| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Animal Science, University of Wyoming, Laramie, WY 82071, USA
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
3 more piglets litter-1) and reduced placental sizes. Placental vessel density increases progressively after day 50 of gestation in the pig, and is positively correlated with PE and placental expression of vascular endothelial growth factor (VEGF), a potent angiogenic and permeability factor. To elicit its vascular effects, VEGF must bind to its receptors (R), VEGF-R1 and VEGF-R2. The objective of this study was to compare placental and endometrial blood vessel density and placental VEGF, VEGF-R1 and VEGF-R2 mRNA expression in day 70 and 90 conceptuses from Yorkshire females selected for high PE, low PE, and from unselected controls. A greater (P < 0.05) PE was observed for conceptuses in the high PE selection group when compared to the low PE selection group. Placental blood vessel density increased (P < 0.05) from day 70 to 90 (1.8 ± 0.1 versus 2.8 ± 0.2) in association with increases (P < 0.05) in placental VEGF mRNA expression. No selection group differences were observed in expression of VEGF, VEGF-R1, or VEGF-R2 on day 70. By day 90, however, placentae of conceptuses from the high PE group expressed greater (P < 0.05) amounts of VEGF and VEGF-R1 mRNA than the unselected controls and the low PE group. These data demonstrate that increased placental expression of the VEGF receptor system is associated with increased placental vascular density observed with the advancement of gestation in the pig. Although placental blood vessel density was not increased in the high PE selection group, elevated levels of the VEGF receptor system suggest an effect on increasing placental and endometrial blood vessel permeability and/or proximity in the high PE group.
(Received 15 September 2003;
accepted after revision 22 October 2003;
first published online 24 October 2003)
Corresponding author S. P. Ford: 113 Animal Science/Molecular Biology Complex, Department of Animal Science, University of Wyoming, Laramie, WY 82071, USA. Email: spford{at}uwyo.edu
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In order to determine if placental size was heritable in our Yorkshire population, Wilson et al. (1999) developed a method of matching each piglet with its placenta at farrowing. As each piglet appeared at the vulva, its umbilical cord was double tagged and ligated, and the tagged cord allowed to retract into the birth canal. After farrowing and placental expulsion, each piglet's birth weight was matched with the weight of its placenta. Wilson et al. (1999) selected piglets with a birth weight of >1200 g and an above-average PE and placed them in the high PE selection group, and piglets of similar weight and below-average PE were placed in the low PE selection group. Interestingly, he noted that there was a four-fold variation in placental efficiency within an individual litter. When he bred boars and gilts of the high PE selection group together, placental weight was dramatically reduced and litter size was increased (3 live piglets litter-1) compared with the litters produced by the low PE boars and gilts (Wilson et al. 1999). These data are supported by Leenhouwers et al. (2001), who reported that piglets from females selected for high estimated piglet survival to weaning exhibited markedly greater PE than piglets from the low estimated piglet survival line.
We have also previously demonstrated that in the pig placental vessel density (or the number of placental vessels per unit area) increases markedly and progressively after day 50 of gestation and is positively correlated with PE as well as increases in placental expression of vascular endothelial growth factor (VEGF; Vonnahme et al. 2001). The potent angiogenic factor, VEGF, is a secreted 45-kDa dimeric ligand binding glycoprotein which increases endothelial cell proliferation, migration and capillary permeability when it binds to its receptors (R), VEGF-R1 and VEGF-R2 (Neufeld et al. 1999; Stacker & Achen, 1999).
The objective of this study was to compare placental and endometrial blood vessel density and placental VEGF, VEGF-R1, and VEGF-R2 mRNA expression from day 70 and day 90 conceptuses from females selected for high PE, low PE and from unselected controls after three additional generations of selection for PE beyond that reported by Wilson et al. (1999).
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Populations of Yorkshire pigs originally selected for high or low PE by Wilson et al. (1999) continued to be selected and bred within a group over four generations by the placental tagging technique. During generation 4, females from the high PE selection group (n= 4), low PE selection group (n= 4) and an unselected control group (n= 4) were bred to boars in their respective group at the onset of oestrus (day 0) and 12 h later. Females were killed by applying an electrical current across the brain (two per selection group) on day 70 and on day 90 of gestation at the Iowa State University Meat Laboratory, a USDA inspected facility, in accordance with procedures approved by the Institutional Animal Care & Use Committee and the FASS Guide (1999). Days 70 and 90 of gestation were chosen for sample collection as this is the initial period of rapid placental vascular proliferation in the Meishan pig (Biensen et al. 1998), and the interval when placental VEGF mRNA levels begin to increase in the Yorkshire pig (Vonnahme et al. 2001). The gravid uterus was immediately transported on ice to the laboratory (<5 min) for further processing. At the laboratory, each uterine horn was opened along the antimesometrial side. Noting its location in the horn, each fetus was removed, weighed, and a crown–rump length recorded. A 3 cm x 4 cm section of the uteroplacental interface located 2–3 cm from the umbilical attachment site of each fetus was collected, placed in a tissue cassette (Fisher Brand; Fisher Scientific, Pittsburgh, PA, USA) and fixed in 4 % paraformaldehyde. Next, a small portion (4 g) of placental tissue adjacent to the excised uteroplacental section was collected and snap frozen on liquid nitrogen for RNA extraction. The ends of each placenta were marked with dissection pins placed in the uterine wall, and placentae were peeled from the endometrium and weighed. The implantation site length for each conceptus was then measured using a cloth tape measure. In order to obtain a measure of PE, the weight of each fetus was divided by the weight of its placenta.
Histology and vascular density determination
After fixation, uteroplacental sections were dehydrated in a series of ethanol solutions and paraffin embedded using procedures previously established in our laboratory (Biensen et al. 1998). Vascular measurements were determined for utero-placental sections from 12 randomly selected conceptuses from litters in each selection group and the unselected control group on days 70 and 90. Paraffin-embedded placental/endometrial sections were sectioned at 5 µm, stained with periodic acid–Schiff reagent, counterstained with haematoxalin, and traced for quantification of vascular measurements as previously described (Vonnahme et al. 2001). For each placental: endometrial interface, images of two fields from each of four slides with stained tissues were projected on to a sheet of paper using a projecting microscope (XM150; Kramer Scientific, New York, NY, USA) and the areas occupied by placental and adjacent endometrial tissues were individually traced. In each of these areas, the blood vessels were traced so that the area and number of all vessels could be determined via image analysis (Bioquant; Nashville, TN, USA; Biensen et al. 1998), values were then averaged across the eight sections examined.
Placental VEGF, VEGF-R1, VEGF-R2 mRNA expression
To determine the levels of VEGF, VEGF-R1, and VEGF-R2 mRNA in the pig placenta, a pig-specific probe was needed for use in the RNase protection assay. Details for the porcine VEGF probe generation are previously published (Vonnahme et al. 2001). Primers for VEGF-R1 and VEGF-R2 were designed from the full-length porcine sequence established from ARS-USDA MARC (Clay Center, NE, USA; VEGF-R1 sense 5'-GCAGGATCCGACG-AGCAACAGCGGCTTCACG-3' and antisense 5'-GTAG-AATTCAGCTGGAGTGGCAGAAAGT-3' corresponding to base pairs 2039–2403; VEGF-R2 sense 5'-GCAGGAT-CCGGCTCTGGCCCAACAATCAGAG-3' and antisense 5' - GTAGAATTCCCTCGCACAAAGGGACACAT - 3' corresponding to base pairs 230–544; primers designed with cloning restriction sites). While there has been no report of the soluble truncated form of VEGF-R1 in the pig, care was taken to design porcine VEGF-R1 primers homologous to regions within human and mouse sequences which do not share homology with the truncated form of VEGF-R1. Porcine placental RNA was reversed transcribed using Moloney murine leukaemia virus reverse transcriptase. Conditions were optimized, and the polymerase chain reaction (PCR) was performed. A 5-min extension time was added to the cycling programme to insure ample addition of dATP to the 3' end of the PCR amplicon for ligation in to the pCR2.1 plasmid (Invitrogen, Carlsbad, CA, USA). The VEGF-R1 and VEGF-R2 inserts were then subcloned into Bluescript SK+-plasmid (Stratagene, La Jolla, CA, USA).
RNase protection assay
The in vitro transcription assay and RNase protection assay were performed as previously described (Wilson et al. 2000) in our laboratory with the following exceptions. Detection of placental VEGF mRNA and the housekeeping gene, pyruvate dehydrogenase (PD) was performed using the HybSpeed RNase Protection Assay kit as previously described (Vonnahme et al. 2001). Briefly, protected fragments resulted in two bands using the VEGF probe representing messages that coded for the VEGF165 fragment (exons 1–5 and 7) or the VEGF121, VEGF189 and VEGF206 fragments (exons 1–5; Fig. 1). To quantify VEGF mRNA levels for each placental sample, counts from both VEGF bands were summed and divided by the counts in the PD band to correct for slight differences in sample loading. Although the pattern of VEGF165 was positively correlated (r= 0.87; P < 0.0001) to the pattern of total VEGF mRNA expression, we cannot determine the exact patterns of isoforms 121, 189 and 206, and therefore we only report the total amount of VEGF mRNA expression. A second RNase protection assay was performed utilizing probes for VEGF-R1, VEGF-R2 and PD (Fig. 2). Plasmids containing either VEGF-R1 or VEGF-R2 were linearized with the Sac-1 restriction enzyme. Radiolabelled RNAs were synthesized from these linear DNA templates with 10 U of T7 RNA polymerase according to the manufacturer's protocol (Ambion, Austin, TX, USA). Preliminary RPAs were performed where a range of input sample RNA was added using a constant amount of high specific probe (i.e. 3 x 108 cpm µg-1). The intensity of the band representing each protected fragment should increase with increasing amounts of input RNA when there is excess probe present. When the signal remained the same with more input RNA, then there was not a molar excess of probe and the RPA would not be quantitative. The optimal amount of RNA added to each reaction was determined to be 20 µg. To quantify mRNA expression levels, counts from VEGF or VEGF-R1 or VEGF-R2 bands were divided by the counts in the PD band to correct for slight differences in sample loading. To correct for between-gel variation, a pool of placental RNA was included in each assay and therefore data are presented relative to the mRNA levels in the control sample.
|
|
Data were analysed using the general linear model procedure of SAS (SAS Institute Inc. Version 8.0; Cary, NC, USA). The experimental unit in this study was an individual conceptus, as it has been determined that PE is an individual conceptus trait (Wilson et al. 1999; Ford et al. 2002). In order to confirm that there was no effect of sow or selection scheme on PE, the percentage variation around mean PE was calculated. The effect of selection group and sow on percentage variation around the mean was analysed by the homogeneity of variance test using the Brown and Forsythe's variation of Levene's test. Percentage variation around the mean was calculated by subtracting mean PE from an individual's PE and dividing this by the individual's PE. This value was then put on a percentage basis. There was no effect of sow or selection group on the percentage of variation around the mean for PE (P= 0.98), indicating that an individual sow and our selection process did not impact the potential variation for PE within a litter. Day of gestation and selection group were included in the class statement. The effects of day of gestation and selection group were tested for the variables fetal weight, placental weight, PE, crown–rump length, implantation site length, relative number of placental blood vessels, relative number of endometrial blood vessels, placental blood vessel diameter, endometrial blood vessel diameter, and placental VEGF, VEGF-R1 and VEGF-R2 mRNA expression levels. Separation of means was accomplished using the least squared means procedure. P values of <0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In association with the progressive increase in placental vascularity from day 50 to term, Meishan conceptuses exhibit progressive increases in the expression of VEGF, VEGF-R1 and VEGF-R2 (Vonnahme & Ford, 2002a). In contrast, while Yorkshire conceptuses also exhibit a progressive increase in placental VEGF mRNA expression during this period, placental VEGF-R1 mRNA and VEGF-R2 mRNA levels are highly variable. These data suggest a role for both VEGF receptors in mediating the progressive increase in the vascularity of the Meishan placenta. The biological implications of this differential pattern of vascular development in the placenta of the Meishan versus Yorkshire conceptuses was addressed by Vonnahme & Ford (2002b). They determined that Yorkshire, but not Meishan conceptuses, accelerate placental growth when adjacent litter mates perish as late as day 40 of gestation. This failure of surviving Meishan conceptuses to accelerate their placental growth may be a result of the breed's documented ability to increase placental vascularity to meet fetal demands. This strategy of a reduced placental growth and increased placental vascularity may also be present in piglets of domestic pig breeds, as selection of breeding stock with increased PE results in increased litter sizes and conceptuses with smaller, more vascular placentae (Wilson et al. 1999).
As mentioned previously, VEGF elicits its vasoactive actions via its receptors, VEGF-R1 and VEGF-R2. Although it was initially thought that the receptors for VEGF would be found exclusively on the endothelial cells, VEGF and its receptors have been localized to other tissues including the endometrium and placenta of the human (Charnock-Jones et al. 1994; Clark et al. 1996) and the pig (Winther et al. 1999; Charnock-Jones et al. 2001; Vonnahme et al. 2001). Vascular endothelial growth factor receptors seem to play different roles in the angiogenic process as VEGF-R2 deficient mouse conceptuses fail to develop endothelial cells or blood islands (Shalaby et al. 1995), whereas mice deficient in VEGF-R1 develop endothelial cells, but lack proper vascular lumen formation (Fong et al. 1995). While endothelial cell proliferation (Seetharam et al. 1995) and migration (Waltenberger et al. 1994) appear to be primarily a result of VEGF acting via VEGF-R2, vascular permeability and endothelial cell differentiation appear to be regulated by VEGF's actions via VEGF-R1 (Peters et al. 1993).
Vascular endothelial growth factor has been localized to the chorionic and uterine luminal epithelium of the pig (Winther et al. 1999; Vonnahme et al. 2001), and there is a progressive increase in immunostaining from mid- to late gestation (Vonnahme et al. 2001). In addition, we have localized VEGF-R1 and VEGF-R2 to the endothelium of adjacent placental and endometrial blood vessels during late gestation (S. P. Ford, unpublished data). These progressive increases in VEGF, VEGF-R1 and VEGF-R2 at the placental: endometrial interface may play a significant role in the reported decrease in intercapillary distance from 40 µm to 2 µm at the summit and lateral sides of the chorionic ridges from early to late gestation (Friess et al. 1980). This decrease in intercapillary distance results from epithelial cell thinning and from the protrusion of vessels into the chorionic and uterine luminal epithelial cells (Friess et al. 1980). Blood gases pass from maternal to fetal blood by simple diffusion, which is dependent on the surface area available for transfer, and the physical distance separating endometrial and placental capillaries (Villee, 1965). In contrast, Friess et al. (1980) presented morphological and histological evidence that the transport of less diffusible materials (i.e. glucose, amino acids, etc.) occurs in the chorionic troughs, where the chorionic and uterine luminal epithelium remain high columnar. Even in these areas, an increased density and/or permeability of fetal and endometrial capillaries would improve transfer mechanisms such as facilitated diffusion, active transport and pinocytosis (Sperhake, 1971).
While placental vascular density increased from day 70 to day 90 of gestation for all conceptuses in this study, we observed no preferential increase in placental vascular density in the high PE selection group to account for the greater fetal/placental weight ratio in this group on day 90 when compared to the low PE selection group or the unselected controls. It is conceivable that the elevated levels of VEGF-R1 and VEGF-R2 mRNA in the high PE selection group on day 90 may have resulted in an augmented capillary permeability and/or a reduced placental: endometrial intercapillary distance through endothelial cell proliferation and migration. Additional studies will be needed, however, to quantify selection group differences in intercapillary distances and the transport of blood gases and nutrients across the fetal: maternal interface to confirm this hypothesis.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Charnock-Jones DS, Clark DE, Licence D, Day K, Wooding FB & Smith SK (2001). Distribution of vascular endothelial growth factor (VEGF) and its binding sites at the maternal_fetal interface during gestation in pigs. Reproduction 122, 753–760.[Abstract]
Charnock-Jones DS, Sharkey AM, Boocock CA, Ahmed A, Plevin R, Ferrara N & Smith SK (1994). Vascular endothelial growth factor receptor localisation and activation in human trophoblast and choriocarcinoma cells. Biol Reprod 51, 524–530.[Abstract]
Christenson
RK, Leymaster
KA
&
Young
LD (1987). Justification of unilateral hysterectomy-ovariectomy as a model to evaluate uterine capacity in swine. J Anim Sci
65, 738–744.
Clark
DE, Smith
SK, Sharkey
AM
&
Charnock-Jones
DS (1996). Localization of VEGF and expression of its receptors flt and KDR in human placenta throughout pregnancy. Hum Reprod
11, 1090–1098.
Dziuk
PJ (1968). Effect of number of embryos and uterine space on embryo survival in the pig. J Anim Sci
27, 673–676.
Federation of Animal Science Societies (1999). FASS Guide For the Care and Use of Agricultural Animals in Agricultural Research and Teaching, first revised edition, p. 24.
Fenton
FR, Bazer
FW, Robison
OW
&
Ulberg
LC (1970). Effect of quantity of uterus on uterine capacity in gilts. J Anim Sci
31, 104–106.
Fenton
FR, Schwartz
FL, Bazer
FW, Robison
OW
&
Ulberg
LC (1972). Stage of gestation when uterine capacity limits embryo survival in gilts. J Anim Sci
35, 383–388.
Fong GH, Rossant J, Gertsenstein M & Breltman ML (1995). Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature 376, 66–70.[CrossRef][Medline]
Ford
SP, Vonnahme
KA
&
Wilson
ME (2002). Uterine capacity in the pig reflects a combination of uterine environment and conceptus genotype effects. J Anim Sci
80 (E. Suppl. 1), E66–E73.
Ford SP & Youngs CR (1993). Early embryonic development in prolific Meishan pigs. J Reprod Fert 48, 271–278.
Friess AE, Sinowatz F, Skolek-Winnisch R & Trautner W (1980). The placenta of the pig. I. Finestructural changes of the placental barrier during pregnancy. Anat Embryol 158, 179–191.[CrossRef][Medline]
Leenhouwers JI, Knol EF, de Groot PN, Vos H & van der Lende T (2001). Fetal development in the pig in relation to genetic merit for piglet survival. In Biologic Aspects of Genetic Differences in Piglet Survival, Doctoral Thesis. Wageningen, The Netherlands.
Monk
EL
&
Erb
RE (1974). Effect of unilateral ovariectomy and hysterectomy on reproductive parameters in the gilt during early pregnancy. J Anim Sci
39, 366–372.
Neufeld
G, Cohen
T, Gengrinovitch
S
&
Poltorak
Z (1999). Vascular endothelial growth factor (VEGF) and its receptors. FASEB J
13, 9–22.
Peilieu C (1985). Pig breeds. In Livestock Breeds of China, pp. 159–194. FAO and China Academic Publishers, Rome.
Peters
KG, De Vries
C
&
Williams
LT (1993). Vascular endothelial growth factor receptor expression during embryogenesis and tissue repair suggests a role in endothelial differentiation and blood vessel growth. Proc Natl Acad Sci USA
90, 8915–8919.
Pope
CE, Christenson
RK, Zimmerman-Pope
VA
&
Day
BN (1972). Effect of number of embryos on embryonic survival in recipient gilts. J Anim Sci
35, 805–808.
SAS (2003). SAS Systems for Windows, version 8.0. SAS Institute Inc, Cary, NC, USA.
Seetharam L, Gotoh N, Maru Y, Neufeld G, Yamaguchi S & Shibuya M (1995). A unique signal transduction form FLT tyrosine kinase, a receptor for vascular endothelial growth factor VEGF. Oncogene 10, 135–147.[Medline]
Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu X-F, Breltman ML & Schuh AC (1995). Failure of blood island formation and vasculogenesis in flk-1-deficient mice. Nature 376, 62–66.[CrossRef][Medline]
Sperhake B (1971). Zur Durchlassigkeit der placenta des schweines. Eine Literautrstudie. Inaug Diss Hannoever; Thesis.
Stacker SA & Achen MG (1999). The vascular endothelial growth factor family: signalling for vascular development. Growth Factors 17, 1–11.[Medline]
Villee CA (1965). Placental transfer of drugs. Ann N Y Acad Sci 123, 237–244.[Medline]
Vonnahme KA & Ford SP (2002a). Role of vascular endothelial growth factor (VEGF) in placental vascular development, placental efficiency and litter size in the pig. In Proceedings for Perspectives in Pig Science. University of Nottingham, Sutton Bonington, UK.
Vonnahme
KA
&
Ford
SP (2002b). Conceptus competition for uterine space: different strategies exhibited by the Meishan and Yorkshire pig. J Anim Sci
80, 1311–1316.
Vonnahme
KA, Wilson
ME
&
Ford
SP (2001). Relationship between placental vascular endothelial growth factor expression and placental/endometrial vascularity in the pig. Biol Reprod
64, 1821–1825.
Waltenberger
J, Claesson-Welsh
L, Siegbahn
A, Shibuya
M
&
Heldin
CH (1994). Different signal transduction properties of KDR and Flt-1, two receptors for vascular endothelial growth factor. J Biol Chem
269, 26988–26995.
Webel
SK
&
Dziuk
PJ (1974). Effects of stage of gestation and uterine space on prenatal survival in the pig. J Anim Sci
38, 960–967.
Wilson
ME, Biensen
NJ
&
Ford
SP (1999). Novel insight into the control of litter size in pigs, using placental efficiency as a selection tool. J Anim Sci
77, 1654–1658.
Wilson ME, Sonstegard TS, Smith TPL, Fahrenkrug SC & Ford SP (2000). Differential gene expression during elongation in the pig embryo. Genesis 26, 9–14.[CrossRef][Medline]
Winther H, Ahmed A & Dantzer V (1999). Immunohistochemical localization of vascular endothelial growth factor (VEGF) and its two specific receptors, Flt-1 and KDR, in the porcine placenta and non-pregnant uterus. Placenta 20, 35–43.[Medline]
This article has been cited by other articles:
|
|
 |
|
  K. A. Vonnahme, M. J. Zhu, P. P. Borowicz, T. W. Geary, B. W. Hess, L. P. Reynolds, J. S. Caton, W. J. Means, and S. P. Ford Effect of early gestational undernutrition on angiogenic factor expression and vascularity in the bovine placentome J Anim Sci, October 1, 2007; 85(10): 2464 - 2472. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Wu, F. W. Bazer, J. M. Wallace, and T. E. Spencer BOARD-INVITED REVIEW: Intrauterine growth retardation: Implications for the animal sciences J Anim Sci, September 1, 2006; 84(9): 2316 - 2337. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Vonnahme, M. E. Wilson, Y. Li, H. L. Rupnow, T. M. Phernetton, S. P. Ford, and R. R. Magness Circulating levels of nitric oxide and vascular endothelial growth factor throughout ovine pregnancy J. Physiol., May 15, 2005; 565(1): 101 - 109. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Vonnahme and S. P. Ford Differential Expression of the Vascular Endothelial Growth Factor-Receptor System in the Gravid Uterus of Yorkshire and Meishan Pigs Biol Reprod, July 1, 2004; 71(1): 163 - 169. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
