J Physiol Wellcome Trust-funded researchers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 555, Number 1, 15-26, February 15, 2004 DOI: 10.1113/jphysiol.2003.052514
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
555/1/15    most recent
jphysiol.2003.052514v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cummings, K. J.
Right arrow Articles by Wilson, R. J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cummings, K. J.
Right arrow Articles by Wilson, R. J. A.

Sudden neonatal death in PACAP-deficient mice is associated with reduced respiratory chemoresponse and susceptibility to apnoea

Kevin J. Cummings1, Jonathan D. Pendlebury1, Nancy M. Sherwood2 and Richard J. A. Wilson1

1 Department of Physiology and Biophysics, University of Calgary, Calgary AB, Canada2 Department of Biology, University of Victoria, Victoria BC, Canada


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Pituitary adenylate cyclase-activating polypeptide (PACAP)-deficient mice are more prone to sudden death during postnatal weeks 1–3 than wild-type littermates. Given that PACAP is localized in brainstem regions associated with respiratory chemosensitivity, we examined whether PACAP-null neonates have reduced respiratory responses to hypoxia and hypercapnia. Using unrestrained, whole-body, flow-through plethysmography we found that, by postnatal day 4, the PACAP-null neonates had significantly reduced ventilation during baseline breathing, and blunted responses to both hypoxia (10% O2–90% N2) and hypercapnia (8% CO2–92% air). To determine whether the respiratory phenotype of the PACAP-null mice may contribute to their greater neonatal mortality, we used ECG to examine respiration and cardiovascular function of littermates. We demonstrate that, under conditions that exacerbate mortality of knockout but not wild-type animals, PACAP-deficient mice experience prolonged apnoeas that precede atrio-ventricular block. Both apnoeas and atrio-ventricular block were absent in wild-type littermates. These data suggest that PACAP-deficiency results in higher neonatal mortality primarily as a result of respiratory control defects and raise the possibility that mutations in genes encoding components of the PACAP signalling pathways may contribute to neonatal breathing disorders in humans.

(Received 5 August 2003; accepted after revision 3 November 2003; first published online 7 November 2003)
Corresponding author R. J. A. Wilson: Respiratory Research Group, Department of Physiology and Biophysics, University of Calgary, 3330 Hospital Dr NW, Calgary, Alberta T2N 4N1, Canada. Email: wilsonr{at}ucalgary.ca


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
PACAP, the most highly conserved member of the secretin/glucagon/vasoactive intestinal peptide (VIP) superfamily, has garnered considerable attention recently, owing to its potent effects on a diverse range of physiological functions (Sherwood et al. 2000). Several groups have documented that PACAP-deficient mice, though normal in appearance at birth, have a higher susceptibility to sudden death during the neonatal period (Gray et al. 2002), with fewer PACAP knockout mice surviving to weaning compared to wild-type littermates (Hashimoto et al. 2001; Gray et al. 2002; Hamelink et al. 2002). Higher mortality of PACAP-receptor deficient mice has also been reported (Jamen et al. 2000; Otto et al. 2001). The reason why PACAP signalling increases the chance of surviving the neonatal period is unknown. However, one study demonstrated that the increased mortality of PACAP-null mice was exacerbated by reduced ambient temperature, suggesting that PACAP may be involved in the physiological response to environmental stress (Gray et al. 2002). This increased susceptibility to sudden death, resulting from an interaction of environmental stress with PACAP deficiency, suggests that mutations in genes encoding components of the PACAP signalling pathway(s) could be contributing factors in disorders that lead to infant mortality in humans, such as Sudden Infant Death Syndrome (SIDS).

Several lines of evidence suggest that PACAP may be involved in respiratory control. Firstly, intravenous injection of PACAP in dogs is reported to cause an increase in ventilation that is abolished by transecting the carotid sinus nerves innervating the peripheral respiratory chemoreceptors (Runcie et al. 1995). Secondly, PACAP is located widely within the rat brain, including several areas containing neurones implicated in respiratory rhythm generation and/or respiratory chemosensitivity: the ventrolateral medulla, the ventral medullary surface, the raphe nucleus pallidus and the nucleus tractus solitarius (Hannibal, 2002). Thirdly, PACAP binds with high affinity to three distinct G-protein coupled receptors (PAC1, VPAC1 and VPAC2) that can activate adenylate cyclase leading to the production of cAMP and PKA activation (Vaudry et al. 2000). PKA and cAMP are potent modulators of both phrenic motor neurones and putative rhythm generating neurones in the ventral lateral medulla (Lalley et al. 1997; Arata et al. 1993; Bocchiaro et al. 2003; Shao et al. 2003).

In light of these data, we hypothesized that the higher neonatal mortality in PACAP-null mice was principally the result of defective respiratory control. To test this hypothesis, we evaluated ventilation in PACAP+/+, +/- and -/- littermates at an early stage of postnatal development (postnatal day 4 (P4)) using continuous-flow, unrestrained, whole-body plethysmography. We also determined whether genotype influenced ventilatory responses to hypoxia and hypercapnia. We found that PACAP deficiency leads to a significant reduction in ventilation and blunted responses to both hypoxia and hypercapnia. To determine whether this respiratory abnormality could lead to death, we studied the effects of PACAP deletion on respiration and cardiovascular function during the sensitive period of postnatal development (P7-P14) using electrocardiography (ECG). Under conditions that exacerbate the chance of sudden death of PACAP-null mice (isoflurane-induced hypothermia), we found that prolonged apnoea preceded atrio-ventricular block. These data are consistent with an important role for PACAP in respiratory control.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Experimental procedures were approved by the University of Calgary Animal Care Committee and were in accordance with national guidelines.

Animals

Mice were housed at 24–26°C with a 12 h light–dark cycle and were given food and water ad libitum. PACAP+/+, +/- and -/- mice were bred from PACAP +/- mice, kept on a 129SvJ~C57BL/6 hybrid background. This PACAP deficient mouse line was generated by Gray et al. (2001). Mixed breeding strains were used as (a) they produce larger offspring with larger tidal volumes than pure strains, which facilitates measurement of respiratory parameters, and (b) previous reports indicate that this line has a similar phenotype to a C57BL/6 back-crossed line, suggesting that strain has little influence on the increased neonatal mortality in PACAP-deficient mice (Gray et al. 2001). To limit genetic variability, comparisons between littermates were used in all experiments.

Whole-body plethysmography

Respiration was assessed in non-anaesthetized PACAP+/+, +/- and -/- P4 pups using continuous-flow, unrestrained, whole-body plethysmography. In order to have the exquisite sensitivity required to record breaths of <0.05 ml (based on an adult 20 g mouse with tidal volume (VT) of 0.15 ml; Guyton, 1947; Mortola, 1984), we modified a commercial system designed for studies of larger rodents (Buxco Electronics Inc., Sharon, CT, USA). The apparatus consisted of two 20 ml chambers: one to house the animal and the other to act as a reference. A low dead space differential pressure transducer was used to monitor the pressures in the chambers, removing the contribution of environmental pressure fluctuations and thereby isolating pressure changes in the box related to breathing. This differential pressure signal was amplified, digitized and stored on a computer. The animal chamber incorporated gas inlet and outlet ports. Fresh gas was fed to the chamber by a pump. Exhaust gas was passed through CO2 and O2 gas analysers. Continuous flow of gas through the chamber, which was sufficient to exchange the gas in the chamber within a minute, was held constant by a pair of precision gas flow controllers. The animal chamber also contained humidity and temperature probes that were monitored continuously (Omega Engineering, Stamford, CA, USA). A heat lamp was used to hold the ambient temperature in the chamber within the thermoneutral range (33 ± 0.5°C), thus protecting against hypothermia in mice pups that have limited thermogenic capacity and normally rely on behavioural approaches for thermoregulation (Mortola, 2001).

Pups were subjected to either hypoxia (10% O2–90% N2) or hypercapnia (8% CO2–92% air) using the following protocol: 15 min calm-down period, 5 min baseline (room air) period, 5 min hypoxia or hypercapnia treatment, and 15 min washout (room air) period. Data from minutes 3–5 of baseline, minutes 2–3 and 4–5 of treatment and minutes 2–3 and 14–15 of washout were analysed. Analysis was performed offline using semiautomated analysis software written in VEE (by R.J.A.W.) (Agilent Technologies, Palo Alto, CA, USA). The software imported the raw pressure signals exported from the data acquisition system and identified and quantified the properties of breaths in the predefined sections of data. Breathing parameters studied were rate (breaths min-1), inspiratory time (TI), expiratory time (TE) and standard deviation of the period (period variability, V). Given that we used flow-through plethysmography, essentially a leaky box, the pressure signal we record is proportional to volume changes, i.e. flow (e.g. Mortola & Lanthier, 1996). Therefore, we integrated the area under the inspiratory pressure curve to obtain an index (see below) of VT.

We did not attempt to measure absolute tidal volume. Previous quantitative analysis of tidal volume has been based on the principle that air entering the lungs is heated and humidified, thereby increasing the pressure within the chamber as a whole (Drorbaugh & Fenn, 1955). In pilot experiments, we found that the breathing-related pressure changes recorded in our chamber were unaffected by increased humidity (from ~20 to 95%) and temperature (from 33 to 36°C). Therefore, the breathing-related pressure changes we observed are more likely to result from the compression and rarefaction of external gases, occurring as a consequence of airway resistance, during inspiration and expiration, respectively (Enhorning et al. 1998; Mortola & Frappell, 1998). Consequently, our measurements provide an index of tidal volume that will be influenced by changes in airway resistance.

Experiments and analysis of breathing were completed before genotyping animals, ensuring both were performed blind. Statistical analysis of data was performed using two-factor, repeated-measures ANOVA to assess the effects of genotype, treatment (hypoxia or hypercapnia), and the interaction between genotype and treatment on breathing parameters. To determine the effect of genotype on baseline breathing (i.e. when animals were breathing air), baseline data from the two treatment groups were pooled. A one-way, between-subject ANOVA was used for statistical analysis. A one-way, between-subject ANOVA was also used to compare body weights of the three genotypes.

ECG

Surface electrocardiography (ECG) tracings were recorded from postnatal days 7–14 PACAP+/+ and PACAP-/- littermates. P7–14 neonates were used for this part of the study because: (a) the size of these animals is more convenient for instrumentation, and (b) this is the period of increased mortality of PACAP -/- mice and we were interested specifically in the cause of death. Animals were genotyped before experiments and PACAP-/- and +/+ littermates were paired, with pairs being exposed to identical experimental conditions.

Pups were briefly anaesthetized with 2 or 3% isoflurane under a heat lamp to prevent anaesthesia-induced hypothermia. A rectal temperature probe was inserted. The fractional concentration of isoflurane was then reduced to 1.5 or 2%. During the remainder of the experiment (see below), the heat lamp was regulated using a feedback circuit to clamp rectal temperature (Tb) at either a normothermic or a hypothermic level (30°C). We chose this level of hypothermia because: (a) the body temperature of neonatal mice depends largely on environmental temperatures (Alexander, 1975; Mortola, 2001), and (b) a previous study demonstrated that a reduction in ambient temperature of 3°C was sufficient to increase the mortality of PACAP-null mice, without increasing the mortality of wild-type animals (Gray et al. 2002).

ECG was performed by placing paws into three small plastic cylinders (one paw per cylinder) backfilled with conducting gel and containing silver/silver-chloride needle electrodes (EW-Wright, Guilford, CT, USA). ECGs were recorded using a custom-designed amplifier (bandwidth: 0.1 Hz–1 kHz). Data were digitized, analysed and stored using a data acquisition board (National Instruments, Austin TX, USA serial PCI-M10-16XE-10) and custom software written in LabView 5.1 (National Instruments) by Dr Anders Nygren. Breathing produced distinct bursts of ‘noise’ on ECG recordings caused by the movement of the animal's chest cavity.

Given that PACAP-/- mortality increases with reduced ambient temperature, a protocol was designed to assess the consequence of PACAP deficiency on heart function and breathing during anaesthesia-induced hypothermia. Initially, ECG recordings were made during 10 min of normothermia (1.5 or 2% isoflurane). The isoflurane concentration was then increased to 3% and the body temperature allowed to drop to 30°C. Once the rectal temperature was at 30°C, ECG recordings were continued for an additional 10 min. For analysis of breathing, breaths were counted over minute 6 of normothermia and hypothermia. Data were normalized (reciprocal transform) before a two-way ANOVA. For analysis of heart rate (beats·min-1), R-waves were counted over the same time intervals used to analyse breathing.

Ten PACAP+/+ and 10 PACAP-/- littermates were subjected to experimentation. However, 3/10 PACAP-/- animals died upon application of anaesthetic and no recording was obtained. In addition, another PACAP-/- animal had no recordable breathing during minute 6 of hypothermia. Therefore, data from these pups and their PACAP+/+ littermates were excluded from analysis, leaving data from six pairs of animals. Data was analysed for significant differences using two-way repeated-measures ANOVA.

Genotyping

PACAP genotype was determined using PCR with primers directed against signal peptide DNA (5'atgtgtagcggagcaaggctgg 3'), the PACAP-encoding region (5'cactcggacggcatcttcacagatag3') and the 3' untranslated region (5'gaacacgagtgatgactggtcagtc-3'). Using these three primers, it was possible to detect PACAP+/+, +/- and -/- animals with one reaction, as the PACAP-/- mice were lacking the PACAP-encoding region, but not the other two regions. The parameters were: 94°C (30 s), 64°C (30 s), 72°C (45 s) for 38 cycles with 1 µl of genomic DNA isolated from proteinase K-digested ear notches. PCR products were analysed in ethidium-bromide stained 1.5% agarose gels.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Whole-body, continuous-flow plethysmography

PACAP+/+, +/- or -/- P4 pups were identical in appearance and there was no significant difference in body weight between genotypes (one-way ANOVA: P = 0.20). Although there was a slightly smaller proportion of PACAP-/- littermates than would be predicted from Mendelian genetics (Table 1), this difference was not significant ({chi}2; P = 0.423). This suggests that P4 is before the period in which a PACAP-/- genotype leads to increased neonatal mortality. To study breathing at this age, we used whole-body, continuous-flow plethysmography in two groups of unanaesthetized, unrestrained animals. One group was subject to a protocol that involved a 5 min exposure to hypercapnia (n= 47); the other group was subject to an identical protocol but exposed to hypoxia (n= 34).


View this table:
[in this window]
[in a new window]
 
Table 1.  Genotype of animals used in whole-body, continuous-flow plethysmography
 
Effects of genotype on baseline respiration

Baseline data from both treatment groups were pooled to determine whether genotype influenced respiration when animals breathed room air (Fig. 1). Unrestrained, non-anaesthetized wild-type P4 mice had an average breathing rate of 183 breaths min-1 while breathing air, within the range reported previously (Bissonnette & Knopp, 2001; Kazemian et al. 2001; Ptak et al. 2002). Genotype did not affect timing variables (TI, P = 0.21; TE, P = 0.24; rate, P = 0.19; and variability of the period, P = 0.41). However, the PACAP-/- mice had a smaller index of tidal volume (P < 0.01) than wild-type littermates resulting in a ~25% reduction in minute ventilation (P < 0.01).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 1.  Effects of PACAP genotype on baseline breathing of unrestrained, unanaesthetized P4 mice
A, inspiratory time (TI). B, expiratory time (TE). C, breathing rate (breaths·min-1). D, period variability (S.D. Period). E, index of tidal volume (VT). F, index of minute ventilation (VE). Data from P4 wild-type (PACAP+/+; n= 20), heterozygous (PACAP+/-; n= 44) and knockout (PACAP-/-; n= 17) littermates, pooled from hypoxic and hypercapnic experimental groups while animals were breathing air and prior to chemo-challenge. In each animal, mean values were obtained for a 2 min window. Error bars in this and subsequent figures are S.E.M. Asterisk (*) indicates a significant difference (P < 0.05) compared to wild-type.

 
Respiratory response to hypoxia and the effect of genotype

Overall hypoxia (10% O2, balanced air) produced a marked reduction in TE(P < 0.001) (Fig. 2B), and a small but significant reduction in TI(P < 0.05) (Fig. 2A). Respiratory rate was increased and period variability was markedly reduced (P < 0.001 for each) (Fig. 2C and D). Hypoxia increased both VT(P < 0.01) and VE(P < 0.001) (Fig. 2E and F). Our results confirm the lack of ventilatory hypoxic depression in neonatal mice within the first days of birth and the presence of posthypoxic decline, which has been reported in P7 mice (Robinson et al. 2000; Bissonnette & Knopp, 2001).



View larger version (44K):
[in this window]
[in a new window]
 
Figure 2.  Effects of PACAP genotype on response to hypoxia
A, inspiratory time (TI). B, expiratory time (TE). C, breathing rate (breaths·min-1). D, period variability (S.D. Period). E, index of tidal volume (VT). F, index of minute ventilation (VE). Data from 2 min treatment windows are labelled as Baseline (immediately prior to challenge), Early Response (1 min after beginning of challenge), Late Response (3 min after beginning of challenge), Wash1 (1 min following return to air) and Wash2 (13 min following return to air). Hypoxic challenge: 10% O2–90% N2. T, G, and GT indicate statistically significant effects of treatments, genotypes, and interaction between treatment and genotype, respectively.

 
Genotype had significant influences on hypoxia-mediated changes in both TI(P = 0.028) and rate (P < 0.001): the PACAP-/- neonates having blunted responses in comparison to PACAP+/+ littermates.

However, genotype did not affect either the hypoxia-mediated reduction in TE(P = 0.33) or the hypoxia-mediated increase in VT(P = 0.54). Despite the significant influence of genotype on the hypoxia-mediated changes in rate, genotype had no effect on the overall ventilatory response to hypoxia (i.e. VE, P = 0.57). The most likely explanation for this is that the influence of genotype on hypoxia-mediated changes in rate is not of sufficient magnitude to overcome the variability in the influence of genotype on hypoxia-mediated changes in VT. In summary, there is a genotype effect on overall ventilation but genotype does not change the response of VE to hypoxia.

Respiratory response to hypercapnia and the effect of genotype

Hypercapnia (8% CO2, balanced air) had no significant effect on TI(P = 0.45) but caused significant reductions in TE (P < 0.001; Fig. 3A and B). Rate was significantly increased by hypercapnia (P < 0.001) and there was a significant reduction in period variability (P < 0.001) (Fig. 3C and D). VT was also increased (P < 0.001) (Fig. 3E). Concomitantly, hypercapnia caused a significant increase in minute ventilation (VE, P < 0.001) (Fig. 3F).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 3.  Effects of PACAP genotype on response to hypercapnia
A, inspiratory time (TI). B, expiratory time (TE). C, breathing rate (breaths min-1). D, period variability (S.D. Period). E, index of tidal volume (VT). F, index of minute ventilation (VE). Data from 2 min treatment windows are labelled as Baseline (immediately prior to challenge), Early Response (1 min after beginning of challenge), Late Response (3 min after beginning of challenge), Wash1 (1 min following return to air) and Wash2 (13 min following return to air). Hypercapnic challenge: 8% O2–92% air. T, G, and GT indicate statistically significant effects of treatments, genotypes, and interaction between treatment and genotype, respectively.

 
Genotype did not have a significant effect on the hypercapnia-mediated responses of rate (P = 0.51), or period variability (P = 0.57). However, genotype had an influence on TE, with PACAP-/- neonates having a significantly longer TE throughout the entire protocol, when compared to littermates (P = 0.01). Genotype also affected significantly the change in TE due to hypercapnia (P = 0.006) with the TE of PACAP-/- animals being more severely affected during the first washout period (Tukey's post hoc test: P < 0.001). In addition, genotype significantly affected the VT response: the increase in VT with hypercapnia was blunted in PACAP-/- neonates compared with that of PACAP +/+ littermates (P < 0.005). This contributed to a reduction in the VE response to hypercapnia (P < 0.001), from an increase of 104% (PACAP+/+) to an increase of 59% (PACAP-/-).

Effects of conditions that selectively exacerbate PACAP -/- neonatal mortality

To determine whether a respiratory phenotype may be one of the primary causes of neonatal death of PACAP-/- mice, we examined the physiology of the PACAP-/- genotype under life-threatening conditions. Specifically, we used ECGs to study respiratory and cardiac function in anaesthetized PACAP+/+ and -/- littermates (aged P7–14) during hypothermia, which has been shown to increase the mortality of PACAP-/- neonates (Gray et al. 2002). Respiratory events were observed clearly on ECG recordings as bursts of ‘noise’ corresponding to respiratory movements of the chest wall.

Under normothermic conditions, respiration in both PACAP+/+(n= 6) and -/-(n= 6) genotypes was regular, with no significant difference in respiratory rate (Tukey's post hoc test: P = 0.75) (Fig. 4A). A slight but significantly greater heart rate was observed in the PACAP-null neonates when compared to wild-type littermates (Tukey's post hoc test: P = 0.019) (Fig. 4C).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 4.  Effects of PACAP genotype on ventilatory (A and B) and heart rate (C and D) responses to hypothermia of anaesthetized P4 neonates
A and C, normothermia. B and D, after 5 min of hypothermia (rectal temperature maintained at 30°C). In each experiment, a PACAP-/-(n= 6) was matched with a PACAP+/+ littermate (n= 6). Note that after 5 min of hypothermia, genotype had a pronounced effect on ventilatory rate (breaths min-1) but had no significant effect on heart rate (beats min-1). Three of six PACAP-/- neonates from which measurements were made subsequently died. In addition, three other PACAP-/- pups died after anaesthesia and before recordings were made. All paired PACAP+/+ littermates survived. Asterisk (*) indicates a significant difference (P < 0.05) to wild-type littermates.

 
As would be expected from the lower metabolic rate that accompanies reductions in body temperature, both heart beat (two-way ANOVA: P < 0.001) and breathing rates (two-way ANOVA: P < 0.001) were significantly less than normothermic levels after 5 min of hypothermia (Fig. 4B and D). Breathing of both genotypes was affected (Tukey's post hoc test: +/+, P < 0.01; -/-, P < 0.001). However, the reduction in respiratory rate with hypothermia was highly dependent on genotype (2-way ANOVA: P < 0.001), with the decline being far more pronounced for PACAP-/- animals (Tukey's post hoc test: P < 0.001) (Fig. 4A and B). In contrast, after 5 min of hypothermia there was no significant difference between the heart rate of PACAP-null mice and their wild-type littermates (Tukey's post hoc test: P = 0.617) (Fig. 4D).

Figure 5 shows examples of ECGs during the hypothermic part of the protocol from one of the 6 +/+/-/- pairs of animals used to make Fig. 4. Figure 5A2 and B2 (wild-type mice and PACAP-deficient mice, respectively) shows the effect of hypothermia in the 15 s immediately after the time at which rectal temperatures reached 30°C. Although heart rate is comparable between the genotypes, the respiratory rate of the PACAP-null mouse is much less than its wild-type littermate (compare Fig. 5A2 and 5B2).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 5.  Examples of ECGs during steady-state hypothermia of anaesthetized P4 neonates
A1–3, PACAP+/+. B1–4, PACAP-/-. A1 and B1, ECG of first 10 min of hypothermia. A2 and B2, expanded trace of first 15 s of hypothermia. B3, after 7 min, 30 s of hypothermia. A3 and B4: After 9 min, 45 s of hypothermia. Arrows in B2 and B3 indicate noise in ECG, indicative of ventilatory efforts. Note: respiratory rate fell more rapidly following the onset of hypothermia in PACAP-/- neonates (B2) than in PACAP+/+ littermates (A2).

 
After 10 min of hypothermia, the breathing and heart beat of the wild-type mouse remained regular with frequencies only slightly less that those observed soon after the onset of hypothermia (Fig. 5A3). In contrast, in the PACAP-null mouse the frequency of breathing continued to decline as the duration of hypothermia increased (Fig. 5B3). Despite these dramatic effects on the respiratory rhythm, the heart rate remained relatively stable. Only towards the end of the 10 min of hypothermia, when breathing in PACAP knockout animals was vastly reduced or absent, was cardiac function seriously compromised. Note the declining R-wave amplitude (Fig. 5B1) and an uncoupling of atrial and ventricular firing (AV-block) (Fig. 5B4).

In total, 3 of 6 PACAP-/- neonates succumbed by the end of the hypothermic treatment with AV-block. These three mice had long duration apnoeas preceding AV-block, suggesting that chronic hypoxaemia led to cardiac arrest. A 4th mouse had no detectable breathing with an absence of AV-block. In contrast, none of the PACAP +/+ neonates died, and ECG tracings remained relatively normal, even after 10 min of hypothermia (e.g. Fig. 5A1).


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
A central finding of this study is that a PACAP deficiency compromises respiration in neonatal mice, a finding consistent with previous studies demonstrating that intravenous PACAP injections in anaesthetized dogs causes an increase in ventilation (Ishizuka et al. 1992; Runcie et al. 1995). The respiratory phenotype of the PACAP-null mice precedes the vulnerable period in postnatal development during which PACAP-null mice have a higher rate of mortality. While our data demonstrate that PACAP deficiency reduces baseline minute ventilation, we also show that it blunts the ventilatory response to hypercapnia (tidal volume and overall ventilation) and hypoxia (timing variables, but not tidal volume or overall ventilation). In addition to studying the effect of PACAP on respiration, we examined whether the respiratory phenotype contributes to increased neonatal mortality. We found that the respiration rhythm of PACAP-deficient neonates was most greatly affected under conditions that selectively increase the mortality of PACAP-deficient mice (anaesthetic and hypothermia). Specifically, in PACAP-deficient mice, these conditions caused prolonged apnoea that preceded AV-block. These data are consistent with a critical role for PACAP in respiratory control during periods of neonatal stress.

Breathing in neonatal mice assessed by plethysmography

Advances in mouse genomics offer new approaches to assess the role of specific proteins in the ontogeny and control of breathing (Funk et al. 1997). To take full advantage of these new approaches the technical difficulties of recording breathing non-invasively in an animal weighing only a few grams, and having tidal volumes of <0.05 ml (Mortola, 1984), need to be overcome. The only techniques currently available are whole-body (e.g. Mortola & Lanthier, 1996; Ptak et al. 2002; Autret et al. 2002; Viemari et al. 2003) and head-out (Burton et al. 1997; Robinson et al. 2000; Kazemian et al. 2001) plethysmography. Head-out plethysmography provides a measure of tidal volume independent of airway resistance but this advantage must be weighed against the stress to the animal imposed by this technique, in which an animal is secured by an airtight band around its neck (Gaultier et al. 2003).

Given the accumulating evidence that PACAP may be involved in stress responses, we used unrestrained whole-body plethysmography for the current study. Consequently, a caveat that should be considered when interpreting our results is that the index of tidal volume we used (i.e. the area under the inspiratory pressure curve recorded in the chamber) depends, in part, on airway resistance: as airway resistance increases so would our index. Hypercapnia and hypoxia both cause bronchodilatation, reducing airway resistance (Wetzel et al. 1992; D'Angelo et al. 2001). Therefore, the actual increase in tidal volume when animals were challenged with either 8% CO2 or 10% O2 is likely to be greater than suggested by our index. Similarly, PACAP is a potent bronchodilator (Linden, 1999) so PACAP deficiency could result in a more broncho-constricted lung, with higher airway resistance. Our index of tidal volume might therefore overestimate the tidal volume of the PACAP-null mice, which, in turn, would mean our results underestimate the modulatory affects of PACAP on breathing.

Direct role for PACAP in respiratory control?

Our data suggest that PACAP influences respiration, both during baseline conditions and in response to hypoxic and hypercapnic challenges. The influence of PACAP may be direct, through neuromodulation of the respiratory circuit, or it may be indirect through augmentation of metabolism. Indeed, a proportion of PACAP-null mice that survive into the second week of life develop a wasting disorder characterized by abnormalities in both glucose and fat metabolism, fasting hyperinsulinaemia and a redistribution of fat stores from the peripheral adipose tissue to the liver and skeletal muscle (Gray et al. 2001). If PACAP is involved in maintaining the metabolic rate of neonates, PACAP deficiency would result in less CO2 production during baseline conditions, which in turn would be expected to reduce minute ventilation. A lower metabolism of PACAP-deficient animals may also explain why these mice have a blunted response (timing variables, not overall ventilation) to hypoxia in comparison to wild-type littermates, if the lower metabolism allows them to reside on a shallower portion of the O2-ventilatory response curve.

However, there are several reasons to suggest that the wasting disorder alone is not responsible for the respiratory phenotype we observed: First, blunted chemoresponse of PACAP-null neonates occurs at postnatal day 4, before the previously reported onset of the wasting disorder. Second, although the effect of PACAP on the metabolism of P4 littermates was not measured directly, we found no significant difference in body weight between the three genotypes. Nor did PACAP-null mice show any evidence of peripheral fat wasting or lipid accumulation in the liver upon gross morphological examination. Third, we probably minimize the effects of metabolism on respiration by keeping mice at thermoneutral temperatures during experiments (Mortola & Dotta, 1992). Fourth, while PACAP+/- neonates are normal with regards to lipid and glucose metabolism (4), values for VE during both hypoxia and hypercapnia are between those of PACAP+/+ and -/- littermates (Figs 2F and 3F). This suggests that there is a dose-dependent effect of PACAP on respiration, independent of lipid and/or glucose metabolism. Interestingly, the wasting disorder resembles the effect of chronic neonatal hypoxia and could, in fact, be secondary to a respiratory defect (Mortola, 2001). Finally, differences in metabolic rate are unlikely to explain the differential effects of genotype on the overall ventilatory response to CO2, as the ventilatory response to CO2 is linear throughout most of the physiological range (Loeschke & Gertz, 1958).

An alternate hypothesis is that PACAP has a role in respiratory chemosensitivity, acting directly on elements of the respiratory circuits to modulate their response to respiratory challenges. In a previous study in anaesthetized adult dogs, bilateral sectioning of the carotid sinus nerve innervating the carotid bodies abolished the stimulatory effect of intravenous PACAP27 injections on ventilation, leading the authors to suggest that PACAP was stimulating the peripheral carotid chemoreceptor (Runcie et al. 1995). Interestingly, cAMP has been shown to increase the excitability of Type 1 glomus cells within the carotid body (Stea et al. 1995). While the dog data provide compelling indirect evidence that PACAP may be involved in peripherally mediated chemosensitivity, at least in adults, the effects of PACAP on O2 and CO2 chemosensitivity per se were not directly tested. Nor do the data exclude the possibility that PACAP modulates other components in the neuronal pathway between the peripheral chemoreceptors and respiratory motor neurones.

We note that PACAP is widely distributed within the CNS and is located in brainstem regions implicated in mediating the response to peripheral chemoreceptor activation, the generation of respiratory rhythm and central chemosensitivity (e.g. nucleus of the solitary tract, ventro-lateral medulla, nucleus ambiguous and dorsal vagal nucleus; Hannibal, 2002). In addition, the hypothalamus, which contains the highest concentrations of PACAP and PACAP-specific receptors, has populations of neurones that (a) receive inputs from peripheral chemoreceptors (Thomas & Calaresu, 1972) (b) are sensitive to both CO2 and O2 (Waldrop & Porter, 1995) and (c) project directly to the phrenic motor nucleus (Kc et al. 2002). Therefore, we consider it likely that PACAP acts centrally to modulate respiration.

PACAP, being a potent stimulator of cAMP production and subsequent protein kinase-A (PKA) activation, is a good candidate for a central respiratory neuromodulator. Several groups have established that cAMP, cAMP analogues and cAMP-stimulating agents, such as forskolin, increase respiratory rate when applied to a number of brainstem regions (Arata et al. 1993; Mironov et al. 1999). PKA has also been implicated in the control of respiration by modulating the excitability of respiratory units. For example, PKA increases excitability of both inspiratory neurones within the pre-Botzinger complex (Shao et al. 2003), as well as hypoglossal (XII) motoneurones (Bocchiaro et al. 2003), by modulating postsynaptic AMPA (amino-3-hydroxy-5-methyl-4-isoxazole propionic acid) currents. In addition, the cAMP–PKA pathway has been implicated in the modulation of expiratory neurone excitability in the medulla (Lalley et al. 1997).

PACAP and sudden neonatal death

In addition to a blunted chemoresponse in PACAP-deficient animals, we found that under hypothermic conditions, the rate of breathing in PACAP-null animals is significantly reduced when compared to wild-type littermates, leading to AV-block and death in 50% of the animals tested. These data suggest that the respiratory phenotype may account for the higher mortality of PACAP-null mice when housed at slightly lower ambient temperatures. An important caveat to these experiments is that we used hypothermia and isoflurane to increase the likelihood of neonatal death while making recordings of cardiac and ventilatory activity. While these conditions had no significant effect on either the heart rate or ventilation of wild-type littermates, we cannot exclude the possibility that the cause of death of PACAP-null mice exposed to acute isoflurane–hypothermia was different from that of PACAP-null mice housed at slightly reduced ambient temperatures. It should be noted, however, that, in all genotypes, isoflurane had only a mild effect on breathing and cardiac function before the body temperature was reduced.

Previously studies have demonstrated that the body temperature of small neonatal mammals is highly dependent on ambient temperatures, being regulated mainly by behavioural mechanisms rather than by non-shivering thermogenesis (Mortola, 2001). In neonatal rats, for example, non-shivering thermogenesis is absent during the first 3–4 days (Fowler & Kellogg, 1975). The body temperature of neonatal mice is therefore likely to fluctuate significantly. Our results suggest that PACAP may play a critical physiological role in coping with these fluctuations.

Interestingly, environmental stressors (including hyperthermia), a critical developmental period, abnormal respiratory chemosensitivity and a genetic predisposition have been implicated in human SIDS (Ackerman et al. 2001; Guntheroth & Spiers, 2002). PACAP-deficient mice (a) respond poorly to environmental stress, i.e. hypothermia (the effect of hyperthermia has not been determined), (b) have a critical period in which they are more prone to death than wild-type littermates, and (c) have abnormal responses to hypoxia and hypercapnia. Therefore, it may be constructive to determine whether congenital abnormalities in PACAP-dependent signalling pathways contribute to some cases of SIDS. However, given that (a) breathing abnormalities and a high rate of neonatal death is a phenotype common to several strains of knockout mice (Guillemot et al. 1993; Hummler et al. 1996; Tokieda et al. 1997) (b) brainstem abnormalities have been identified in some, but not all SIDS victims (Kinney & Filiano, 1988), and (c) a mutation in a gene encoding a cardiac sodium channel, which almost never occurs in the adult population, is present in 3% of SIDS victims (Ackerman et al. 2001), it seems likely that the genetic predisposition of SIDS might include congenital abnormalities in a large number of genes.

We have shown that PACAP is an important hormone for the ventilatory response to both hypoxia and hypercapnia in neonatal mice. This is the earliest phenotype for PACAP-deficient mice described to date and may contribute to their sudden-death phenotype. Our findings are in keeping with the recently described importance of PACAP in the mammalian response to stress. We hypothesize that congenital defects within PACAP-dependent signalling pathways lead to an increased susceptibility to infant death resulting from an abnormal regulation of breathing.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Ackerman MJ, Siu BL, Sturner WQ, Tester DJ, Valdivia CR, Makielski JC & Towbin JA (2001). Postmortem molecular analysis of SCN5A defects in sudden infant death syndrome. J A M A 286, 2264–2269.[Abstract/Free Full Text]

Alexander G (1975). Body temperature control in mammalian young. Br Med Bull 31, 62–68.[Free Full Text]

Arata A, Onimaru H & Homma I (1993). Effects of cAMP on respiratory rhythm generation in brainstem-spinal cord preparation from newborn rat. Brain Res 605, 193–199.[CrossRef][Medline]

Autret F, Dauger S, Renolleau S, Eng GV, Kosofsky BE, Gressens P, Gaultier C & Gallego J (2002). Ventilatory control in newborn mice prenatally exposed to cocaine. Pediatr Pulmonol 34, 434–441.[CrossRef][Medline]

Bissonnette JM & Knopp SJ (2001). Developmental changes in the hypoxic ventilatory response in C57BL/6 mice. Respir Physiol 128, 179–186.[CrossRef][Medline]

Bocchiaro CM, Saywell SA & Feldman JL (2003). Dynamic modulation of inspiratory drive currents by protein kinase A and protein phosphatases in functionally active motoneurons. J Neurosci 23, 1099–1103.[Abstract/Free Full Text]

Burton MD, Johnson DC & Kazemi H (1997). The central respiratory effects of acetylcholine vary with CSF pH. J Auton Nerv Syst 62, 27–32.[CrossRef][Medline]

D'Angelo E, Calderini IS & Tavola M (2001). The effects of CO2 on respiratory mechanics in anesthetized paralyzed humans. Anesthesiology 94, 604–610.[CrossRef][Medline]

Drorbaugh JE & Fenn WO (1955). A barometric method for measuring ventilation in newborn infants. Pediatrics 16, 81–87.[Abstract/Free Full Text]

Enhorning G, van Schaik S, Lundgren C & Vargas I (1998). Whole-body plethysmography, does it measure tidal volume of small animals?Can J Physiol Pharmacol 76, 945–951.[CrossRef][Medline]

Fowler SJ & Kellogg C (1975). Ontogeny of thermoregulatory mechanisms in the rat. J Comp Physiol Psychol 89, 738–746.[CrossRef][Medline]

Funk GD, Johnson SM, Smith JC, Dong XW, Lai J & Feldman JL (1997). Functional respiratory rhythm generating networks in neonatal mice lacking NMDAR1 gene. J Neurophysiol 78, 1414–1420.[Abstract/Free Full Text]

Gaultier C, Simonneau M, Dauger S & Gallego J (2003). Genetics and respiratory control: studies in normal humans and genetically modified animals. Rev Mal Respir 20, 77–94.[Medline]

Gray SL, Cummings KJ, Jirik FR & Sherwood NM (2001). Targeted disruption of the pituitary adenylate cyclase-activating polypeptide gene results in early postnatal death associated with dysfunction of lipid and carbohydrate metabolism. Mol Endocrinol 15, 1739–1747.[Abstract/Free Full Text]

Gray SL, Yamaguchi N, Vencova P & Sherwood NM (2002). Temperature-sensitive phenotype in mice lacking pituitary adenylate cyclase-activating polypeptide. Endocrinology 143, 3946–3954.[Abstract/Free Full Text]

Guillemot F, Lo LC, Johnson JE, Auerbach A, Anderson DJ & Joyner AL (1993). Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell 75, 463–476.[CrossRef][Medline]

Guntheroth WG & Spiers PS (2002). The triple risk hypotheses in sudden infant death syndrome. Pediatrics 110, e64.[Abstract/Free Full Text]

Guyton AC (1947). Measurement of respiratory Volumes of laboratory animals. Am J Physiol 150, 70–77.[Free Full Text]

Hamelink C, Tjurmina O, Damadzic R, Young WS, Weihe E, Lee HW & Eiden LE (2002). Pituitary adenylate cyclase-activating polypeptide is a sympathoadrenal neurotransmitter involved in catecholamine regulation and glucohomeostasis. Proc Natl Acad Sci U S A 99, 461–466.[Abstract/Free Full Text]

Hannibal J (2002). Pituitary adenylate cyclase-activating peptide in the rat central nervous system: an immunohistochemical and in situ hybridization study. J Comp Neurol 453, 389–417.[CrossRef][Medline]

Hashimoto H, Shintani N, Tanaka K, Mori W, Hirose M, Matsuda T, Sakaue M, Miyazaki J, Niwa H, Tashiro F, Yamamoto K, Koga K, Tomimoto S, Kunugi A, Suetake S & Baba A (2001). Altered psychomotor behaviors in mice lacking pituitary adenylate cyclase-activating polypeptide (PACAP). Proc Natl Acad Sci U S A 98, 13355–13360.[Abstract/Free Full Text]

Hummler E, Barker P, Gatzy J, Beermann F, Verdumo C, Schmidt A, Boucher R & Rossier BC (1996). Early death due to defective neonatal lung liquid clearance in alpha-ENaC-deficient mice. Nat Genet 12, 325–328.[CrossRef][Medline]

Ishizuka Y, Kashimoto K, Mochizuki T, Sato K, Ohshima K & Yanaihara N (1992). Cardiovascular and respiratory actions of pituitary adenylate cyclase- activating polypeptides. Regul Pept 40, 29–39.[CrossRef][Medline]

Jamen F, Persson K, Bertrand G, Rodriguez-Henche N, Puech R, Bockaert J, Ahren B & Brabet P (2000). PAC1 receptor-deficient mice display impaired insulinotropic response to glucose and reduced glucose tolerance. J Clin Invest 105, 1307–1315.[Medline]

Kazemian P, Stephenson R, Yeger H & Cutz E (2001). Respiratory control in neonatal mice with NADPH oxidase deficiency. Respir Physiol 126, 89–101.[CrossRef][Medline]

Kc P, Haxhiu MA, Tolentino-Silva FP, Wu M, Trouth CO & Mack SO (2002). Paraventricular vasopressin-containing neurons project to brain stem and spinal cord respiratory-related sites. Respir Physiol Neurobiol 133, 75–88.[CrossRef][Medline]

Kinney HC & Filiano JJ (1988). Brainstem research in sudden infant death syndrome. Pediatrician 15, 240–250.[Medline]

Lalley PM, Pierrefiche O, Bischoff AM & Richter DW (1997). cAMP-dependent protein kinase modulates expiratory neurons in vivo. J Neurophysiol 77, 1119–1131.[Abstract/Free Full Text]

Linden L (1999). PACAPs-potential for bronchodilation. Pulm Pharmacol Ther 12, 229–236.[CrossRef][Medline]

Loeschke HH & Gertz KH (1958). Einfluss des O2-Druckes in der Einatmungsluft auf die Atemtätigkeit der Menschen, geprüft unter Konstanthaltung des alveolaren CO2-Druckes. Pflugers Arch Ges Physiol 267, 460–477.[CrossRef]

Mironov SL, Langohr K & Richter DW (1999). A1 adenosine receptors modulate respiratory activity of the neonatal mouse via the cAMP-mediated signaling pathway. J Neurophysiol 81, 247–255.[Abstract/Free Full Text]

Mortola JP (1984). Breathing pattern in newborns. J Appl Physiol 56, 1533–1540.[Abstract/Free Full Text]

Mortola JP (2001). Respiratory Physiology of Newborn Mammals: A Comparative Perspective. Johns Hopkins University Press, Baltimore.

Mortola JP & Dotta A (1992). Effects of hypoxia and ambient temperature on gaseous metabolism of newborn rats. Am J Physiol 263, R267–R272.[Medline]

Mortola JP & Frappell PB (1998). On the barometric method for measurements of ventilation, and its use in small animals. Can J Physiol Pharmacol 76, 937–944.[CrossRef][Medline]

Mortola JP & Lanthier C (1996). The ventilatory and metabolic response to hypercapnia in newborn mammalian species. Respir Physiol 103, 263–270.[CrossRef][Medline]

Otto C, Kovalchuk Y, Wolfer DP, Gass P, Martin M, Zuschratter W, Grone HJ, Kellendonk C, Tronche F, Maldonado R, Lipp HP, Konnerth A & Schutz G (2001). Impairment of mossy fiber long-term potentiation and associative learning in pituitary adenylate cyclase activating polypeptide type I receptor-deficient mice. J Neurosci 21, 5520–5527.[Abstract/Free Full Text]

Ptak K, Burnet H, Blanchi B, Sieweke M, De Felipe C, Hunt SP, Monteau R & Hilaire G (2002). The murine neurokinin NK1 receptor gene contributes to the adult hypoxic facilitation of ventilation. Eur J Neurosci 16, 2245–2252.[CrossRef][Medline]

Robinson DM, Kwok H, Adams BM, Peebles KC & Funk GD (2000). Development of the ventilatory response to hypoxia in Swiss CD-1 mice. J Appl Physiol 88, 1907–1914.[Abstract/Free Full Text]

Runcie MJ, Ulman LG & Potter EK (1995). Effects of pituitary adenylate cyclase-activating polypeptide on cardiovascular and respiratory responses in anaesthetised dogs. Regul Pept 60, 193–200.[CrossRef][Medline]

Shao XM, Ge Q & Feldman JL (2003). Modulation of AMPA receptors by cAMP-dependent protein kinase in preBotzinger complex inspiratory neurons regulates respiratory rhythm in the rat. J Physiol 547, 543–553.[Abstract/Free Full Text]

Sherwood NM, Krueckl SL & McRory JE (2000). The origin and function of the pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon superfamily. Endocr Rev 21, 619–670.[Abstract/Free Full Text]

Stea A, Jackson A, Macintyre L & Nurse CA (1995). Long-term modulation of inward currents in O2 chemoreceptors by chronic hypoxia and cyclic AMP in vitro. J Neurosci 15, 2192–2202.[Abstract]

Thomas MR & Calaresu FR (1972). Responses of single units in the medial hypothalamus to electrical stimulation of the carotid sinus nerve in the cat. Brain Res 44, 49–62.[CrossRef][Medline]

Tokieda K, Whitsett JA, Clark JC, Weaver TE, Ikeda K, McConnell KB, Jobe AH, Ikegami M & Iwamoto HS (1997). Pulmonary dysfunction in neonatal SP-B-deficient mice. Am J Physiol 273, L875–L882.[Medline]

Vaudry D, Gonzalez BJ, Basille M, Yon L, Fournier A & Vaudry H (2000). Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol Rev 52, 269–324.[Abstract/Free Full Text]

Viemari JC, Burnet H, Bevengut M & Hilaire G (2003). Perinatal maturation of the mouse respiratory rhythm-generator: in vivo and in vitro studies. Eur J Neurosci 17, 1233–1244.[CrossRef][Medline]

Waldrop TG & Porter JP (1995). Hypothalamic involvement in respiratory and cardiovascular regulation. In Regulation of Breathing, 2nd edn, ed. Dempsey JA & Pack AI, pp. 338–343. Marcel Dekker, New York.

Wetzel RC, Herold CJ, Zerhouni EA & Robotham JL (1992). Hypoxic bronchodilation. J Appl Physiol 73, 1202–1206.[Abstract/Free Full Text]


    Acknowledgements
 
The authors gratefully acknowledge the generous support of Dr Frank R. Jirik throughout this project. In addition, we thank Dr Francis Green and Dr Wayne Giles for the use of ECG equipment and Colleen Kondo for aiding in the setup of ECG experiments. N.M.S. was funded by CIHR and the Canadian Heart and Stroke Foundation. R.J.A.W. was funded by the Parker B. Francis Foundation, the Canadian Heart and Stroke Foundation, CIHR and NSERC.




This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
C. Gaultier and J Gallego
Neural control of breathing: insights from genetic mouse models
J Appl Physiol, May 1, 2008; 104(5): 1522 - 1530.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
K. J. Cummings, C. Willie, and R. J. A. Wilson
Pituitary adenylate cyclase-activating polypeptide maintains neonatal breathing but not metabolism during mild reductions in ambient temperature
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R956 - R965.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
H. HASHIMOTO, N. SHINTANI, and A. BABA
New Insights into the Central PACAPergic System from the Phenotypes in PACAP- and PACAP Receptor-Knockout Mice
Ann. N.Y. Acad. Sci., July 1, 2006; 1070(1): 75 - 89.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Lacombe, V. Lelievre, C. E. Roselli, W. Salameh, Y.-h. Lue, G. Lawson, J.-M. Muller, J. A. Waschek, and E. Vilain
Delayed testicular aging in pituitary adenylate cyclase-activating peptide (PACAP) null mice
PNAS, March 7, 2006; 103(10): 3793 - 3798.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. Otto, L. Hein, M. Brede, R. Jahns, S. Engelhardt, H.-J. Grone, and G. Schutz
Pulmonary Hypertension and Right Heart Failure in Pituitary Adenylate Cyclase-Activating Polypeptide Type I Receptor-Deficient Mice
Circulation, November 16, 2004; 110(20): 3245 - 3251.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
555/1/15    most recent
jphysiol.2003.052514v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cummings, K. J.
Right arrow Articles by Wilson, R. J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cummings, K. J.
Right arrow Articles by Wilson, R. J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS