J Physiol JP - online manuscript tracking
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 554, Number 2, 309-320, January 15, 2004 DOI: 10.1113/jphysiol.2003.053579
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
554/2/309    most recent
jphysiol.2003.053579v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tavi, P.
Right arrow Articles by Ruskoaho, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tavi, P.
Right arrow Articles by Ruskoaho, H.

Pacing-induced calcineurin activation controls cardiac Ca2+ signalling and gene expression

Pasi Tavi1,4, Sampsa Pikkarainen2, Jarkko Ronkainen1, Perttu Niemelä3, Mika Ilves1, Matti Weckström3, Olli Vuolteenaho1, Joseph Bruton4, Håkan Westerblad4 and Heikki Ruskoaho2

1 Department of Physiology, Division of Biophysics, Biocentre Oulu, University of Oulu, Finland 2 Department of Pharmacology and Toxicology, Division of Biophysics, Biocentre Oulu, University of Oulu, Finland 3 Department of Physical Sciences, Division of Biophysics, Biocentre Oulu, University of Oulu, Finland 4 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Calcineurin, a Ca2+–calmodulin-dependent protein phosphatase (PP2B) is one of the links between Ca2+ signals and regulation of gene transcription in cardiac muscle. We studied the Ca2+ signal specificity of calcineurin activation experimentally and with modelling. In the rat atrial preparation, an increase in pacing frequency increased nuclear activity of the calcineurin-sensitive transcription factor, nuclear factor of activated T-cells (NFAT), 2-fold in a cyclosporin A (CsA)-sensitive manner. In line with this, modelling results predicted that the frequency of cardiac Ca2+ transients encodes the stimulus for calcineurin activation. We further observed experimentally that calcineurin inhibition by CsA modulated Ca2+ release in a Ca2+-dependent manner. CsA had no effect on [Ca2+]i at a pacing frequency of 1 Hz but it significantly suppressed the amplitude of Ca2+ transients, systolic [Ca2+]i and time averaged [Ca2+]i at 6 Hz. Calcineurin had a differential role in the expression of immediate-early genes B-type natriuretic peptide (BNP) and c-fos. CsA inhibited the pacing-induced BNP gene expression, whereas pacing alone had no effect on the expression of c-fos. However, in the presence of CsA, c-fos mRNA levels were significantly augmented by increased pacing frequency. These results show that frequency-dependent calcineurin activation has a specific role in [Ca2+]i regulation and gene expression, constantly recruited by varying cardiac Ca2+ signals.

(Received 18 August 2003; accepted after revision 16 October 2003; first published online 17 October 2003)
Corresponding author P. Tavi: Karolinska Institutet, 17177 Stockholm, Sweden.  Email: pasi.tavi{at}fyfa.ki.se


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Muscle cells are capable of changing their structure and function in response to altered activity. Research in recent years shows that Ca2+ has a central role in this adaptation process (for review see Molkentin, 2000; Wilkins & Molkentin, 2002; Frey & Olson, 2003). One suggested link between the free myoplasmic Ca2+ concentration ([Ca2+]i) and altered gene expression is the Ca2+–calmodulin-dependent protein phosphatase-2B, calcineurin (Timmerman et al. 1996; for review see Rusnak & Mertz, 2000). Activated calcineurin mediates nuclear translocation of cytosolic nuclear factor of activated T-cells (NFAT), which controls transcription co-operatively with other transcription factors, e.g. activator protein-1 (AP-1), myocyte enhancer factor and GATA-4 (Molkentin et al. 1998; Wu et al. 2000; Macian et al. 2000; for review see Rao et al. 1997).

Originally it was shown that transgenic mice with constitutively active calcineurin develop cardiac hypertrophy and express fetal cardiac genes (Molkentin et al. 1998), making the calcineurin–NFAT pathway an attractive candidate for coupling of Ca2+ signals to cardiac gene expression. Moreover, overexpression of an endogenous calcineurin inhibitory protein, modulatory calcineurin-interacting protein-1 (MCIP1), inhibits hypertrophy induced by overexpression of constitutively active calcineurin or chronic administration of ß-adrenoreceptor agonist (Rothermel et al. 2001), indicating that activation of calcineurin is critical for the development of the hypertrophy. However, pharmacological inhibition of calcineurin in a variety of rodent models of heart disease has produced controversial results. Calcineurin inhibitors (CsA or FK506) have been reported to inhibit the load-induced hypertrophy (Shimoyama et al. 1999; Zou et al. 2000) or to have no effect (Ding et al. 1999). CsA has even been found to escalate the development of the mouse cardiomyopathy induced by a myosin heavy chain mutation (Fatkin et al. 2000). Furthermore, calcineurin inhibition is not selective to the pathological hypertrophy, since both CsA (Eto et al. 2000) and MCIP1 (Rothermel et al. 2001) also suppress the favourable hypertrophic adaptation to exercise. One possible explanation for these conflicting results could be that the effect of calcineurin inhibition depends on the hypertrophic model used. For example, lack of MCIP1 in mice heart results in an increased hypertrophic response to overexpression of constitutively active calcineurin, but a reduced hypertrophic response to pressure overload and to adrenergic stimulation (Vega et al. 2003), suggesting that calcineurin may have a different role depending on the stimulus inducing the hypertrophy.

While there is strong evidence from genetic mouse models to support the involvement of calcineurin in the development of various forms of hypertrophy (for reviews see Molkentin, 2000; Wilkins & Molkentin, 2002; Frey & Olson, 2003), very little is known about the normal Ca2+ activation of calcineurin and its immediate functional implications. Because the frequency of Ca2+ transients encodes an adequate stimulus for calcineurin activation in skeletal muscle (Liu et al. 2001; Kubis et al. 2002), we first examined if cardiac calcineurin is activated by pacing-induced [Ca2+]i changes in rat atrium. Secondly, since it was reported that calcineurin inhibitors (McCall et al. 1996; Janssen et al. 2000) and/or activated calcineurin (Bandyopadhyay et al. 2000; Münch et al. 2002) regulate the [Ca2+]i balance in cardiac myocytes, we studied the Ca2+-dependent effects of CsA on the myocyte Ca2+ signalling. Thirdly, the findings that in several cell types the calcineurin–NFAT cascade has been implicated in both activation (Rao et al. 1997; Molkentin et al. 1998; Macian et al. 2000) and suppression of the expression of immediate genes (Su et al. 1996; Bito et al. 1996; Schaefer et al. 1998) led us to examine if the calcineurin-dependent transcriptional pathway shows dual effects with respect to the expression of immediate-early genes.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Preparation and perfusion of rat atrial appendix

The rat atrial appendix preparation was set up and perfused as previously described (Tavi et al. 1999). The Animal Use and Care Committee of the University of Oulu approved the experimental design. Male Sprague-Dawley rats weighing 290–400 g were used. The rats were decapitated, and the hearts were rapidly removed and placed in oxygenated (ca 10°C) Tyrode buffer solution (mM): 113.8 NaCl; 17.6 NaHCO3; 4.7 KCl; 2.0 CaCl2; 1.1 MgSO4; 1.2 KH2PO4; 11.0 glucose; and 10 µIU ml-1 insulin; pH was 7.4 when bubbled with 5% CO2–95% O2 gas. The same solution was used for superfusion of the atrium (2.5 ml min-1) at 37°C. The atria were paced with a field stimulus (1 ms, 50% over threshold) by two platinum electrodes located inside the perfusion chamber. CsA (1 µM, Sigma-Aldrich) was applied to the perfusion medium 30 min before the change of the pacing frequency. For mRNA measurements the atria were preincubated for 50 min with 1 Hz pacing, followed by 30 min pacing at 1, 4, 5, or 6 Hz. The tissue was frozen in liquid nitrogen and stored at –70°C.

[Ca2+]i measurements

For indo-1AM loading, the atria were superfused for 25–40 min at 25–32°C (flow 7 ml min-1) with Tyrode solution (volume 4 ml) containing (mM): 103.8 NaCl; 17.6 NaHCO3; 4.7 KCl; 2.0 CaCl2; 1.1 MgSO4; 1.2 KH2PO4; 10 glucose; 9.1 sodium pyryvate. Indo-1 AM (Molecular Probes, Europe) was dissolved in DMSO with 20% Pluronic. The final concentration of indo-1 AM was 20 µM and the amount of DMSO/Pluronic was 25 µl ml-1 Tyrode solution. The solution was bubbled with 5% CO2–95% O2 (pH 7.4). The Ca2+ measurement setup has been previously described (Tavi et al. 1998, 1999). The Indo-1 emission ratio (405 nm/485 nm) was acquired at 200 Hz with two photomultiplier tubes (Hamamatsu, Japan) and filtered at 100 Hz. Both excitation and emission were guided to and from the tissue with a quartz fibre optic cable (diam. 1 mm). The distance between the tissue and the cable head was constant (~3 mm) and the illuminated area covered 100% of the tissue area facing the cable. Therefore the amount of the Indo-1 molecules within the illuminated area was constant. For calibration of the measured signal, Rmin and Rmax were determined at the end of each experiment. To get Rmin the atria were perfused with Ca2+-free buffer (0 Ca2+, 0.5 Mg2+, 5 mM EGTA) containing 10 µM of the Ca2+ ionophore 4-Br-A23187 (Molecular Probes) until a steady state fluorescence signal was obtained (10–12 min). This was followed by perfusion with high Ca2+ solution (15 mM) with 10 µM Ca2+ ionophore. The atria was then exposed to high frequency stimulation (8–10 Hz), resulting in a tetanic-like contraction within 10 min and a steady-state value of Rmax. To evaluate the degree of loading of the non-cytosolic compartments, 1 mM of Mn2+ was applied at the end of calibration procedure. The residual fluorescence after Mn2+ was 6 ± 2% (n= 6) representing the maximal error caused by non-cytosolic fluorescence. To estimate the non-myocyte fluorescence, we induced Ca2+ release in endothelial cells with 10 µM bradykinin (Field et al. 1994), which caused no detectable change in the fluorescence (n= 4), indicating that either the tissue does not contain endothelial cells or these cells were not loaded with indo-1. The [Ca2+]i was calculated by using Grynkiewicz formalism:


(1)
where Kd is the dissociation constant for indo-1 and ß is the ratio of the free/bound indo-fluorescence at 485 nm from measured Rmin and Rmax. We used a Kd value of 844 nM determined in cellular environment of cardiac myocytes (Bassani et al. 1995).

Isolation of mRNA and quantitative PCR

Total RNA was prepared from rat atria and used as a template for the cDNA first strand synthesized by M-MuLV reverse transcriptase. The quantitative PCR reactions were performed with an ABI 7700 Sequence Detection System using the TaqMan chemistry. The forward and reverse primers for rat b-type natriuretic peptide (BNP) mRNA detection were TGGGCAGAAGATAGACCGGA and ACAACCTCAGCCCGTCACAG, and for c-fos GGCTGAACCCTTTGATGACTTC and GGGCAGTCTCCGAGCCA, respectively. The bifunctional fluorogenic probes for BNP and c-fos were 5'-Fam-CCAAGCGACTGACTGCGCCG-Tamra-3' and 5'-Fam-TGTTTCCGGCATCATCTAGGC-Tamra-3', respectively. The results were normalized to 18S RNA quantified from the same samples as previously described (Majalahti-Palviainen et al. 2000).

Oligonucleotides and EMSA

All oligonucleotides were purchased from Sigma Chemical Co. For electrophoretic mobility shift assay (EMSA), the NFAT binding element located at –927 bp BNP promoter (NFAT-BNP, Molkentin et al. 1998) was used as probe and intact and mutated NFAT binding elements of the interleukin-2 promoter (NFAT-IL-2 and NFATmut-IL-2, respectively, Northrop et al. 1994) were used as unlabelled competitor oligonucleotides (coding strand shown, point mutations in bold and 5'-overhangs in italics): NFAT-BNP, 5'-AGAGCTATCCTTTTGTTTTCCATCCTGGCCC-3'; NFAT-IL-2, 5'-AGAGCGCCCAAAGAGGAAAATTTGTTTCATAGCCC-3' and NFATmut-IL-2: 5'-AGAGCGCCCAAAGCTTAAAATTTGTTTCATAGCCC-3'. The sense and corresponding antisense oligonucleotides were annealed to generate double-stranded oligonucleotides. NFAT-BNP was sticky-end-labelled with [32P]-dCTP by Klenow enzyme. Nuclear extracts from frozen auricular tissue were prepared (Hautala et al. 2001) and protein concentration from each sample was colourimetrically determined (Bio-Rad Laboratories). For each reaction mixture, 12 µg of nuclear protein and 3 µg of poly(dI-dC) were used in a buffer containing 10 mM Hepes (pH 7.9), 1 mM MgCl2, 50 mM KCl, 1 mM DTT, 1 mM EDTA, 10% glycerol, 0.025% NP-40, 0.25 mM PMSF and 1 µg ml-1 each of leupeptin, pepstatin and aprotinin. Reaction mixtures were incubated with a labelled probe for 15 min followed by non-denaturating gel electrophoresis on 5% polyacrylamide gel. Subsequently, gels were dried and exposed in a PhosphorImager screen and analysed with ImageQuant (Molecular Dynamics, Amersham Biosciences, CA, USA). To confirm DNA sequence specificity of the protein–DNA complex formation, competition experiments with 100 M excesses of unlabelled oligonucleotides with intact or mutated NFAT binding sites were performed. Competitor oligonucleotides were added to the reaction mixture 15 min before the labelled probe.

Model for calcineurin Ca2+ activation

We utilized a previously published reaction scheme for Ca2+- and calmodulin-dependent activation of calcineurin (CaN) (Bhalla & Iyengar, 1999), where parameters have been adjusted to better meet the characteristics of cardiac myocytes. The reactions and the corresponding rate constants of the model are shown in Fig. 1A. All the reactions were incorporated into Mathlab (Mathworks, USA) as time-dependent differential equations of concentration and they were solved using the well-stirred assumption, which states that each molecule has equal access to each other in a single compartment. As initial concentrations we have used 6 µM for calmodulin ([CaM]) (Shannon et al. 2000) and 1 µM for calcineurin ([CaN]) (Bhalla & Iyengar, 1999; Crabtree, 1999) while the other concentrations being zero at the beginning. The reaction rates were taken initially from the previous model (Bhalla & Iyengar, 1999) and the equilibrated CaN-activation was calculated at different Ca2+ concentrations, which allowed plotting of the CaN activation against [Ca2+] (Fig. 1B) and data points were fitted to the Hill equation:


(2)
We compared the parameters of our fitted Hill equation with the published experiments (n= 3, Kd= 0.6 µM, Stemmer & Klee, 1994) and adjusted the reaction rate constants (see Fig. 1A) by re-running the simulations until the Hill coefficients matched. After adjusting the parameters, the responses to three Ca2+ concentration steps of different magnitude were simulated and the time constants of each calcineurin activation/inactivation were determined (Fig. 1C and D). Thereafter, experimentally determined Ca2+ signals (sampling interval 0.005 s) were used as stimuli for the model. The signals were first smoothed with a three-point moving average filter, after which linear interpolation was used to provide continuous signals as input. To solve the differential equations, we used the variable-step Mathlab routine ‘ode45’, based on a fourth order explicit Runge-Kutta formula (Dormand & Prince, 1980) with an average time step of 0.003 s.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1.  Characteristics of the calcineurin model
A, reactions with forward and reverse rates included into the model. CaNAB represents calcineurin A and B subunits, which are always assumed to be bound under physiological conditions. The four-Ca2+-bound form of calcineurin (CaNAB-Ca4) has a small activity, but it is negligible compared to the CaM-bound forms. For clarity, Ca2+ is represented multiple times in the scheme, but it is modelled only as a single reactant. All the CaM-bound forms of calcineurin have been assumed to have the same enzymatic activity, thus the CaN activity can be obtained by simply summing the concentrations of each form. B, steady-state activation of the model. The Hill equation (continuous line) has been fitted to simulated steady-state levels of active calcineurin at different [Ca2+] ({circ}). C, activation time constants of calcineurin in the model upon steps (from 0.2 µM to 0.4, 0.6 or 0.80 µM [Ca2+]. D, deactivation time constants by corresponding Ca2+ stimuli (as in C).

 
Artificial Ca2+ signals were constructed to study the frequency and base-line dependence of the CaN-activation. The experimentally determined 1, 4, 5 and 6 Hz signals were used to determine the shape of an average Ca2+ transient for each frequency. These average transients were then repeated a number of times to form oscillatory signals, which were finally scaled to the same amplitude.

Statistical testing

Results are expressed as mean ±S.E.M. The statistical testing was done with one-way and two-way ANOVA. Pairwise comparisons between different groups were done by Student–Newman-Keuls method (SigmaStat, USA). For comparison between multiple groups, Bonferroni correction was applied. P values smaller than 0.05 were considered statistically significant. The data analysis was done with Origin 6.1 (OriginLab) and equations were solved with Mathlab.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Pacing-induced changes in [Ca2+]i

Increase of the pacing frequency in different types of cardiac preparations causes a substantial Ca2+ accumulation, manifested as an elevation of diastolic [Ca2+]i. This has been reported in rat ventricular trebeculae (Layland & Kentish, 1999; Brandes & Bers, 2002) and in isolated cardiac myocytes of mouse (Antoons et al. 2002; Knollmann et al. 2003), rabbit (Chudin et al. 1999) and cat (Wang et al. 2001). Because both the sustained component of the Ca2+ signal, like the diastolic Ca2+ accumulation, and the frequency of Ca2+ transients activate calcineurin (Timmerman et al. 1996; Rusnak & Mertz, 2000; Kubis et al. 2003), we hypothesized that in cardiac myocytes pacing might serve as a physiological stimulus for calcineurin activation. To quantify this, we measured [Ca2+]i levels from atria paced at different frequencies. At 1 Hz atrial myocytes generated Ca2+ transients from a stable diastolic [Ca2+]i of 200 ± 7 nM to a systolic [Ca2+]i of 802 ± 18 nM, resulting in an amplitude of the transients of 600 ± 21 nM and an average [Ca2+]i of 300 ± 8 nM (n= 24). An increase in the pacing frequency rapidly shifted the diastolic Ca2+ to higher levels as shown by the representative recording in Fig. 2A. The diastolic [Ca2+]i was dependent on the frequency of the pacing and increased up to 511 ± 40 nM after 10 min at 6 Hz (n= 6, Fig. 2B). The increase in diastolic [Ca2+]i was accompanied by a corresponding increase in the systolic and average [Ca2+]i, but there was no change in the amplitude of the Ca2+ transients.



View larger version (32K):
[in this window]
[in a new window]
 
Figure 2.  Pacing increases diastolic, systolic and average [Ca2+]i but does not change the amplitude of Ca2+ transients
A, [Ca2+]i during change in pacing frequency from 1 to 4 Hz. Arrows indicate systolic, diastolic and average Ca2+ (1 s moving average). B, pacing-induced changes at the steady-state in different parameters of [Ca2+]i at different pacing frequencies (1, 4, 5 and 6 Hz, n= 6 each). Note that diastolic, systolic and average [Ca2+]i increase as function of the pacing frequency, whereas the amplitude of Ca2+ transients remains virtually constant.

 
Simulation of calcineurin activation with cardiac Ca2+ signals

To explore the dynamics of calcineurin activation induced by pacing, we used a mathematical model to simulate calcineurin activation using the measured [Ca2+]i signals as input to the model. A data set for each pacing group was selected where [Ca2+]i was closest to the mean values of systolic, diastolic and average as calculated from six identical experiments. The simulations showed that calcineurin activity is ~10% of maximum when the pacing frequency is 1 Hz. This baseline activity is brought about by the diastolic [Ca2+]i since Ca2+ transients at 1 Hz do not cause any accumulative activation of calcineurin in the simulations. By increasing the pacing frequency, the calcineurin activity is increased to ~50% at 4 Hz, to ~60% at 5 Hz and to ~70% at 6 Hz (Fig. 3A). From the simulation with measured [Ca2+]i as an input it cannot be judged how much of the calcineurin activity is caused by diastolic [Ca2+]i increase and how much is due to increase of the frequency of the Ca2+ transients. To study this we modelled artificial data mimicking the normal Ca2+ signals at different frequencies (1, 4, 5 and 6 Hz, Fig. 3B), but with fixed baseline (0.2 or 0.4 µM) and amplitude (0.8 µM). With baseline [Ca2+]i of 0.4 µM, the frequency-dependent calcineurin activity increases from 37% at 1 Hz to 59% at 6 Hz and with baseline [Ca2+]i of 0.2 µM the corresponding values were 13% and 36% (Fig. 3B), indicating that calcineurin is activated by the frequency of cardiac Ca2+ transients.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 3.  Simulated calcineurin (CaN) activation by pacing-induced Ca2+ changesA, simulated calcineurin activity produced by representative [Ca2+]i measurements from rat atrium. Left panel shows samples from the data used at 4, 5 and 6 Hz pacing. B, the steady state CaN activity from simulations with artificial [Ca2+] data with 0.4 µM ({circ}) and 0.2 µM ({square}) baseline [Ca2+], respectively, compared with the simulated CaN activity produced by measured [Ca2+]i changes (•).

 
Effect of cyclosporin on the frequency-dependent Ca2+ changes in the rat atrium

Cyclosporin A has been reported to cause a calcineurin-independent suppression of Ca2+ transients with a corresponding negative inotropy in cardiac muscle by acting on the sarcoplasmic reticulum (SR) (Janssen et al. 2000). However, active calcineurin may modulate the Ca2+ release in cardiac myocytes by regulating the ryanodine receptors (RyRs) (Bandyopadhyay et al. 2000) and reduce the SR Ca2+ uptake by dephosphorylating phopholamban, the regulator of cardiac SR Ca2+-ATPase (Münch et al. 2002). Measuring the Ca2+ dependence of the CsA effect can be used to distinguish between the calcineurin-dependent and calcineurin-independent effects of CsA. When we superfused rat atria paced at 1 Hz with 1 µM CsA for 15 min, no statistically significant differences in any of the measured parameters of [Ca2+]i were observed compared to control experiments without CsA (Fig. 4). However, when CsA was applied prior to 6 Hz pacing, [Ca2+]i was decreased. In six experiments the systolic [Ca2+]i (P < 0.05), the average [Ca2+]i (P < 0.01) and the amplitude of the Ca2+ transients (P < 0.05) were all significantly suppressed compared to control. It should be noted that CsA affected the Ca2+ transients in a biphasic manner. After the onset of 6 Hz pacing the amplitude was transiently increased (Fig. 5A), which was then followed by decay to a lower level than in the control (Fig. 5B). This suggests that calcineurin has a role in the maintenance of Ca2+ release in the face of high levels of [Ca2+]i.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 4.  Cyclosporin A suppresses the pacing-induced [Ca2+]i changes in rat atrium
A, effect of CsA (1 µM) and pacing on the diastolic, systolic, average and amplitude of the Ca2+ transients in rat atrium. Each bar represents mean ±S.E.M. of 6 separate experiments. *P < 0.05 and **P < 0.01.

 


View larger version (21K):
[in this window]
[in a new window]
 
Figure 5.  Cyclosporin A induces biphasic changes in the Ca2+ transient amplitude after onset of the pacing
A, after onset of the 6 Hz pacing in rat atrium [Ca2+]i reaches a steady state within 1 min (left). Pre-incubation of rat atrium with of CsA (1 µM) promotes biphasic behaviour of [Ca2+]i when pacing is switched from 1 to 6 Hz (right). B, mean change in the amplitude of Ca2+-transient in the absence ({blacksquare}) and presence ({circ}) of CsA (1 µM). Note the biphasic behaviour of transient amplitude with CsA characterized by transient increase of the Ca2+ transients before decaying to lower level after 4 min.

 
Effects of calcineurin activation on immediate-early gene expression

To study the immediate effects of calcineurin activation on gene expression, we measured the mRNA levels of two rapidly inducible genes, BNP and c-fos. First we measured pacing sensitivity of the expressions of these genes. Atrial tissues were subjected to different pacing frequencies (1, 4, 6 and 8 Hz) for 30 min and mRNA levels measured. BNP mRNA level showed near-linear pacing dependence, whereas pacing did not affect the c-fos mRNA level (Fig. 6A). From the frequencies used here, 8 Hz pacing for 30 min gave the maximal BNP mRNA response of ~2-fold compared to the baseline expression in 1 Hz. Next we studied the role of calcineurin in these pacing-induced changes in gene expression by exposing atrial tissues to one of the following stimuli for 30 min: 1 Hz pacing, 1 Hz pacing after preincubation (30 min) with 1 µM CsA, 8 Hz pacing, and 8 Hz pacing with preincubation (30 min) with 1 µM CsA. Pacing at 8 Hz induced a significant increase in the BNP mRNA levels (P < 0.05), which was abolished by pre-exposure of CsA (Fig. 6B). It was a surprise to see that while the mRNA levels of c-fos were not sensitive to 8 Hz pacing or CsA alone, pacing at 8 Hz increased the c-fos mRNA levels when the atria were pre-exposed to CsA (n= 6, P < 0.01, Fig. 6C).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 6.  Cyclosporin A inhibits pacing-induced BNP gene expression while it activates c-fos gene expression during pacing
A, relative (1 Hz equals 1) changes in the mRNA (n= 6 each) levels of BNP and c-fos in rat atria exposed to different pacing frequencies at 30 min as function of given pacing frequency. Apparent slope of the linear fit shows clear pacing sensitivity of BNP mRNA but no pacing sensitivity of the c-fos mRNA. The mRNA levels of BNP (B) and c-fos (C) genes from atrial tissues exposed to low pacing 1 Hz (-) or high pacing 8 Hz (+) for 30 min. When indicated, cyclosporin A (CsA, 1 µM) was included in perfusion medium from start of preincubation BNP and c-fos mRNA levels are expressed relative to 18S RNA levels, and each bar represents mean ±S.E.M. of 6 separate experiments. *P < 0.05 and **P < 0.01.

 
Pacing-induced increase in NFAT activity

We isolated nuclear fractions from atria exposed to different pacing and/or CsA and from these fractions we measured the NFAT binding activity on the BNP promoter. This step was taken to answer two questions: first, to determine if pacing-induced Ca2+ changes are sufficient to activate calcineurin and resulting NFAT nuclear translocation, and second, to study if cyclosporin A inhibits the NFAT activation. This indirect method was chosen because the fast inactivation of calcineurin after Ca2+ removal (Stemmer & Klee, 1994) might complicate direct activity measurements from tissue samples, while the calcineurin-induced NFAT nuclear accumulation persists for several minutes (Timmerman et al. 1996; Liu et al. 2001; Kubis et al. 2002). The specificity of NFAT complex formation on BNP promoter was confirmed by the competition analysis for nuclear protein binding with NFAT-BNP as a radioactively labelled probe exposed to 100 M excess of unlabelled competitor oligonucleotides of NFATmut-IL-2, NFAT-BNP or NFAT-IL-2 (Fig. 7A). In rat atrium, 8 Hz pacing for 30 min induced a 2-fold increase in NFAT nuclear activation (n= 6, P < 0.01, Fig. 7B). Application of 1 µM of CsA did not change the NFAT activation at 1 Hz pacing but totally inhibited the activation induced by pacing at 8 Hz.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 7.  Pacing activates NFAT in rat atrium with a cyclosporin A-dependent manner
A, specific NFAT binding on BNP promoter (NFAT-BNP). Competition analysis for nuclear protein binding was carried out with NFAT-BNP as a radioactively labelled probe and when designated with 100 M excess of unlabelled competitor oligonucleotides of NFATmut-IL-2, NFAT-BNP and NFAT-IL-2. Nuclear extracts from 8 Hz paced atria were used for competition experiments. B, pacing-induced NFAT activation in rat atrium. For binding reaction, 12 µg of a nuclear protein extract from atrial tissue were used. After preincubation (50 min, 1 Hz), atrial pacing was continued at 1 (-) or 8 Hz (+) for 30 min. When indicated, cyclosporin A (CsA, 1 µM) was included in perfusion medium from start of preincubation. Each bar represents mean ±S.E.M. of 6 separate experiments. **P < 0.01.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
This is the first report that establishes a relationship between cardiac Ca2+ signals and calcineurin activation. Our results show that (1) frequency of cardiac Ca2+ transients forms an adequate stimulus for calcineurin activation and corresponding NFAT activation, (2) calcineurin activation regulates Ca2+ release in the myocytes, and (3) calcineurin activation results in a dual effect on the immediate gene expression with both augmentation (BNP) and suppression (c-fos).

Calcineurin activation by pacing

The measurements showed a clear CsA-dependent increase in the nuclear NFAT activity when the frequency of atrial pacing was increased. This is in line with the modelling results that predicted that calcineurin activation depends on the frequency of cardiac Ca2+ transients. Similarly, in skeletal muscle cells NFAT translocation has been shown to be sensitive to the frequency of stimulation and to CsA (Lui et al. 2001; Kubis et al. 2002). Although the NFAT translocation is induced by calcineurin activation, the time courses of these two processes are different. The nuclear import of NFAT requires a minimum stimulation time of 1.5–5 min and is complete after 20–30 min (Liu et al. 2001; Kubis et al. 2002), whereas calcineurin in vitro responds to Ca2+ on a time scale of seconds (Stemmer & Klee, 1994). This was also seen in the present study where the effects of calcineurin inhibition on [Ca2+]i were apparent within seconds after increasing the pacing frequency. In our simulations, the activation of calcineurin was fast enough ({tau}act= 0.7–1.6 s) to respond to a brief rise in [Ca2+]i such as that during the cardiac Ca2+ transient. The kinetics of calcineurin deactivation ({tau}deact~1.5 s) ensures that activity triggered by a single Ca2+ transient decays if the frequency is low enough. Upon an increase of frequency, the deactivation of calcineurin becomes incomplete before the next transient and calcineurin activation increases. The frequency-dependent calcineurin activation appears to be prominent at frequencies corresponding to the normal rat heart rate (~5–8 beats s-1) and thus calcineurin is likely to exhibit a significant level of activity even at rest, with rapid responses to both increase and decreases of heart rate. It is also interesting to note that although pacing produces an increase in the diastolic [Ca2+]i that activates calcineurin effectively, our modelling experiments show that changes in the frequency of Ca2+ transients alone are sufficient to alter calcineurin activity (see Fig. 3B). This supports the idea that calcineurin is part of the normal adaptation mechanism, and as such participates in the maintenance of the normal cardiac phenotype (Eto et al. 2000). Analogously, it has been suggested that in slow type skeletal myocytes, calcineurin maintains the slow phenotype because the continuous activity in these cells upholds the calcineurin activity (Chin et al. 1998).

Suppression of pacing-induced Ca2+ increase by cyclosporin A

In the present study, we found that that all of the effects of CsA on [Ca2+]i were present only with high pacing frequency (see Fig. 4). This indicates that the changes were caused by inhibition of Ca2+-activated calcineurin. In cardiac myocytes, three different calcineurin targets may be involved in Ca2+ regulation. First, the inhibitory regulator of SR Ca2+-ATPase, phospholamban, is inhibited by calcineurin in ventricular myocytes (Münch et al. 2002) and therefore calcineurin inhibition would have a stimulatory effect on the pump. This sort of Ca2+-ATPase stimulation would cause faster Ca2+ transient decay, possibly a reduced diastolic [Ca2+]i and increased SR Ca2+ content resulting in an increased Ca2+ release and subsequently sustained augmentation of Ca2+ transients (Song et al. 2003). This is opposite to what we found to be the effect of CsA during pacing where the endpoint was a significant reduction in Ca2+ transient amplitude. This finding is not surprising since atrial muscle contains much less phospholamban than ventricular muscle (Koss et al. 1995). Second, calcineurin inhibition was recently found to stimulate the L-type calcium current and thereby cause a sustained increase of calcium release in ventricular myocytes (Santana et al. 2002). This mechanism had either a transient or a small effect in our atrial cells where the endpoint was a significant reduction in calcium release. Third, calcineurin may act on the Ca2+ release channels, i.e. the RyRs (Bandyopadhyay et al. 2000) or the IP3 receptors (Cameron et al. 1995). The contribution of IP3 receptors to the normal calcium release is small in rat atrial myocytes (Mackenzie et al. 2002). Calcineurin regulates cardiac ryanodine receptor via FKBP12.6, which de-sensitizes the channel to Ca2+, thereby reducing the Ca2+ leak during diastole (Bandyopadhyay et al. 2000; Marks, 2003). Calcineurin inhibitors make RyRs more sensitive to Ca2+ leading to increased RyR openings at lower levels of Ca2+ manifested as spontaneous Ca2+ release events (McCall et al. 1996; Bandyopadhyay et al. 2000). This type of RyR sensitization leads first to an increase in the Ca2+ release, which in turn leads to a reduction of SR Ca2+ content and Ca2+ release ensuring that the effect is transient (Trafford et al. 2000; Eisner et al. 2000). If this is accompanied by even a small increase in the passive Ca2+ leak like that with ryanodine (Bers et al. 1987) or with CsA (Bandyopadhyay et al. 2000), a sustained decrease of Ca2+ release can be expected. Altogether this is exactly what we found in the present study (see Fig. 4), which supports the idea that RyR-mediated SR Ca2+ release was the main target of CsA.

Effect of calcineurin inhibition on the BNP and c-fos gene expression

Part of the controversy concerning calcineurin signalling in cardiac muscle gene expression and hypertrophy is related to the difficulty in isolating the calcineurin pathway from other hypertrophic pathways. In vivo hypertrophic stimuli consist not only of activation of Ca2+-dependent processes, but also of hormonal, mechanical and neuronal adaptations with corresponding activation of different hypertrophic signalling cascades (for review see Tavi et al. 2001). To study the earliest calcineurin-induced transcriptional events, we measured the effects of altered [Ca2+]i on the expression of the immediate-early genes c-fos and BNP, two rapidly inducible marker genes for load-induced hypertrophy (see, e.g. Tavi et al. 2001). We found that the Ca2+–calcineurin pathway has opposite effects on the expressions of c-fos and BNP. While the BNP expression is part of normal adaptation of heart to increased load (Tavi et al. 2001; Tokola et al. 2001) and a direct target of calcineurin–NFAT-mediated transcription (Molkentin et al. 1998), the c-fos induction is additionally associated with pathological developments such as induction of fetal gene expression by mechanical unloading of the heart (Depre et al. 1998). More importantly, induction of c-fos expression is likely to regulate the impending expression of other genes because it is a part of the heterodimeric transcription factor AP-1. We have shown here that in rat cardiac myocytes, CsA increases the c-fos mRNA levels in a Ca2+-dependent manner. This seems to be a common feature of many cell types since stimulation of c-fos expression by CsA has been demonstrated in T-cell lymphoma cells when exposed to ionomycin (Su et al. 1996) and in murine erythroleukaemia cell line CsA stimulates c-fos expression in a Ca2+-dependent manner in correlation with the inhibition of CaN activity (Schaefer et al. 1998). These phenomena are probably not caused by unspecific actions of CsA since in hippocampal neurones FK506 enhances the c-fos expression after short bouts of electrical stimulation (Bito et al. 1996). These results suggest that the same calcium signal promotes both activation and inhibition of the c-fos expression. To explain a similar phenomenon in hippocampal neurones, Bito et al. (1996) suggested that calcineurin acts indirectly to de-phosphorylate the CaM kinase-phosphorylated cyclic AMP-responsive element binding protein (CREB) transcription factor, thereby suppressing the CREB-induced c-fos expression.

Supporting such a dual role of calcineurin in controlling cardiac gene expression, MCIP1-/- mice have an increased hypertrophic response to constitutively active calcineurin expression but a reduced hypertophic response to pressure overload and to adrenergic stimulation (Vega et al. 2003). If the primary role of calcineurin activation is suppression of some genes, like c-fos, the inhibition of calcineurin would allow these genes to be expressed and would secondarily change the whole pattern of gene expression. This dualism in the calcineurin-dependent immediate-early gene transcription together with the apparent activity of calcineurin, maintained already by moderate heart rates, suggests that calcineurin may orchestrate the transcriptional signals during both normal adaptation and pathological developments. This is not unexpected since the output of calcineurin-dependent transcription has been shown to depend on other accompanying signal cascades (e.g. Rac, Ras or protein kinase C, for review see Crabtree, 2001) also in cardiac myocytes (Bueno et al. 2002; for review see Wilkins & Molkentin, 2002).

Physiological and pathophysiological implications

On the basis of the modelling in the present study it can be predicted that, in addition to the frequency, other factors that modulate the shape or amplitude of cardiac Ca2+ transients and the diastolic [Ca2+]i may have a substantial impact on calcineurin activity. Increased amplitude of the Ca2+ transients, induced by increased SR Ca2+ uptake (for example, by phosphorylation of phospholamban), may actually reduce calcineurin activity by shortening the duration of transients and decreasing the diastolic [Ca2+]i. On the other hand, factors that act to lengthen the Ca2+ transients or augment Ca2+ transients without increasing the rate of Ca2+ removal may elevate calcineurin activity as shown previously with endothelin-1 (Zhu et al. 2000). This mechanism would provide a novel pathway for communication between different hypertrophic pathways.

This study shows that calcineurin influences excitation–contraction coupling in the heart by regulating the Ca2+ release. This extends the spectrum of calcineurin effects in the heart, but also points to the likely consequences of calcineurin inhibition. The vast majority of the reported effects of calcineurin inhibition on the hypertrophy development appear to be due to inhibition of calcineurin-induced transcription activity. Nevertheless, part of the effects can be due to concomitant suppression of cardiac Ca2+ signals, which in turn suppresses many other Ca2+-mediated processes in the myocytes.

The extent to which frequency-dependent calcineurin activation, as described in the present study, contributes to the development of left ventricular hypertrophy and cardiac failure cannot be precisely estimated. However, given that the increased sympathetic outflow with associated tachycardia constitutes one of the major risk factors of chronic heart failure mortality (Poole-Wilson et al. 2003) and calcineurin activity has been reported to increase in patients with cardiac hypertrophy and failure (Haq et al. 2001; Ritter et al. 2002), the drugs that reduce the activation of the sympathetic nervous system like ß-receptor blockers may be effective in control of cardiac growth and remodelling (Packer et al. 1996).


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Antoons G, Mubagwa K, Nevelsteen I & Sipido KR (2002). Mechanisms underlying the frequency dependence of contraction and [Ca2+]i transients in mouse ventricular myocytes. J Physiol 543, 889–898.[Abstract/Free Full Text]

Bandyopadhyay A, Shin DW, Ahn JO & Kim DH (2000). Calcineurin regulates ryanodine receptor/Ca2+-release channels in rat heart. Biochem J 352, 61–70.[CrossRef][Medline]

Bassani JW, Bassani RA & Bers DM (1995). Calibration of indo-1 and resting intracellular [Ca]i in intact rabbit cardiac myocytes. Biophys J 68, 1453–1460.[Abstract/Free Full Text]

Bers DM, Bridge JH & MacLeod KT (1987). The mechanism of ryanodine action in rabbit ventricular muscle evaluated with Ca-selective microelectrodes and rapid cooling contractures. Can J Physiol Pharmacol 65, 610–618.[Medline]

Bhalla US & Iyengar R (1999). Emergent properties of networks of biological signaling pathways. Science 283, 381–387.[Abstract/Free Full Text]

Bito H, Deisseroth K & Tsien RW (1996). CREB phosphorylation and dephosphorylation. a Ca2+- and stimulus duration-dependent switch for hippocampal gene expression. Cell 87, 1203–1214.[CrossRef][Medline]

Brandes R & Bers DM (2002). Simultaneous measurements of mitochondrial NADH and Ca2+ during increased work in intact rat heart trabeculae. Biophys J 83, 587–604.[Abstract/Free Full Text]

Bueno OF, Wilkins BJ, Tymitz KM, Glascock BJ, Kimball TF, Lorenz JN & Molkentin JD (2002). Impaired cardiac hypertrophic response in calcineurin Aß-deficient mice. Proc Natl Acad Sci USA 99, 4586–4591.[Abstract/Free Full Text]

Cameron AM, Steiner JP, Roskams AJ, Ali SM, Ronnett GV & Snyder SH (1995). Calcineurin associated with the inositol 1,4,5-trisphosphate receptor-FKBP12 complex modulates Ca2+ flux. Cell 83, 463–472.[CrossRef][Medline]

Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C, Shelton JM, Wu H, Zhu W, Bassel-Duby R & Williams RS (1998). A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev 12, 2499–2509.[Abstract/Free Full Text]

Chudin E, Goldhaber J, Garfinkel A, Weiss J & Kogan B (1999). Intracellular Ca2+ dynamics and the stability of ventricular tachycardia. Biophys J 77, 2930–2941.[Abstract/Free Full Text]

Crabtree GR (1999). Generic signals and specific outcomes: signaling through Ca2+, calcineurin, and NF-AT. Cell 96, 611–614.[CrossRef][Medline]

Crabtree GR. (2001). Ca2+, calcineurin, and the control of transcription. J Biol Chem 276, 2313–2316.[Free Full Text]

Depre C, Shipley GL, Chen W, Han Q, Doenst T, Moore ML, Stepkowski S, Davies PJ & Taegtmeyer H (1998). Unloaded heart in vivo replicates fetal gene expression of cardiac hypertrophy. Nat Med 4, 1269–1275.[CrossRef][Medline]

Ding B, Price RL, Borg TK, Weinberg EO, Halloran PF & Lorell BH (1999). Pressure overload induces severe hypertrophy in mice treated with cyclosporine, an inhibitor of calcineurin. Circ Res 84, 729–734.[Abstract/Free Full Text]

Dormand JR & Prince PJ (1980). A family of embedded Runge-Kutta formulae. J Comp Appl Math 6, 19–26.[CrossRef]

Eisner DA, Choi HS, Diaz ME, O'Neill SC & Trafford AW (2000). Integrative analysis of Ca2+ cycling in cardiac muscle. Circ Res 87, 1087–1094.[Abstract/Free Full Text]

Eto Y, Yonekura K, Sonoda M, Arai N, Sata M, Sugiura S, Takenaka K, Gualberto A, Hixon ML, Wagner MW & Aoyagi T (2000). Calcineurin is activated in rat hearts with physiological left ventricular hypertrophy induced by voluntary exercise training. Circulation 101, 2134–2137.[Abstract/Free Full Text]

Fatkin D, McConnell BK, Mudd JO, Semsarian C, Moskowitz IG, Schoen FJ, Giewat M, Seidman CE & Seidman JG (2000). An abnormal Ca2+ response in mutant sarcomere protein-mediated familial hypertrophic cardiomyopathy. J Clin Invest 106, 1351–1359.[Medline]

Field ML, Azzawi A, Styles P, Henderson C, Seymour AM & Radda GK (1994). Intracellular Ca2+ transients in isolated perfused rat heart: measurement using the fluorescent indicator Fura-2/AM. Cell Calcium 16, 87–100.[CrossRef][Medline]

Frey N & Olson EN (2003). Cardiac hypertrophy: The good, the bad, and the ugly. Ann Rev Physiol 65, 45–79.[CrossRef][Medline]

Haq S, Choukroun G, Lim H, Tymitz KM, del Monte F, Gwathmey J, Grazette L, Michael A, Hajjar R, Force T & Molkentin JD (2001). Differential activation of signal transduction pathways in human hearts with hypertrophy versus advanced heart failure. Circulation 103, 670–677.[Abstract/Free Full Text]

Hautala N, Tokola H, Luodonpaa M, Puhakka J, Romppanen H, Vuolteenaho O & Ruskoaho H (2001). Pressure overload increases GATA4 binding activity via endothelin-1. Circulation 103, 730–735.[Abstract/Free Full Text]

Janssen PM, Zeitz O, Keweloh B, Siegel U, Maier LS, Barckhausen P, Pieske B, Prestle J, Lehnart SE & Hasenfuss G (2000). Influence of cyclosporine A on contractile function, Ca2+ handling, and energetics in isolated human and rabbit myocardium. Cardiovasc Res 47, 99–107.[Abstract/Free Full Text]

Knollmann BC, Kirchhof P, Sirenko SG, Degen H, Greene AE, Schober T, Mackow JC, Fabritz L, Potter JD & Morad M (2003). Familial hypertrophic cardiomyopathy-linked mutant troponin T causes stress-induced ventricular tachycardia and Ca2+-dependent action potential remodeling. Circ Res 92, 428–436.[Abstract/Free Full Text]

Koss KL, Ponniah S, Jones WK, Grupp IL & Kranias EG (1995). Differential phospholamban gene expression in murine cardiac compartments. Molecular and physiological analyses. Circ Res 77, 342–353.[Abstract/Free Full Text]

Kubis HP, Hanke N, Scheibe RJ, Meissner JD & Gros G (2003). Ca2+ transients activate calcineurin/NFATc1 and initiate fast-to-slow transformation in a primary skeletal muscle culture. Am J Physiol 285, C56–63.

Kubis HP, Scheibe RJ, Meissner JD, Hornung G & Gros G (2002). Fast-to-slow transformation and nuclear import/export kinetics of the transcription factor NFATc1 during electrostimulation of rabbit muscle cells in culture. J Physiol 541, 835–847.[Abstract/Free Full Text]

Layland J & Kentish JC (1999). Positive force- and [Ca2+]i-frequency relationships in rat ventricular trabeculae at physiological frequencies. Am J Physiol 276, H9–18.[Medline]

Liu Y, Cseresnyes Z, Randall WR & Schneider MF (2001). Activity-dependent nuclear translocation and intranuclear distribution of NFATc in adult skeletal muscle fibers. J Cell Biol 155, 27–39.[Abstract/Free Full Text]

McCall E, Li L, Satoh H, Shannon TR, Blatter LA & Bers DM (1996). Effects of FK-506 on contraction and Ca2+ transients in rat cardiac myocytes. Circ Res 79, 1110–1121.[Abstract/Free Full Text]

Macian F, Garcia-Rodriguez C & Rao A (2000). Gene expression elicited by NFAT in the presence or absence of cooperative recruitment of Fos and Jun. EMBO J 19, 4783–4795.[CrossRef][Medline]

Mackenzie L, Bootman MD, Laine M, Berridge MJ, Thuring J, Holmes A, Li WH & Lipp P (2002). The role of inositol 1,4,5-trisphosphate receptors in Ca2+ signalling and the generation of arrhythmias in rat atrial myocytes. J Physiol 541, 395–409.[Abstract/Free Full Text]

Majalahti-Palviainen T, Hirvinen M, Tervonen V, Ilves M, Ruskoaho H & Vuolteenaho O (2000). Gene structure of a new cardiac peptide hormone: a model for heart-specific gene expression. Endocrinology 141, 731–740.[Abstract/Free Full Text]

Marks AR (2003). A guide for the perplexed: towards an understanding of the molecular basis of heart failure. Circulation 107, 1456–1459.[Free Full Text]

Molkentin JD (2000). Calcineurin and beyond: cardiac hypertrophic signaling. Circ Res 87, 731–738.[Abstract/Free Full Text]

Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR & Olson EN (1998). A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93, 215–228.[CrossRef][Medline]

Münch G, Bolck B, Karczewski P & Schwinger RH (2002). Evidence for calcineurin-mediated regulation of SERCA 2a activity in human myocardium. J Mol Cell Cardiol 34, 321–334.[CrossRef][Medline]

Northrop JP, Ho SN, Chen L, Thomas DJ, Timmerman LA, Nolan GP, Admon A & Crabtree GR (1994). NF-AT components define a family of transcription factors targeted in T-cell activation. Nature 369, 497–502.[CrossRef][Medline]

Packer M, Bristow MR, Cohn JN, Colucci WS, Fowler MB, Gilbert EM & Shusterman NH (1996). The effect of carvedilol on morbidity and mortality in patients with chronic heart failure. US Carvedilol Heart Failure Study Group. N Engl J Med 334, 1349–1355.[Abstract/Free Full Text]

Poole-Wilson PA, Uretsky BF, Thygesen K, Cleland JG, Massie BM & Ryden L (2003). Mode of death in heart failure: findings from the ATLAS trial. Heart 89, 42–48.[Abstract/Free Full Text]

Rao A, Luo C & Hogan PG (1997). Transcription factors of the NFAT family: regulation and function. Ann Rev Immunol 15, 707–747.[CrossRef][Medline]

Ritter O, Hack S, Schuh K, Rothlein N, Perrot A, Osterziel KJ, Schulte HD & Neyses L (2002). Calcineurin in human heart hypertrophy. Circulation 105, 2265–2269.[Abstract/Free Full Text]

Rothermel BA, McKinsey TA, Vega RB, Nicol RL, Mammen P, Yang J, Antos CL, Shelton JM, Bassel-Duby R, Olson EN & Williams RS (2001). Myocyte-enriched calcineurin-interacting protein, MCIP1, inhibits cardiac hypertrophy in vivo. Proc Natl Acad Sci USA 98, 3328–3333.[Abstract/Free Full Text]

Rusnak F & Mertz P (2000). Calcineurin: form and function. Physiol Rev 80, 1483–1521.[Abstract/Free Full Text]

Santana LF, Chase EG, Votaw VS, Nelson MT & Greven R (2002). Functional coupling of calcineurin and protein kinase A in mouse ventricular myocytes. J Physiol 544, 57–69.[Abstract/Free Full Text]

Schaefer A, Magocsi M, Fandrich A & Marquardt H (1998). Stimulation of the Ca2+-mediated egr-1 and c-fos expression in murine erythroleukaemia cells by cyclosporin A. Biochem J 335, 505–511.[Medline]

Shannon TR, Ginsburg KS & Bers DM (2000). Reverse mode of the sarcoplasmic reticulum calcium pump and load-dependent cytosolic calcium decline in voltage-clamped cardiac ventricular myocytes. Biophys J 78, 322–333.[Abstract/Free Full Text]

Shimoyama M, Hayashi D, Takimoto E, Zou Y, Oka T, Uozumi H, Kudoh S, Shibasaki F, Yazaki Y, Nagai R & Komuro I (1999). Calcineurin plays a critical role in pressure overload-induced cardiac hypertrophy. Circulation 100, 2449–2454.[Abstract/Free Full Text]

Song Q, Schmidt AG, Hahn HS, Carr AN, Frank B, Pater L, Gerst M, Young K, Hoit BD, McConnell BK, Haghighi K, Seidman CE, Seidman JG & Dorn GW II & Kranias EG (2003). Rescue of cardiomyocyte dysfunction by phospholamban ablation does not prevent ventricular failure in genetic hypertrophy. J Clin Invest 111, 859–867.[CrossRef][Medline]

Stemmer PM & Klee CB (1994). Dual Ca2+ ion regulation of calcineurin by calmodulin and calcineurin B. Biochemistry 33, 6859–6866.[CrossRef][Medline]

Su Q, Eugster HP, Ryffel B & Dumont FJ (1996). Cyclosporin A enhances the Ca2+-dependent induction of AP-1 complex and c-fos mRNA in a T cell lymphoma. Biochem Biophys Res Commun 229, 249–256.[CrossRef][Medline]

Tavi P, Han C & Weckström M (1998). Mechanisms of stretch-induced changes in [Ca2+]i in rat atrial myocytes: role of increased troponin C affinity and stretch-activated ion channels. Circ Res 83, 1165–1177.[Abstract/Free Full Text]

Tavi P, Han C & Weckström M (1999). Intracellular acidosis modulates the stretch-induced changes in E-C coupling of the rat atrium. Acta Physiol Scand 167, 203–213.[CrossRef][Medline]

Tavi P, Laine M, Weckström M & Ruskoaho H (2001). Cardiac mechanotransduction: from sensing to disease and treatment. Trends Pharmacol Sci 22, 254–260.[CrossRef][Medline]

Timmerman LA, Clipstone NA, Ho SN, Northrop JP & Crabtree GR (1996). Rapid shuttling of NF-AT in discrimination of Ca2+ signals and immunosuppression. Nature 383, 837–840.[CrossRef][Medline]

Tokola H, Hautala N, Marttila M, Magga J, Pikkarainen S, Kerkelä R, Vuolteenaho O & Ruskoaho H (2001). Mechanical load-induced alterations in B-type natriuretic peptide gene expression. Can J Physiol Pharmacol 79, 646–653.[CrossRef][Medline]

Trafford AW, Diaz ME, Sibbring GC & Eisner DA. (2000). Modulation of CICR has no maintained effect on systolic Ca2+: simultaneous measurements of sarcoplasmic reticulum and sarcolemmal Ca2+ fluxes in rat ventricular myocytes. J Physiol 522, 259–270.[Abstract/Free Full Text]

Vega RB, Rothermel BA, Weinheimer CJ, Kovacs A, Naseem RH, Bassel-Duby R, Williams RS & Olson EN (2003). Dual roles of modulatory calcineurin-interacting protein 1 in cardiac hypertrophy. Proc Natl Acad Sci USA 100, 669–674.[Abstract/Free Full Text]

Wang YG, Benedict WJ, Huser J, Samarel AM, Blatter LA & Lipsius SL (2001). Brief rapid pacing depresses contractile function via Ca2+/PKC-dependent signaling in cat ventricular myocytes. Am J Physiol 280, H90–98.

Wilkins BJ & Molkentin JD (2002). Calcineurin and cardiac hypertrophy: where have we been? Where are we going?J Physiol 541, 1–8.[Abstract/Free Full Text]

Wu H, Naya FJ, McKinsey TA, Mercer B, Shelton JM, Chin ER, Simard AR, Michel RN, Bassel-Duby R, Olson EN & Williams RS (2000). MEF2 responds to multiple Ca2+-regulated signals in the control of skeletal muscle fiber type. EMBO J 19, 1963–1973.[CrossRef][Medline]

Zhu W, Zou Y, Shiojima I, Kudoh S, Aikawa R, Hayashi D, Mizukami M, Toko H, Shibasaki F, Yazaki Y, Nagai R & Komuro I (2000). Ca2+/calmodulin-dependent kinase II and calcineurin play critical roles in endothelin-1-induced cardiomyocyte hypertrophy. J Biol Chem 275, 15239–15245.[Abstract/Free Full Text]

Zou Y, Hiroi Y, Uozumi H, Takimoto E, Toko H, Zhu W, Kudoh S, Mizukami M, Shimoyama M, Shibasaki F, Nagai R, Yazaki Y & Komuro I (2000). Calcineurin plays a critical role in the development of pressure overload-induced cardiac hypertrophy. Circulation 104, 97–101.


    Acknowledgements
 
This study was supported by Jenny and Antti Wihuri foundation (P.T.), Finnish Foundation of Cardiovascular Research (P.T., M.W., S.P., H.R.), Emil Aaltonen Foundation (P.T.), Sigrid Juselius Foundation (O.V., P.T.), Aarne Koskelo Foundation (P.T., S.P.), Ida Montin Foundation (S.P.), Finnish Cultural Foundation (S.P.), Academy of Finland (H.R.), funds at Karolinska Institutet (P.T., H.W.) and Swedish Research Council (P.T., H.W., project 10842).




This article has been cited by other articles:


Home page
Sci SignalHome page
S. R. Houser and J. D. Molkentin
Does Contractile Ca2+ Control Calcineurin-NFAT Signaling and Pathological Hypertrophy in Cardiac Myocytes?
Sci. Signal., June 24, 2008; 1(25): pe31 - pe31.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Colella, F. Grisan, V. Robert, J. D. Turner, A. P. Thomas, and T. Pozzan
Ca2+ oscillation frequency decoding in cardiac cell hypertrophy: Role of calcineurin/NFAT as Ca2+ signal integrators
PNAS, February 26, 2008; 105(8): 2859 - 2864.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. M. MacDonnell, H. Kubo, D. M. Harris, X. Chen, R. Berretta, M. F. Barbe, S. Kolwicz, P. O. Reger, A. Eckhart, B. F. Renna, et al.
Calcineurin inhibition normalizes beta-adrenergic responsiveness in the spontaneously hypertensive rat
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3122 - H3129.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. J. Ronkainen, O. Vuolteenaho, and P. Tavi
Calcium-Calmodulin Kinase II Is the Common Factor in Calcium-Dependent Cardiac Expression and Secretion of A- and B-Type Natriuretic Peptides
Endocrinology, June 1, 2007; 148(6): 2815 - 2820.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
T. Shen, Z. Cseresnyes, Y. Liu, W. R. Randall, and M. F. Schneider
Regulation of the nuclear export of the transcription factor NFATc1 by protein kinases after slow fibre type electrical stimulation of adult mouse skeletal muscle fi