements in peripheral blood (100 µl) before and after short-term IH exposure and during long-term exposure at weeks 0, 4, 8 and 12. After short-term exposure, an IPGTT was performed in 17 lean mice (n = 9 IH; n = 8 IA), 15 obese mice without leptin replacement (n = 8 IH; n = 7 IA) and in 16 obese mice with leptin replacement (n = 8 IH; n = 8 IA). After long-term exposure to IH and IA, an IPGTT was performed in all animals. A glucose load of 0.5 g kg-1 body weight was administered I.P. for the glucose tolerance test. During the IPGTT, glucose measurements were obtained by retro-orbital puncture (15 µl) at 15, 30, 45, 60, 75, 90 and 120 min after administration of the glucose load. Retro-orbital puncture was used due to large blood volume requirements associated with repetitive sampling. Haemostasis was assured by applying pressure and, in survival experiments, all animals were observed to assure that there were no signs of distress or abnormal behaviour.

At the termination of all short-term and long-term IH and IA experiments, arterial blood (1 ml) was obtained by direct cardiac puncture under 1-2 % isoflurane anaesthesia; animals were then killed with an overdose of pentobarbital (60 mg I.P). Subcutaneous white adipose tissue was collected, immediately frozen in liquid nitrogen and stored at -70 °C for future analysis.

Blood glucose and plasma leptin, insulin and free fatty acid (FFA) determination

Glucose was measured in blood from the retro-orbital plexus using an Accu-Chek Comfort Curve kit from Roche Diagnostics (Indianapolis, IN, USA). Serum leptin levels were measured with a mouse leptin radioimmunoassay kit from Linco Research (St Charles, MO, USA). Serum insulin levels were measured with a rat insulin ultrasensitive radioimmunoassay kit (cross-reactivity with mouse insulin 100 %) from Linco Research. Serum FFA were measured with a NEFA C test kit from Wako Diagnostics (Richmond, VA, USA).

To evaluate the degree of insulin resistance, the homeostasis model assessment (HOMA) was calculated using the following formula: HOMA = fasting serum insulin (µu ml-1) times fasting blood glucose (mmol l-1)/22.5 (Matthews et al. 1985).

RNA purification

The subcutaneous white adipose tissue was homogenized on ice using an Omni EZ Connect Homogenizer (Omni International, Warrington, VA, USA). Total RNA was isolated using Trizol Reagent (Life Technologies, Rockville, MD, USA) with additional RNA clean-up using the RNAeasy (Qiagen, Valencia, CA, USA) purification kit.

Gene expression microarray analyses

RNA samples of the subcutaneous white adipose tissue from mice exposed to short-term IH were pooled for animals of each strain for each experimental condition: lean mice exposed to IH (n = 5), lean mice exposed to IA (n = 5), obese mice exposed to IH (n = 5) and obese mice exposed to IA (n = 5). A gene expression microarray cRNA was produced from double-stranded cDNA and fragmented to a size of approximately 50 base pairs (bp). Biotinylated cRNA was hybridized to the Affymetrix Murine GeneChip U74A (Affymetrix, Santa Clara, CA, USA), which represents approximately 6000 sequences from the UniGene database that have been functionally characterized and approximately 6000 additional expressed sequence tag (EST) clusters. Absolute analysis of Affymetrix image data was carried out using the Affymetrix Microarray Suite 4.0, as described previously (Chen et al. 2000). Duplicate Genechips were used for quality control, and alterations in gene expression were determined on the basis of a twofold change in specific genes or ESTs.

RT-PCR

cDNA was produced from total RNA using the Advantage RT for PCR kit from Clontech (Palo Alto, CA, USA). PCR was performed with the SuperTaq Plus Polymerase kit from Ambion RNA Company (Austin, TX, USA) in an iCycler from Bio-Rad (Richmond, CA, USA) using primers for mouse leptin

(5'-3': F, TGACACCAAAACCCTCATCA;

R, AGCATTCAGGGCTAACATCC)

and mouse 18 S rRNA

(5'-3': F, CTGTTCCGCCTAGTCCTGTC;

R, GTTTCTCAGGCTCCCTCTCC)

derived from GeneBank sequences. PCR results were resolved on 1.2 % agarose gel stained with ethidium bromide. Densitometry was performed using a Kodak DC290 ZOOM digital camera with 2 150 000 pixels (2 megapixels) and an UN-SCAN-IT gel Automated Digitizing System, version 5.1 software from Silk Scientific Corporation (Orem, VT, USA).

Statistical analyses

All values are reported as means ± S.E.M. In short-term exposure, comparisons of body weights, food intake, fasting blood glucose, fasting serum insulin levels, and leptin and fatty acid levels within and between the IH and IA groups of obese and lean mice were performed using either a paired t test (between days 0 and 5 within a group) or an unpaired t test (between groups). In long-term exposure, statistical differences in body weight, food intake, fasting blood glucose, and fasting serum insulin levels were determined across time and between mice exposed to IH and IA, by two-way ANOVA. To test whether serum glucose levels during the IPGTT were different between IH and IA conditions, we used the technique of longitudinal data analysis (Zeger & Liang, 1986) to determine whether the response to glucose load was different at any time point. Because glucose levels during the IPGTT are inherently correlated, determination of whether significant differences exist between two groups at any time point requires that the autocorrelation between the repeated measurements be accounted for in these assessments. To account for the correlation between repeated measurements, the method of generalized estimating equations (Liang & Zeger, 1986) was used to obtain unbiased estimates (and associated standard errors) that quantify the differences between the two groups. This approach also allowed us to adjust for baseline differences in the glucose levels and estimate whether the change from the baseline level was different between two groups at any time point after the glucose load. Thus, all of the IPGTT results are presented as a change in the glucose value from baseline. The GENMOD procedure in the SAS statistical software package (version 9.0) was used to fit models using the method of generalized estimating equations. Statistical significance was based on whether the difference in glucose values from baseline was different under IH and IA conditions. A P value of less than 0.05 was considered significant.

  RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

A. Short-term exposure to intermittent hypoxia

a. Lean mice: fasting parameters on day 0 and day 5. Exposure to IH for 5 days decreased fasting blood glucose levels by 35 ± 14 mg dl-1 (P < 0.01, Table 1), whereas insulin (Fig. 1) and FFA (1.1 ± 0.2 mmol l-1 on day 0 and 1.4 ± 0.2 mmol l-1 on day 5) remained unchanged. In control mice exposed to 5 days of IA, there were no changes in glucose (Table 1), insulin (Fig. 1 left panel) or FFA levels (0.9 ± 0.1 mmol l-1 on day 0 and 1.1 ± 0.3 mmol l-1 on day 5). During exposure to IH, the HOMA index of insulin resistance decreased from 9.1 ± 1.0 on day 0 to 2.8 ± 0.5 on day 5 (P < 0.05), whereas in control animals exposed to IA, it did not change (5.6 ± 2.1 and 4.4 ± 0.6, respectively). The decrease in insulin resistance induced by IH in lean mice was independent of changes in food intake and body weight, which were matched between the IH and the IA groups (Table 1).

F1 View larger version
[in this window]
[in a new window]

Figure 1. Fasting serum insulin levels in C57BL/6J (lean) and C57Bl/6J-Lepob (obese) mice were determined before (day 0) and after (day 5) exposure to either IH or IA for 5 days

These results are presented as the means ± S.E.M. The statistical significance of the difference between day 0 and day 5 within each group of animals or between animals exposed to intermittent hypoxia or intermittent air was derived with paired or unpaired t tests, respectively. *P < 0.01 for difference between day 0 and day 5; †P < 0.01 between mice exposed to IH and IA on day 5.

b. Lean mice: intraperitoneal glucose tolerance on day 5. In lean mice, IH resulted in significant improvement of glucose tolerance, as assessed by IPGTT on day 5 (Fig. 2A). After adjustment for the difference in fasting blood glucose (see Table 1), the glucose levels throughout the IPGTT were on average 70 ± 25 mg dl-1 lower (P < 0.01) in mice exposed to IH compared with control animals exposed to IA (Fig. 2A). In lean mice, the 2 h IPGTT insulin levels were unchanged from the day 5 baseline levels in both the IH and IA groups (Fig. 3, left panel).

F2 View larger version
[in this window]
[in a new window]

Figure 2. Blood glucose levels as a result of an IPGTT after a 5 day exposure to either IH or IA in lean mice, leptin-deficient obese mice and leptin-deficient obese mice receiving supplemental leptin

The change in the blood glucose from fasting levels was determined over a 2 h period after I.P. injection of glucose at 0.5 g kg-1 body weight in lean C57BL/6J mice (A), leptin-deficient obese C57Bl/6J-Lepob mice (B) and in C57Bl/6J-Lepob (obese) mice receiving leptin subcutaneously at 200 µg kg-1 day-1 (C). The IPGTT was performed after exposure to IH or IA for 5 days. The results show the mean of the change in blood glucose level (blood glucose level - fasting blood glucose level) ± S.E.M. The statistical significance of the difference between groups was derived with the method of generalized estimating equations (see Methods for the details). *P < 0.05 for the difference between groups.

F3 View larger version
[in this window]
[in a new window]

Figure 3. Serum insulin levels as a result of an IPGTT after exposure to either IH or IA in lean mice, leptin-deficient obese mice and leptin-deficient obese mice receiving supplemental leptin

Serum insulin levels in C57BL/6J (lean) and C57Bl/6J-Lepob (obese) mice were determined before (fasting level) and 2 h after I.P. glucose injection (0.5 g kg-1 body weight) in the IPGTT. The IPGTT was performed after exposure to either IH or IA for 5 days. Results are presented as the means ± S.E.M. The statistical significance of the difference between fasting and 2 h IPGTT levels within each group of animals or between animals exposed to intermittent hypoxia or intermittent air was derived with paired or unpaired t tests, respectively. *P < 0.001 for difference between fasting and 2 h IPGTT levels; †P < 0.01 between mice exposed to IH and IA.

c. Obese mice: fasting parameters on day 0 and day 5. Exposure to IH for 5 days led to a decrease (P < 0.001) in fasting blood glucose levels of 85 ± 5 mg dl-1 (Table 1) and unchanged levels of FFA (1.2 ± 0.1 mmol l-1 on day 0 and 1.2 ± 0.2 mmol l-1 on day 5). In contrast to lean mice, fasting insulin levels rose markedly (P < 0.01) in response to 5 days of IH in obese mice (Fig. 1). In obese control mice exposed to 5 days of IA, there were no changes in glucose (Table 1), insulin (Fig. 1) or FFA levels (1.4 ± 0.2 mmol l-1 on day 0 and 1.4 ± 0.1 mmol l-1 on day 5). During exposure to IH, the HOMA index increased more than fourfold (from 44.9 ± 11.0 on day 0 to 204.7 ± 39.3 on day 5; P = 0.01), whereas there was no change in control animals exposed to IA (65.9 ± 8.1 and 58.9 ± 18.1, respectively). The increase in insulin resistance induced by IH in obese mice was independent of changes in food intake and body weight (Table 1).

d. Obese mice: intraperitoneal glucose tolerance on day 5. A 5 day exposure to IH improved glucose tolerance in obese mice in a manner comparable to lean mice, but, after correction for fasting blood glucose levels, the difference with control mice reached statistical significance only at two time points, 30 and 45 min (P < 0.05; Fig. 2B). Unlike lean mice, IH in obese mice induced a twofold increase in post-IPGTT serum insulin from an already elevated fasting level (28.6 ± 3.0 ng ml-1 vs. 13.6 ± 2.3 ng ml-1; P < 0.001), whereas there was no change in the IA group (Fig. 3, right panel).

e. Leptin replacement in obese mice: fasting parameters on day 0 and day 5. The leptin infusion rate of 200 µg kg-1 day-1 produced serum leptin levels of 11.2 ± 2.4 ng ml-1 in the IA group and 10.2 ± 2.1 ng ml-1 in the IH group, and resulted in reduced food intake and weight loss in both groups (Table 1). Fasting blood glucose levels were significantly decreased (P < 0.001) after 5 days in both the IH and IA groups. Fasting serum insulin levels on day 5 were 1.0 ± 0.3 ng ml-1 and 1.4 ± 0.5 ng ml-1 in mice subjected to IH and IA, respectively, which was a substantial decrease compared to leptin-deficient mice (Fig. 1, right panel). The HOMA levels of 9.0 ± 2.7 (IH group) and 10.4 ± 3.1 (IA group) were similar to that of lean mice (see sections Aa and Ab), and 15-20 times lower than those in leptin-deficient obese mice exposed to IH (see sections Ac and Ad). Thus, the presence of elevated circulating levels of leptin reversed the marked increase in insulin resistance that occurred in obese leptin-deficient mice exposed to IH.

f. Leptin replacement in obese mice: intraperitoneal glucose tolerance on day 5. In the presence of leptin, glucose tolerance in obese mice was improved comparably in both the IH and IA groups (compare Fig. 2C and 2B) to a level similar to lean mice exposed to IH (compare Fig. 2C and 2A). Serum insulin levels at 2 h averaged 4.1 ± 0.9 ng ml-1 in the IH group and 2.8 ± 0.7 ng ml-1 in the IA group, both of which were considerably lower than the values of 28.6 ± 3.0 ng ml-1 and 9.1 ± 1.9 ng ml-1 seen in the leptin-deficient obese mice during IH (P < 0.001) and IA (P < 0.05), respectively. Thus, leptin administration led to an improvement in glucose tolerance and serum insulin levels 2 h after the glucose challenge in obese mice, and reversed the metabolic dysfunction evident in leptin-deficient obese mice exposed to IH.

g. Gene expression in adipose tissue of lean and obese mice. In lean mice exposed to IH, six genes were upregulated greater than twofold and 47 genes were downregulated greater than twofold compared with mice exposed to IA. In obese mice subjected to IH, 12 genes were upregulated greater than twofold and three genes were downregulated greater than twofold compared with mice exposed to IA. Among the genes involved in glucose metabolism and insulin signalling (Misbin et al. 1981; Arnalich et al. 2000; Kim et al. 2000; Li et al. 2000; James et al. 2001; Saltiel & Kahn, 2001; Ceddia et al. 2002) only six genes were differentially expressed in mice subjected to IH (Table 2). In lean mice, leptin was significantly upregulated, phosphotidylinositol-3-kinase (PI(3)K), interleukin 6 (IL-6) receptor, insulin-degrading enzyme and caveolin 3 were downregulated, and uncoupling protein was unchanged. In obese mice, leptin was unchanged, caveolin 3 was upregulated and uncoupling protein was downregulated. Notably, there were no significant changes in the expression of other genes associated with insulin signalling (i.e. insulin receptor, insulin receptor substrates (IRS), glucose transporters), glucose utilization (i.e. glycolysis enzymes) or insulin resistance (i.e. tumour necrosis factor (TNF)alpha, peroxisome proliferator activated receptor (PPAR)gamma, adiponectin and resistin) (Tamemoto et al. 1994; Bruning et al. 1998; Withers et al. 1998; Zisman et al. 2000; Steppan et al. 2001; Yamauchi et al. 2001).

The increase in leptin expression was verified by semi-quantitative RT-PCR (Fig. 4A). Leptin expression in relationship to 18S rRNA (a house-keeping gene) was 44 % higher in lean mice exposed to IH compared to IA controls (Fig 4B). In lean mice exposed to IH, serum leptin levels were significantly elevated compared to the IA group (Fig. 4C), demonstrating that exposure to IH resulted in both an increase in leptin gene expression as well as increased circulating leptin levels in the peripheral blood.

tab2,3

F4 View larger version
[in this window]
[in a new window]

Figure 4. Expression of leptin mRNA and 18S rRNA in subcutaneous adipose tissue, and serum leptin levels in lean mice after exposure to either IH or IA for 5 days

In lean C57BL/6J mice, leptin mRNA and 18S rRNA expression in subcutaneous adipose tissue was assessed by RT-PCR (A and B), and fasting serum leptin levels (C) were measured by radioimmunoassay after exposure to IH (n = 9) or IA (n = 9) for 5 days. Ethidium bromide staining of an agarose gel shows representative RT-PCR yielded products of predicted size, 416 bp for leptin and 500 bp for 18S (A). Semi-quantitative determination of leptin mRNA expression is presented as a percentage of 18S rRNA RT-PCR product expression (B). Results are presented as the means ± S.E.M. The statistical significance of the difference between animals exposed to IH and IA was derived with an unpaired t test.

B. Long-term exposure to IH

a. Fasting parameters. During the 12 week exposure to IH, two out of seven of the IH mice died (one mouse died during exposure and the other died during assessment of fasting glucose and insulin levels); data from these animals were excluded from all analyses. Throughout the 12 week exposure period, the mice exposed to IH and the control mice exposed to IA had similar food intake and body weight (Table 3) and maintained their normal weight gain trajectory (Tankersley et al. 1996). Fasting glucose levels also followed the expected course (Menahan, 1983), declining over time from the nadir at 9 weeks of age. In contrast to the 5 day exposure described above, fasting glucose levels during IH remained comparable to those of the IA control group throughout the 12 week experiment. However, similar to the hyperinsulinaemia seen during short-term IH exposure, the fasting insulin levels in the IH group also increased significantly (P < 0.01) over time, indicating that IH led to sustained insulin resistance (Fig. 5). Indeed, at 12 weeks, the HOMA index was more than double (P < 0.05) in the IH group (134.5 ± 23.1) compared to the IA group (57.3 ± 9.0).

F5 View larger version
[in this window]
[in a new window]

Figure 5. Fasting serum insulin levels in obese mice after exposure to either IH or IA for 12 weeks

Fasting serum insulin levels in C57Bl/6J-Lepob (obese) mice were determined before (baseline), during (weeks 4 and 8) and after exposure to IH or IA conditions for 12 weeks. Results are presented as the means ± S.E.M. Statistical significance of the difference between groups and over time was determined by two-way ANOVA. *P < 0.01 for difference between baseline, week 8 and week 12 levels for the IH group.

b. Intraperitoneal glucose tolerance at week 12. The degree of glucose intolerance present in the IA group at 12 weeks (Fig. 6; continuous line, squares) was identical to that described above at 5 days in the IA group (Fig. 2B; continuous line, squares). In contrast, the glucose tolerance was markedly different between the 5 day (Fig. 2B; dotted line, diamonds) and 12 week exposures (Fig. 6; dotted line, diamonds) in the IH group. After 12 weeks of exposure, all five animals exposed to IH reached blood glucose levels above 600 mg dl-1 during the IPGTT, whereas only two out of seven of the IA group exceeded 600 mg dl-1. Consequently, the blood glucose levels were significantly higher in the IH compared to the IA group at 90 min (a difference of 80 ± 26 mg dl-1; P = 0.002) and 120 min (a difference of 116 ± 24 mg dl-1; P < 0.001) after glucose administration (Fig. 6), demonstrating that glucose intolerance in obese mice is exacerbated by exposure to IH.

F6 View larger version
[in this window]
[in a new window]

Figure 6. Blood glucose levels as a result of an IPGTT after a 12 week exposure to either IH or IA in obese mice

The change in the blood glucose from fasting levels was determined over a 2 h period after I.P. injection of glucose at 0.5 g kg-1 body weight in C57Bl/6J-Lepob (obese) mice following 12 weeks of exposure to IH and IA. Results are presented as the means of the change in blood glucose level (blood glucose level - fasting blood glucose level) ± S.E.M. The statistical significance of the difference between groups was derived with the method of generalized estimating equations (see Methods for the details). *P = 0.002 for the difference between groups, †P < 0.001 for the difference between groups.

  DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

The purpose of our study was to assess the impact of IH, a key clinical manifestation of OSA, on glucose and insulin regulation in the presence and absence of obesity and leptin. Several new findings resulted from the study. Firstly, short-term exposure to IH led to a decrease in fasting blood glucose levels and improved glucose tolerance in both lean and obese, leptin-deficient mice. In lean mice, fasting and post-IPGTT insulin levels did not change and the HOMA estimate of insulin resistance decreased, consistent with IH increasing the sensitivity of peripheral tissues to insulin. In contrast to lean mice, a decrease in blood glucose levels in obese mice was accompanied by a marked rise in serum insulin levels and an increase in insulin resistance. Secondly, the increase in insulin resistance that occurred in obese, leptin-deficient mice in response to short-term IH was abolished by acute leptin replacement, suggesting that leptin deficiency, rather than obesity per se, may be responsible for the metabolic dysregulation that occurs during IH. Thirdly, short-term exposure to IH in lean mice led to an upregulation of leptin gene expression in adipose tissue and an increase in circulating leptin levels, indicating that elevations in leptin may represent a compensatory response to the presence of IH. Fourthly, chronic IH exposure led to a sustained increase in serum insulin levels and insulin resistance in obese mice. Moreover, in contrast to short-term IH exposure, long-term IH worsened glucose tolerance, suggesting that IH accelerated the progression of glucose intolerance and insulin resistance in a leptin-deficient murine model of obesity. In the discussion that follows we explore the relationship and putative pathways linking IH to insulin resistance.

IH and insulin resistance

In obese, leptin-deficient mice, short-term IH led to an increase in both fasting and post-IPGTT serum insulin levels in the presence of decreased fasting glucose and improved glucose tolerance, suggesting that IH can impact on pancreatic endocrine function and increase insulin secretion. However, the relatively small decrease in blood glucose levels (Table 1) was out of proportion to the marked increase in insulin secretion (Fig. 1), consistent with a progression of insulin resistance. The insulin resistance observed in obese leptin-deficient mice during short-term IH was also present after long-term IH, and was associated with a worsening of glucose tolerance. In contrast, in previous in vivo studies, long-term exposure to continuous hypoxia did not cause insulin resistance (Larsen et al. 1997) and resulted in a decrease in fasting blood glucose levels and unchanged glucose tolerance (Calderon et al. 1966; Davidson & Aoki, 1970). Thus, a key finding in our study is that the intermittent nature of the hypoxic stimulus is critical in the development of insulin resistance and impaired glucose tolerance.

Leptin deficiency probably plays an important role in the insulin and glucose responses to IH. Leptin can act at the level of the pancreas to downregulate insulin gene transcription and insulin secretion (Kulkarni et al. 1997; Seufert et al. 1999) and at the peripheral tissues to increase glucose uptake (Barzilai et al. 1997; Sivitz et al. 1997). Although it is unclear through what pathways leptin deficiency interacts with IH to cause insulin resistance in our model, the increase in gene expression of caveolin and decrease in that of uncoupling protein 1 observed in the adipose tissue of obese, but not lean mice, represent two putative mechanisms (Li et al. 2000; James et al. 2001). Moreover, our data in obese mice did not reveal any other mechanism potentially implicated in increased insulin resistance in response to IH. Specifically, serum FFA (Kim et al. 2001) and adipose tissue expression of insulin receptor, IRS, TNFalpha, PPARgamma, glucose transporters, adiponectin and resistin were unchanged (Tamemoto et al. 1994; Bruning et al. 1998; Withers et al. 1998; Zisman et al. 2000; Saltiel & Kahn, 2001; Steppan et al. 2001; Yamauchi et al. 2001). Thus, leptin deficiency plays a key role in the acceleration of insulin resistance in mice exposed to IH, but it remains to be determined whether other models of obesity and insulin resistance with intact leptin pathways are also susceptible to metabolic dysfunction after exposure to IH.

Alternatively, the compensatory increases in leptin that occur in lean mice exposed to IH could increase glucose uptake in the periphery through various mechanisms. Potential mediators of increased glucose uptake include IRS (Tamemoto et al. 1994; Withers et al. 1998), PI(3)K (Kim et al. 2000; Saltiel & Kahn, 2001), Akt/protein kinase B kinase (Kim et al. 2000; Saltiel & Kahn, 2001) and uncoupling protein (Li et al. 2000), although none of these genes showed an increase in expression level in response to IH in adipose tissue of lean mice. Nevertheless, an increase in kinase activity or the amount of these proteins may account for the actions of leptin on glucose utilization in the peripheral tissues. Other potential pathways for improving glucose uptake in response to IH that were identified by gene expression analysis in lean mice include downregulation of several genes associated with increased insulin resistance, such as IL-6 receptor (Arnalich et al. 2000), insulin degrading enzyme (Misbin et al. 1981) and caveolin (James et al. 2001; Table 2). Thus, a number of pathways, in addition to elevated leptin levels, may contribute to the improved glucose tolerance that occurs in lean mice exposed to IH.

IH and leptin

Several clinical studies have shown that patients with OSA have significantly higher leptin levels than weight-matched subjects without OSA (Chin et al. 1999; Ip et al. 2000; Vgontzas et al. 2000). Moreover, treatment with continuous positive airway pressure can result in significant reductions in leptin levels in OSA patients (Chin et al. 1999). The mediating mechanisms and the biological and clinical significance of the increased leptin levels associated with OSA are unknown. Experiments on cell cultures of adipocytes (Grosfeld et al. 2002) and fibroblasts (Ambrosini et al. 2002) have demonstrated that continuous hypoxia increases leptin gene expression via hypoxia-inducible factor (HIF)-1alpha transcription factor (Ambrosini et al. 2002). Our data show that IH causes an elevation in leptin expression and protein level (Fig. 4), suggesting that the hypoxic stress caused by OSA may be the mechanism by which leptin levels are increased. In addition to providing insight into the mechanism by which OSA increases leptin levels, our data provide evidence that leptin plays an important role in mitigating the metabolic disturbances that accompany IH. Both upregulation of leptin and leptin replacement in leptin-deficient mice protected the animals against the development of glucose intolerance and insulin resistance during IH (Fig. 1 and Fig. 2A and C). Thus, the elevation of leptin levels caused by the hypoxic stress induced by OSA may represent an important compensatory response that acts to minimize metabolic dysfunction.

Caveats

Several caveats associated with our study need to be acknowledged. First, fasting blood glucose levels declined over the course of the 12 week (long-term) exposure to IH in obese, leptin-deficient mice, reflecting the natural aging process in C57Bl/6J-Lepob mice (Menahan, 1983). This time-related decline in fasting glucose levels, however, does not impact on our results and conclusions since (1) the decline in fasting blood glucose was identical in both the IH and the IA control groups and (2) the glucose tolerance curve was similar in control animals experiencing either long-term IA (Fig. 6) or short-term IA (Fig. 2B), whereas animals exposed to long-term IH (Fig. 6) showed a marked deterioration in glucose tolerance compared to the short-term IH exposure (Fig. 2B). A second caveat is that mild food restriction and weight loss could potentially contribute to the decreases in blood glucose and HOMA index observed in lean mice during short-term IH exposure. However, control mice that were identically weight-matched to mice exposed to 5 days of IH did not exhibit any change in either blood glucose, serum insulin levels or HOMA index in response to IA, indicating that the mild food restriction did not have an impact on baseline metabolic function. Third, the pooling of mRNA for microarray analysis, despite the animals being genetically identical, is potentially less sensitive than assessing gene expression responses from individual animals. We acknowledge that many of the changes in gene expression discussed above require subsequent verification, although we did show an increase in gene expression, elevated serum levels and physiological relevance for an increase in leptin in response to IH. Fourth, it may be expected that several other metabolic genes that can increase glucose uptake, including glucose transporters, glycolysis enzymes and leptin, would be upregulated by an increase in HIF-1alpha transcription factor, which is a major regulator of the cellular responses to hypoxia (Iyer et al. 1998; Ambrosini et al. 2002). However, since HIF-1alpha is almost instantly degraded with the cessation of a hypoxic stimulus (Hon et al. 2002), the absence of any upregulation of HIF-1alpha-controlled genes, with the exception of leptin, is probably due to our experimental approach assessing responses 6 h after removal of IH.

Clinical implications

Our approach of assessing metabolic function in obese mice exposed to IH was designed to simulate the relationship between obesity and OSA in the clinical environment. The data are relevant for daytime metabolic assessment in patients with severe OSA, since the IH stimulus represented significant and repeated decreases in arterial oxygen levels (Tagaito et al. 2001) and all measurements were performed 6 h after cessation of the IH stimulus. The results from our animal model have several clinical implications. We have shown that IH may be an underlying mechanism contributing to the previously described clinical association between OSA and insulin resistance (Ip et al. 2002; Punjabi et al. 2002). Based on our data, we propose that IH may account for the insulin resistance observed in OSA if leptin pathways are disrupted. Although the leptin deficiency of the obese mouse is rare in humans (Montague et al. 1997), partial leptin deficiency (Ravussin et al. 1997; Farooqi et al. 2001), and, in particular, leptin resistance (Considine et al. 1996; Schwartz et al. 1996; Ceddia et al. 2002) are common. It is conceivable that administration of high doses of either leptin or other factors that stimulate leptin pathways (e.g. ciliary neurotrophic factor; Lambert et al. 2001) could attenuate the insulin resistance and glucose intolerance that occurs in obese patients with OSA.

Conclusion

In conclusion, we have shown that in the absence of leptin, IH can accelerate the progression of insulin resistance and glucose intolerance associated with obesity. Leptin administration and elevations in endogenous leptin levels may have a protective effect against the progression of glucose intolerance and insulin resistance in the presence of IH. Finally, our data suggest that the previously observed association between OSA and insulin resistance are due to the detrimental effects of IH, and that OSA exacerbates the insulin resistance and glucose intolerance associated with obesity when leptin deficiency is present.

  REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

Ambrosini G, Nath AK, Sierra-Honigmann MR & Flores-Riveros J (2002). Transcriptional activation of the human leptin gene in response to hypoxia. Involvement of hypoxia-inducible factor 1. J Biol Chem 277, 34601-34609 [Abstract/Full Text]
Arnalich F, Hernanz A, Lopez-Maderuelo D, Pena JM, Camacho J, Madero R, Vazquez JJ & Montiel C (2000). Enhanced acute-phase response and oxidative stress in older adults with type II diabetes. Horm Metab Res 32, 407-412 [Medline]
Barzilai N, Wang J, Massilon D, Vuguin P, Hawkins M & Rossetti L (1997). Leptin selectively decreases visceral adiposity and enhances insulin action. J Clin Invest 100, 3105-3110 [Abstract/Full Text]
Braun B, Rock PB, Zamudio S, Wolfel GE, Mazzeo RS, Muza SR, Fulco CS, Moore LG & Butterfield GE (2001). Women at altitude: short-term exposure to hypoxia and or alpha(1)-adrenergic blockade reduces insulin sensitivity. J Appl Physiol 91, 623-631 [Abstract/Full Text]
Breslow MJ, Min-Lee K, Brown DR, Chacko VP, Palmer D & Berkowitz DE (1999). Effect of leptin deficiency on metabolic rate in ob/ob mice. Am J Physiol 276, E443-E449 [Medline]
Bruning JC, Michael MD, Winnay JN, Hayashi T, Horsch D, Accili D, Goodyear LJ & Kahn CR (1998). A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell 2, 559-569 [Medline]
Calderon R, Llerena LA, Munive L & Kruger F (1966). Intravenous glucose tolerance test in pregnancy in women living in chronic hypoxia. Diabetes 15, 130-132 [Medline]
Ceddia RB, Koistinen HA, Zierath JR & Sweeney G (2002). Analysis of paradoxical observations on the association between leptin and insulin resistance. FASEB J 16, 1163-1176 [Abstract/Full Text]
Chen YW, Zhao P, Borup R & Hoffman EP (2000). Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. J Cell Biol 151, 1321-1336 [Abstract/Full Text]
Chin K, Shimizu K, Nakamura T, Narai N, Masuzaki H, Ogawa Y, Mishima M, Nakao K & Ohi M (1999). Changes in intra-abdominal visceral fat and serum leptin levels in patients with obstructive sleep apnoea syndrome following nasal continuous positive airway pressure therapy. Circulation 100, 706-712 [Abstract/Full Text]
Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ & Bauer TL (1996). Serum immunoreactive-leptin concentrations in normal-weight and obese humans. N Engl J Med 334, 292-295 [Abstract/Full Text]
Davidson MB , & Aoki VS (1970). Fasting glucose homeostasis in rats after chronic exposure to hypoxia. Am J Physiol 219, 378-383 [Medline]
Farooqi IS, Keogh JM, Kamath S, Jones S, Gibson WT, Trussell R, Jebb SA, Lip GY & O'Rahilly S (2001). Partial leptin deficiency and human adiposity. Nature 414, 34-35 [Medline]
Fletcher EC, Lesske J, Qian W, Miller CC & Unger T (1992). Repetitive, episodic hypoxia causes diurnal elevation of blood pressure in rats. Hypertension 19, 555-561 [Abstract]
Friedman JM, (1998). Leptin, leptin receptors, and the control of body weight. Nutr Rev 56, s38-s46
Gastaut H, Tassinari CA & Duron B (1966). Polygraphic study of the episodic diurnal and nocturnal (hypnic and respiratory) manifestations of the Pickwick syndrome. Brain Research 1, 167-186 [Medline]
Grosfeld A, Zilberfarb V, Turban S, Andre J, Guerre-Millo M & Issad T (2002). Hypoxia increases leptin expression in human PAZ6 adipose cells. Diabetologia 45, 527-530 [Medline]
Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK & Friedman JM (1995). Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269, 543-546
Hon WC, Wilson MI, Harlos K, Claridge TD, Schofield CJ, Pugh CW, Maxwell PH, Ratcliffe PJ, Stuart DI & Jones EY (2002). Structural basis for the recognition of hydroxyproline in HIF-1 alpha by pVHL. Nature 417, 975-978 [Medline]
Ip MS, Lam B, Ng MM, Lam WK, Tsang KW & Lam KS (2002). Obstructive sleep apnoea is independently associated with insulin resistance. Am J Respir Crit Care Med 165, 670-676 [Abstract/Full Text]
Ip MS, Lam KS, Ho C, Tsang KW & Lam W (2000). Serum leptin and vascular risk factors in obstructive sleep apnoea. Chest 118, 580-586 [Abstract/Full Text]
Iyer NV, Kotch LE, Agani F, Leung SW, Laughner E, Wenger RH, Gassmann M, Gearhart JD, Lawler AM, Yu AY & Semenza G L (1998). Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev 12, 149-162 [Abstract/Full Text]
James DJ, Cairns F, Salt IP, Murphy GJ, Dominiczak AF, Connell JM & Gould GW (2001). Skeletal muscle of stroke-prone spontaneously hypertensive rats exhibits reduced insulin-stimulated glucose transport and elevated levels of caveolin and flotillin. Diabetes 50, 2148-2156 [Abstract/Full Text]
Kim JK, Kim YJ, Fillmore JJ, Chen Y, Moore I, Lee J, Yuan M, Li ZW, Karin M, Perret P, Shoelson SE & Shulman GI (2001). Prevention of fat-induced insulin resistance by salicylate. J Clin Invest 108, 437-446 [Abstract/Full Text]
Kim YB, Uotani S, Pierroz DD, Flier JS & Kahn BB (2000). In vivo administration of leptin activates signal transduction directly in insulin-sensitive tissues: overlapping but distinct pathways from insulin. Endocrinology 141, 2328-2339 [Abstract/Full Text]
Kulkarni RN, Wang ZL, Wang RM, Hurley JD, Smith DM, Ghatei MA, Withers DJ, Gardiner JV, Bailey CJ & Bloom SR (1997). Leptin rapidly suppresses insulin release from insulinoma cells, rat and human islets and, in vivo, in mice. J Clin Invest 100, 2729-2736 [Abstract/Full Text]
Lambert PD, Anderson KD, Sleeman MW, Wong V, Tan J, Hijarunguru A, Corcoran TL, Murray JD, Thabet KE, Yancopoulos GD & Wiegand SJ (2001). Ciliary neurotrophic factor activates leptin-like pathways and reduces body fat, without cachexia or rebound weight gain, even in leptin-resistant obesity. Proc Natl Acad Sci U S A 98, 4652-4657 [Abstract/Full Text]
Larsen JJ, Hansen JM, Olsen NV, Galbo H & Dela F (1997). The effect of altitude hypoxia on glucose homeostasis in men. J Physiol 504, 241-249 [Abstract]
Li B, Nolte LA, Ju JS, Han DH, Coleman T, Holloszy JO & Semenkovich CF (2000). Skeletal muscle respiratory uncoupling prevents diet-induced obesity and insulin resistance in mice. Nat Med 6, 1115-1120 [Medline]
Liang KY , & Zeger SL (1986). Longitudinal data analysis using generalized linear models. Biometrika 73, 13-22
Maffei M, Halaas J, Ravussin E, Pratley RE, Lee GH, Zhang Y, Fei H, Kim S, Lallone R & Ranganathan S (1995). Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat Med 1, 1155-1161 [Medline]
Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF & Turner RC (1985). Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 28, 412-419 [Medline]
Menahan L A, (1983). Age-related changes in lipid and carbohydrate metabolism of the genetically obese mouse. Metabolism 32, 172-178 [Medline]
Misbin RI, Almira EC & Cleman MW (1981). Insulin degradation in serum of a patient with apparent insulin resistance. J Clin Endocrinol Metab 52, 177-180 [Abstract]
Montague CT, Farooqi IS, Whitehead JP, Soos MA, Rau H, Wareham NJ, Sewter CP, Digby JE, Mohammed SN, Hurst JA, Cheetham CH, Earley AR, Barnett AH, Prins JB & O'Rahilly S (1997). Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387, 903-908 [Medline]
Mooe T, Franklin KA, Holmstrom K, Rabben T & Wiklund U (2001). Sleep-disordered breathing and coronary artery disease. Long-term prognosis. Am J Respir Crit Care Med 164, 1910-1913 [Abstract/Full Text]
Nieto FJ, Young TB, Lind BK, Shahar E, Samet JM, Redline S, D'Agostino RB, Newman AB, Lebowitz MD & Pickering TG (2000). Association of sleep-disordered breathing, sleep apnoea, and hypertension in a large community-based study. Sleep Heart Health Study. JAMA 283, 1829-1836 [Abstract/Full Text]
Peppard PE, Young T, Palta M & Skatrud J (2000). Prospective study of the association between sleep-disordered breathing and hypertension. N Engl J Med 342, 1378-1384 [Abstract/Full Text]
Punjabi NM, Sorkin JD, Katzel LI, Goldberg AP, Schwartz AR & Smith PL (2002). Sleep-disordered breathing and insulin resistance in middle-aged and overweight men. Am J Respir Crit Care Med 165, 677-682 [Abstract/Full Text]
Ravussin E, Pratley RE, Maffei M, Wang H, Friedman JM, Bennett PH & Bogardus C (1997). Relatively low plasma leptin concentrations precede weight gain in Pima Indians. Nat Med 3, 238-240 [Medline]
Saltiel AR , & Kahn CR (2001). Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414, 799-806 [Medline]
Schwartz MW, Peskind E, Raskind M, Boyko EJ & Porte DJ (1996). Cerebrospinal fluid leptin levels: relationship to plasma levels and to adiposity in humans. Nat Med 2, 589-593 [Medline]
Seufert J, Kieffer TJ & Habener JF (1999). Leptin inhibits insulin gene transcription and reverses hyperinsulinemia in leptin-deficient ob/ob mice. Proc Natl Acad Sci U S A 96, 674-679 [Abstract/Full Text]
Shahar E, Whitney CW, Redline S, Lee ET, Newman AB, Javier NF, O'Connor GT, Boland LL, Schwartz JE & Samet JM (2001). Sleep-disordered breathing and cardiovascular disease: cross-sectional results of the Sleep Heart Health Study. Am J Respir Crit Care Med 163, 19-25 [Abstract/Full Text]
Sivitz WI, Walsh SA, Morgan DA, Thomas MJ & Haynes WG (1997). Effects of leptin on insulin sensitivity in normal rats. Endocrinology 138, 3395-3401 [Abstract/Full Text]
Steppan C, Bailey S, Bhat S, Brown E & Banerjee R (2001). The hormone resistin links obesity to diabetes. Nature 409, 307-312 [Medline]
Strohl KP, Novak RD, Singer W, Cahan C, Boehm KD, Denko CW & Hoffstem VS (1994). Insulin levels, blood pressure and sleep apnoea. Sleep 17, 614-618 [Medline]
Tagaito Y, Polotsky VY, Campen MJ, Wilson JA, Balbir A, Smith PL, Schwartz AR & O'Donnell CP (2001). A model of sleep-disordered breathing in the C57BL/6J mouse. J Appl Physiol 91, 2758-2766 [Abstract/Full Text]
Tamemoto H, Kadowaki T, Tobe K, Yagi T, Sakura H, Hayakawa T, Terauchi Y, Ueki K, Kaburagi Y, Satoh S et al. (1994). Insulin resistance and growth retardation in mice lacking insulin receptor substrate-1. Nature 372, 182-186 [Medline]
Tankersley C, Kleeberger S, Russ B, Schwartz A & Smith P (1996). Modified control of breathing in genetically obese (ob/ob). mice. J Appl Physiol 81, 716-723 [Abstract]
Vgontzas AN, Papanicolaou DA, Bixler EO, Hopper K, Lotsikas A, Lin HM, Kales A & Chrousos GP (2000). Sleep apnoea and daytime sleepiness and fatigue: relation to visceral obesity, insulin resistance, and hypercytokinemia. J Clin Endocrinol Metab 85, 1151-1158 [Abstract/Full Text]
Withers DJ, Gutierrez JS, Towery H, Burks DJ, Ren JM, Previs S, Zhang Y, Bernal D, Pons S, Shulman GI, Bonner-Weir S & White MF (1998). Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900-904 [Medline]
Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P & Kadowaki T (2001). The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 7, 941-946 [Medline]
Zeger SL , & Liang KY (1986). Longitudinal data analysis for discrete and continuous outcomes. Biometrics 42, 121-130 [Medline]
Zhang Y, Proenca R, Maffei M, Barone M, Leopold L & Friedman JM (1994). Positional cloning of the mouse obese gene and its human homologue. Nature 372, 425-432 [Medline]
Zisman A, Peroni OD, Abel ED, Michael MD, Mauvais-Jarvis F, Lowell BB, Wojtaszewski JF, Hirshman MF, Virkamaki A, Goodyear LJ, Kahn CR & Kahn BB (2000). Targeted disruption of the glucose transporter 4 selectively in muscle causes insulin resistance and glucose intolerance. Nat Med 6, 924-928 [Medline]

Acknowledgements

This work was supported by National Heart, Lung and Blood Institute Grants K08 HL68715 to V. Y. Polotsky, K23 HL04065 to N. M. Punjabi, F32 HL71469 to A. E. Rubin, R01 HL71506 to A. R. Schwartz, R01 HL37379 to P. L. Smith and R01 HL63767 and R01 HL66324 to C. P. O'Donnell. The authors gratefully acknowledge Mrs Raisa Gelman for invaluable technical assistance with radioimmune assays, Dr Eric P. Hoffman for performing gene expression analysis, and Drs Brock A. Beamer and Josephine M. Egan for critical reading of the manuscript.


This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Jun, V. Savransky, A. Nanayakkara, S. Bevans, J. Li, P. L. Smith, and V. Y. Polotsky
Intermittent hypoxia has organ-specific effects on oxidative stress
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2008; 295(4): R1274 - R1281.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
K. M. Oltmanns
Abdominal Fat and Sleep Apnea: the Chicken or the Egg?: Response to Pillar and Shehadeh
Diabetes Care, July 1, 2008; 31(7): e61 - e61.
[Full Text] [PDF]


Home page
Diabetes CareHome page
G. Pillar and N. Shehadeh
Abdominal Fat and Sleep Apnea: the Chicken or the Egg?: Response to Oltmanns
Diabetes Care, July 1, 2008; 31(7): e62 - e62.
[Full Text] [PDF]


Home page
J EndocrinolHome page
B. Wang, I S. Wood, and P. Trayhurn
Hypoxia induces leptin gene expression and secretion in human preadipocytes: differential effects of hypoxia on adipokine expression by preadipocytes
J. Endocrinol., July 1, 2008; 198(1): 127 - 134.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
D. Gozal, O. S. Capdevila, and L. Kheirandish-Gozal
Metabolic Alterations and Systemic Inflammation in Obstructive Sleep Apnea among Nonobese and Obese Prepubertal Children
Am. J. Respir. Crit. Care Med., May 15, 2008; 177(10): 1142 - 1149.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
D. A. Myers, K. Hanson, M. Mlynarczyk, K. M. Kaushal, and C. A. Ducsay
Long-term hypoxia modulates expression of key genes regulating adipose function in the late-gestation ovine fetus
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1312 - R1318.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
E. Tasali and M. S. M. Ip
Obstructive Sleep Apnea and Metabolic Syndrome: Alterations in Glucose Metabolism and Inflammation
Proceedings of the ATS, February 15, 2008; 5(2): 207 - 217.
[Abstract] [Full Text] [PDF]


Home page
ChestHome page
E. Tasali, B. Mokhlesi, and E. Van Cauter
Obstructive Sleep Apnea and Type 2 Diabetes: Interacting Epidemics
Chest, February 1, 2008; 133(2): 496 - 506.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
T. Yokoe, L. C. Alonso, L. C. Romano, T. C. Rosa, Robert. M. O'Doherty, A. Garcia-Ocana, K. Minoguchi, and C. P. O'Donnell
Intermittent hypoxia reverses the diurnal glucose rhythm and causes pancreatic {beta}-cell replication in mice
J. Physiol., February 1, 2008; 586(3): 899 - 911.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
G. Pillar and N. Shehadeh
Abdominal Fat and Sleep Apnea: The chicken or the egg?
Diabetes Care, February 1, 2008; 31(Supplement_2): S303 - S309.
[Abstract] [Full Text] [PDF]


Home page
ERRHome page
B. Buyse and the participants of working group 2
Treatment effects of sleep apnoea: where are we now?
Eur. Respir. Rev., December 1, 2007; 16(106): 146 - 168.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. Li, A. Nanayakkara, J. Jun, V. Savransky, and V. Y. Polotsky
Effect of deficiency in SREBP cleavage-activating protein on lipid metabolism during intermittent hypoxia
Physiol Genomics, October 19, 2007; 31(2): 273 - 280.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
V. Savransky, S. Bevans, A. Nanayakkara, J. Li, P. L. Smith, M. S. Torbenson, and V. Y. Polotsky
Chronic intermittent hypoxia causes hepatitis in a mouse model of diet-induced fatty liver
Am J Physiol Gastrointest Liver Physiol, October 1, 2007; 293(4): G871 - G877.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Ye, Z. Gao, J. Yin, and Q. He
Hypoxia is a potential risk factor for chronic inflammation and adiponectin reduction in adipose tissue of ob/ob and dietary obese mice
Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1118 - E1128.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
X.-Q. Chen, J. Dong, C.-Y. Niu, J.-M. Fan, and J.-Z. Du
Effects of Hypoxia on Glucose, Insulin, Glucagon, and Modulation by Corticotropin-Releasing Factor Receptor Type 1 in the Rat
Endocrinology, July 1, 2007; 148(7): 3271 - 3278.
[Abstract] [Full Text]