| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Institut de Pharmacologie Moléculaire et Cellulaire, CNRS-UMR 6097, 660 route des Lucioles, Sophia Antipolis, 06560 Valbonne, France2 Department of Physiology and Experimental Pathophysiology, University of Erlangen-Nuremburg, Universitätsstrasse 17, D-91054 Erlangen, Germany3 Department of Physiology, Fritz-Pregl-Strasse 3, A-6020 Innsbruck, Austria4 INSERM U583, Physiopathologie et thérapie des déficits sensoriels et moteurs, 71 rue de Navacelles, 34090 Montpellier, France
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
(Received 6 April 2004;
accepted after revision 24 May 2004;
first published online 28 May 2004)
Corresponding author M. Lazdunski: Institut de Pharmacologie Moléculaire et Cellulaire, CNRS-UMR 6097, 660 route des Lucioles, Sophia Antipolis, 06560 Valbonne, France. Email: ipmc{at}ipmc.cnrs.fr
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Potential mechanosensitive cation channels were identified in genetic screens in the nematode C. elegans, in Drosophila melanogaster and very recently in Zebrafish. In Drosophila and Zebrafish, members of the transient receptor potential (TRP) family of ion channels, e.g. NompC, are essential for mechanosensation. Genetic inactivation of NompC causes an uncoordinated phenotype and virtually abolishes mechanoreceptor potentials in both Drosophila tactile bristles (Walker et al. 2000) and Zebrafish sensory hair cells of the inner ear (Sidi et al. 2003). Antennal sound-evoked responses in Drosophila require another very recently identified osmosensitive TRP channel (Kim et al. 2003). Interestingly, a TRP channel (OSM-9) is also involved in osmosensation and nose touch perception in C. elegans (Colbert et al. 1997). Those data suggest that some TRP channels are mechanosensitive cation channels that link mechanical stimulation to neuronal firing.
Another family of potential stretch-activated cation channels, the degenerins (e.g. MEC-4, MEC-10), was identified in a screen of C. elegans mutants with impaired body touch perception (Huang & Chalfie, 1994; Ernstrom & Chalfie, 2002). The degenerins are homologues of epithelial amiloride-sensitive Na+ channel subunits. Interestingly, certain forms of mammalian mechanosensation, such as hearing, are blocked by amiloride (Jorgensen & Ohmori, 1988), making the degenerins very interesting candidates for mechanically gated cation channels.
Both ion channel families, TRP channels and degenerins, have members in mammals (McCleskey & Gold, 1999). The TRP channel family includes the capsaicin receptor, TRPV-1, a cation channel that integrates various noxious signals (Caterina et al. 1997; Tominaga et al. 1998) such as heat and acidic pH, TRPM-8, which is activated by cold temperature (McKemy et al. 2002), and TRPV-4, a proposed osmo-transducer in primary nociceptive nerve fibres (Alessandri-Haber et al. 2003). Several mammalian homologues of the C. elegans degenerins have been cloned during recent years from the central and peripheral nervous system (Price et al. 1996; Garcia-Anoveros et al. 1997; Waldmann et al. 1997a,b; de Weille et al. 1998; Waldmann & Lazdunski, 1998; Babinski et al. 1999; Akopian et al. 2000). Most of the mammalian degenerin homologues can be activated by extracellular acid and have therefore been termed ‘acid-sensing ion channels’ (ASICs) by us or ‘brain sodium channels’ (BNC or BNaC) by others (Price et al. 1996; Garcia-Anoveros et al. 1997). The different ASIC subunits form homo- and heteromultimeric cation channels with distinct tissue distribution patterns and pH dependencies (for reviews see Waldmann et al. 1998; Krishtal, 2003).
Most of the ASIC subunits are expressed in sensory neurones and might thus be involved in nociception associated with tissue acidosis. However, the homology of ASIC channels with the C. elegans degenerins suggests that ASIC channels could also be involved in mechanoperception in mammals. The presence of ASIC2a protein in the mechanosensitive cutaneous nerve endings of rodents (Garcia-Anoveros et al. 2001) also suggests a potential role of ASIC2 in touch perception. In line with this, a decreased sensitivity of rapidly adapting cutaneous mechanosensitive fibres in ASIC2 null mice (Price et al. 2000) and an increased sensitivity of those fibres in ASIC3 knockout mice (Price et al. 2001) were reported.
To evaluate the role of the H+-gated cation channel ASIC2 in different facets of mechanoperception, we examined the effect of ASIC2 knockout on: (i) hearing; (ii) visceral mechanonociception; and (iii) cutaneous mechanoperception. However, our data do not support an important role for ASIC2 in those facets of mammalian mechanoperception.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The generation of the ASIC2–/– mice used here has been reported by us elsewhere (Ettaiche et al. 2004). Briefly, a loxP sequence and a neomycin resistance cassette flanked by two loxP sequences were inserted into the HindIII and XhoI sites flanking exon 8, which codes for the second transmembrane domain. The targeted homozygotes were crossed with mice that express CRE recombinase, leading to deletion of exon 8 and thus to a truncation of the ASIC2 protein before TM2. The TM2 deletion affects all known splice variants of ASIC2: ASIC2a and ASIC2b. The ASIC2 null mice were viable, fertile and did not have any apparent morphological or behavioural abnormalities. Animal experiments were carried out in accordance with European Communities Council Directive 86/6609/EEC. Experiments were also in accordance with the German Animal Protection Law (1987) and approved by the District Government or in accordance with French legislation.
Expression of ASIC2a from wild-type and knockout mice in Xenopus oocytes
Both ASIC2 wild-type and ASIC2 knockout cDNA was amplified from ASIC2+/– mouse brain by RT-PCR with the primers AGAATTCGCCGCCACCATGGACCTCAAGGAGAG (sense) and ATCTCGAGTCAGCAGGCAATCTCCT (anti-sense) and subcloned into a Xenopus oocyte expression vector (Waldmann et al. 1996). Capped cRNA was prepared using standard techniques and 1 ng of cRNA was injected into Xenopus laevis oocytes, obtained from frogs which were hummanely killed after the final collection. Currents activated by extracellular acid were recorded 1 day later essentially as described by Champigny et al. (1998). The bath medium contained (mM): NaCl, 140; MgCl2, 2; CaCl2, 1.8; and Hepes, 10; adjusted to pH 7.4 with NaOH. In the acidic extracellular solution, Hepes was replaced by 10 mM sodium acetate, adjusted to pH 4.5 with acetic acid.
Primary cultured mouse hippocampal neurones
Six 2-day-old C57BL/6 mice were killed by decapitation. Hippocampi were dissected and sliced (7–8 slices per hippocampus). Slices were collected at 4°C in DMEM (Sigma; pH 7.4) and incubated in 0.2% trypsine (Seromed), 1875 U ml–1 of DNAse IV (Sigma) in the digestion buffer (mM: NaCl, 137; KCl, 5; Na2HPO4, 7; NaHCO3, 4; Hepes, 25) at room temperature for 5 min. The enzymatic digestion was stopped by an 8 min incubation in 1 mg ml–1 Type I Trypsin inhibitor (Sigma) at room temperature. Slices were washed with DMEM before being mechanically dissociated in the presence of 1875 U ml–1 of DNAse IV, followed by two further mechanical dissociations. Supernatant was collected and centrifuged for 15 min, 300 g at 4°C. The pellet was resuspended in DMEM, and cells were preplated at a density of 100 000 per 35 mm tissue culture dish (central drop) coated with polyornithine (Sigma) and matrigel (Becton Dickinson) in culture medium (MEM {Sigma} with 6 g l–1 glucose, 2.2 g l–1 NaHCO3, 2 mM glutamine, 10% decomplemented fetal calf serum, 3.6 g l–1 Hepes, 100 mg l–1 transferrine {Sigma}, 30 mg l–1 insulin {Sigma}, 100 mg l–1L-ascorbic acid {Sigma}, 0.1 mg l–1 biotin {Sigma}, 1.5 mg ml–1 vitamin B12 {Sigma} and 2 µg ml–1 gentamycin {Sigma}) for 2–3 h before filling the dishes (2 ml culture medium per dish). After 1 day of culture, the culture medium was complemented with B27 medium (1:50 dilution; Gibco InVitrogen), 2 µM uridine (Sigma), 2 µM 5-fluoro-2' -deoxyuridine (Fluka), and this medium was renewed every 4 days. Neurones were kept in an incubator with 95% air–5% CO2 at 37°C and used for electrophysiological recordings 7–20 days after plating. Neurones with triangular cell bodies, a typical feature of pyramidal neurones, were selected for recording.
Patch-clamp recordings of hippocampal ASIC-like currents
Ion currents were recorded using the whole-cell patch-clamp technique (Hamill et al. 1981). Data were sampled at 500 Hz and low-pass filtered at 3 kHz using pClamp8 software (Axon Instruments). The statistical significance of differences between sets of data was estimated by Student's unpaired t test. The pipette solution contained (mM): 140 KCl, 5 NaCl, 2 MgCl2, 5 EGTA, 2 K2ATP and 10 Hepes (pH 7.35), while the bath solution contained (mM): 150 NaCl, 5 KCl, 2 MgCl2, 2 CaCl2, 10 glucose and 10 Hepes (pH 7.45). Twenty micromolar CNQX, 10 µM kynurenic acid, 7 mM MgCl2 and 10 µM bicuculline (all from Sigma) were added in order to inhibit glutamate- and GABA-induced currents. Mes or acetate was used instead of Hepes to buffer bath solution pH ranging from 6 to 5, and from 4.5 to 3, respectively. ZnCl2 was coapplied with acidic solutions at 300 µM (Baron et al. 2001), whereas the spider toxin psalmotoxin 1 (PcTx1) was applied at 20 nM before the pH drop (Escoubas et al. 2000). ASIC-like currents were activated every 2 min by an extracellular pH drop induced by shifting one out of six outlets of a microperfusion system in front of the cell. Experiments were carried out at room temperature (20–24°C). Bovine serum albumin (0.1%) was added in extracellular solutions containing the toxin PcTX1 to prevent its adsorption to tubing and containers.
Western blots
The Western blot with an antibody directed against the ASIC2a NH2 terminus (MDLKESPSEGSLQPSSC) was carried out as described (Ettaiche et al. 2004). Briefly, total protein was prepared from mouse brain and from COS cells (monkey kidney cell line) transfected with an ASIC2a or ASIC3 expression vector (PCI, Promega, France). Proteins were separated on 8% Laemmli gels and transferred to HybondC (Amersham). The first antibody was a 1:200 dilution of affinity purified anti-ASIC2a antibody. The second antibody was a 1:10 000 diluted peroxidase labelled anti-rabbit IgG antibody (Pharmacia).
In vivo measurements of auditory threshold
The technique for recording gross cochlear potentials in mice has been described elsewhere (Guitton et al. 2003). Briefly, mice were anaesthetized intraperitoneally with 0.3 ml kg–1 of 6% sodium pentobarbitone (Sanofi, Montpellier, France). The right bulla was opened through a posterior auricular surgical procedure (dorsal approach) to expose the cochlea. A recording electrode was placed on the bony edge of the round window. A reference electrode was placed in the neck muscles. Cochlear potentials were elicited with tone burst with a 1 ms rise–fall time and a 9 ms total duration generated by an arbitrary function generator (type 9100R, LeCroy Corporation, Chestnut Ridge, NY, USA). The signals were passed through a programmable attenuator and presented to the ear in free field via a JBL 075 earphone (JBL, Northridge, CA, USA). Ten frequencies were tested (2, 4, 6, 8, 10, 12, 16, 20, 26 and 32 kHz), increasing in 5 dB increments from 0 to 100 dB sound pressure level (SPL). The rate of presentation was 10 bursts s–1. Cochlear responses were amplified (gain 2000) by a differential amplifier (Grass P511K, Astro-Medical Inc., West Warwick, RI, USA), averaged (256 samples) and saved on the hard disk of a PC. The stored potentials were digitally low-pass filtered at 2.5 kHz to measure the compound action potential (CAP) of the auditory nerve, and the summating potential (SP) reflecting the summed intracellular DC receptor potential, mainly generated by the inner hair cells (Cody & Russell, 1988). To extract the cochlear microphonic (CM), the potential reflecting summed intracellular ac receptor potentials, mainly generated by outer hair cells (Patuzzi et al. 1989), cochlear potentials were filtered with a band-pass filter centred on the frequency of tone burst stimulation.
In vitro skin–nerve preparation
Extracellular recordings from single nerve fibres were performed as previously published (Kress & Guenther, 1999; Bernardini et al. 2002). Briefly, KO mice and WT litter mates were killed by exposure to 100% CO2 and the hairy skin with the saphenous nerve attached was dissected from either hind paw. The preparation was transferred to a chamber filled with synthetic interstitial fluid (SIF) consisting of (mM): 107.8 NaCl, 26.2 NaHCO3, 9.64 sodium gluconate, 7.6 sucrose, 5.05 glucose, 3.48 KCl, 1.67 NaH3PO4, 1.53 CaCl2 and 0.69 MgSO4 at 32°C, which was adjusted to pH 7.4 by continuously gassing with 95% oxygen–5% CO2. After the nerve had been placed into a separate chamber filled with liquid paraffin for electrical insulation, fine filaments were dissected from the main nerve trunk with sharpened watchmaker's forceps and monopolar action potential activity was recorded from the single filaments with a gold wire electrode with the reference electrode positioned nearby. Signals were amplified 10 000-fold and recorded online on the hard disk of a PC. For recording and offline analysis, the SPIKE/SPIDI software package was used (Forster & Handwerker, 1990). Receptive fields were identified by probing the skin with a blunt glass rod as a search stimulus. For mechanical threshold determination, a calibrated set of von Frey hairs with uniform tip diameter was used. Mechanical response characteristics of myelinated RA and SA fibres were determined with a custom-made automated constant force stimulator. Heat stimuli were applied from a feedback-controlled radiant heat source (linear temperature rise from 32 to 46°C in 21 s with passive cooling) and for cold stimulation SIF of +4°C was applied to the receptive field from a syringe.
CGRP release measurements
The descending colon of the mice was dissected in one piece, cleaned, mounted with the peritoneal side exposed on an inflatable tube with a pressure transducer and washed for 30 min with SIF at 37°C as previously described (Roza & Reeh, 2001). Five glass tubes were each filled with 1.2 ml of SIF at 32°C and the experiment started when the mounted preparation was transferred to the first tube for an incubation period of 5 min. After two 5 min baseline incubations the tube was inflated to a pressure of 60 mmHg during the third incubation and this stimulation was followed by two 5 min washout periods. For CGRP enzyme immunoassay (EIA) analysis, 100 µl aliquots were taken from the total volume and mixed with commercial EIA buffer (SPIbio, Montigny le Bretonneux France). CGRP content was determined as provided by the producer and all EIA plates were analysed photometrically with a microplate reader (Dynatech, Chantilly VA, USA). Total concentrations of CGRP were calculated with reference to 1 g fresh weight and normalized values (to the control incubation preceding the mechanical stimulation) are given in the figures as means ±S.E.M.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
TM2 has previously been shown to participitate in the ionic pore of this ion channel family (Waldmann et al. 1995). Therefore the TM2 deletion in our knockout mice (Ettaiche et al. 2004) should abolish channel activity. To verify this, we expressed both wild-type ASIC2a and the targeted ASIC2a transcript in Xenopus laevis oocytes (Fig. 1). While a transient acid-activated inward current of at least 100 nA was recorded in six out of ten oocytes injected with wild-type ASIC2a cRNA, no H+-gated current could be detected in any of the ten oocytes injected with the ASIC2a transcript from ASIC2 knock-out mice. To further confirm the absence of functional ASIC2 channels, ASIC-like currents were examined in hippocampal neurones from ASIC2–/– mice and compared with currents recorded from ASIC2+/+ mice. We tested the effect of the toxin PcTx1, a specific inhibitor of homomeric ASIC1a channels (Escoubas et al. 2000), and the effect of zinc, a coactivator of ASIC2a-containing channels (Fig. 2; Baron et al. 2001). The ASIC-like current of ASIC2 +/+ mouse hippocampal neurones was half inhibited (I/Icontrol= 0.5 ± 0.1, n= 15) by 20 nM PcTx1 (Fig. 2C) and increased by about 1.4-fold (I/Icontrol= 1.36 ± 0.09, n= 28) by 300 µM zinc (Fig. 2D). Thus, the ASIC-like current of ASIC2+/+ mouse hippocampal neurones flows through a mixture of PcTx1-inhibited, zinc-insensitive homomeric ASIC1a channels and of PcTx1-resistant, zinc-sensitive ASIC2a-containing heteromeric channels. These results are similar to those previously reported for rat hippocampal neurones (Baron et al. 2002). In hippocampal neurones from ASIC2–/– mice, PcTx1 (20 nM) induced a massive inhibition (I/Icontrol= 0.10 ± 0.02, n= 17, Fig. 2C) of the ASIC-like current, whereas zinc (300 µM) did not increase but rather inhibited the current amplitude. (I/Icontrol= 0.62 ± 0.08, n= 13, Fig. 2D). These properties show that homomeric ASIC1a channels are highly predominant in neurones from ASIC2–/– mice and that ASIC2a subunits do not participate in the formation of functional ASIC channels in ASIC2–/– mice.
|
|
Hearing is the sense for which mechanoperception meets its biggest challenge, since extremely small mechanical forces are transformed within microseconds into electrical signals. This short delay makes a direct coupling of mechanosensitive channels to the mechanical trigger highly likely (reviewed by Strassmaier & Gillespie, 2002). The hair cell transduction channel is blocked by the diuretic amiloride and by the lanthanide Gd3+, both rather unspecific channel blockers at the high concentrations required. ASIC channels are also inhibited by amiloride (Waldmann et al. 1998) and certain subunit combinations are blocked by Gd3+ (Babinski et al. 2000). Thus ASICs are potential candidates for the hair cell transduction channel. To evaluate whether ASIC2 is required for hearing, we recorded compound action potentials (CAPs) of the auditory nerve (Fig. 3). CAPs reflect the electrical activity of the auditory nerve and thus the output of the cochlea towards the central nervous system. The sound intensity thresholds that provoked CAPs were virtually identical in wild-type and ASIC2 knockout mice over the entire frequency range tested (2–64 kHz; Fig. 3).
|
The almost identical CAP audiograms, cochlear microphonics and summating potentials recorded from ASIC2+/+ and ASIC2–/– mice suggest that ASIC2 is not required for auditory perception and is not part of the hair cell transduction channel.
It also seems unlikely that other ASICs play a major role in hair cell transduction since the biophysical properties of the known members of the ENaC/Deg ion channel family (Waldmann et al. 1998) do not match the known properties of the hair cell transduction channel (Strassmaier et al. 2002), as follows. (i) The hair cell channel conductance was estimated by several groups to be around 100 pS. Conversely, all ENaC/Deg channels have rather small conductances, below 15 pS. (ii) The mechanosensitive ion channel in hair cells discriminates poorly between cations and Ca2+ is favoured over monovalent cations. Conversely, ASIC channels have a rather strong preference for monovalent cations. The only ASIC subunit with a significant Ca2+ permeability is ASIC1 (Na+:Ca2+permeability ratio of 16 (Sutherland et al. 2001) or 2.5 (Waldmann et al. 1997b).
Effect of ASIC2 knockout on visceral mechanonociception
Mechanosensitive afferents in hollow visceral organs, such as the GI tract and urinary bladder, are thought to signal the degree of distension and thus filling, but also signal discomfort and pain when excessive pressure builds up. The colon is one of the best characterized models for visceral mechanosensation. Both mechanosensitive A
and C fibres innervate the colon (Su & Gebhart, 1998). Neurosecretory nociceptive fibres release neuropeptides such as CGRP and tachykinins upon stimulation (Roza et al. 2001) and the amount of peptide released is an indicator of the activity of those nociceptive nerve endings. To evaluate whether knockout of the ASIC2 gene affects visceral mechanonociception, we examined the pressure-stimulated CGRP release from colon in vitro. An increase in pressure and thus strain increased CGRP release from the colon of ASIC2+/+ mice and their ASIC2–/– littermates. However, there was clearly no effect of the ASIC2 knockout (Fig. 4). Thus ASIC2 is not part of the mechanosensor of primary CGRP-releasing nociceptive afferents innervating the colon.
|
Effect of ASIC2 knockout on cutaneous nociception
Cutaneous mechanosensation is one of the best characterized but maybe also the most complex form of mechanoperception. Several types of mechanosensitive fibres innervate the skin (for review see Koltzenburg et al. 1997). Myelinated Aß fibres comprise RA (rapidly adapting) fibres and SA (slowly adapting) fibres, which innervate hair follicles and Merkel cell complexes in touch domes, respectively. Two types of thinly myelinated A fibres, rapidly adapting D hair (DH) and slowly adapting SA fibres, low- and high-threshold C mechanoreceptors and polymodal A and C nociceptors add further complexity to mammalian cutaneous mechanosensation.
We analysed the responses of different classes of sensory fibres to mechanical, chemical and thermal stimulation of their receptive fields by extracellular recording of action potential discharge activity in a skin–nerve in vitro preparation. We detected no significant effect of ASIC2 knockout on conduction velocity, mechanical and heat sensitivity of cutaneous afferents. The median von Frey threshold of C fibres was 22.6 mN (n= 12–13) for both wild-type and ASIC2 knockout mice and that of RA fibres was 4 mN (n= 12) for ASIC2+/+ and 1 mN (n= 13) for ASIC2–/– mice. The average heat threshold of mechano-heat-sensitive C fibres was 39.43 ± 0.81°C (n= 13, ±S.E.M.) for wild-type and 38.55 ± 0.63°C (n= 12, ±S.E.M.) for ASIC2–/– mice. So far our data are in good agreement with a previously published report by Price et al. (2000), who found that mechanostimulated responses of DH and AM fibres, as well as mechanical, acid and heat responses of C fibres, were unaltered by the ASIC2 knockout. However, Price et al. (2000) reported a decreased stimulus–response coding of RA fibres and, to a rather minor extent, of SA fibres in ASIC2–/– mice when compared to control mice.
RA fibres typically respond with a brief discharge at the onset of the mechanical stimulus and again when the applied force is relieved (Koltzenburg et al. 1997). Thus, RA fibres sense changes in stimulus intensities (Grigg & Del Prete, 2002) and represent typical sensors with differential transduction characteristics. However, in our experiments, the stimulus–response coding during both stimulus onset and offset were not decreased in ASIC2–/– mice when compared to age-matched wild-type littermates (Fig. 5). The stimulation protocols differ somewhat between our study and that of Price et al. (2000). We stimulated the skin with a defined force (controlled stress), whereas Price et al. (2000) used a protocol in which the skin was stretched by a defined distance (controlled strain). Both techniques are equivalent, since stress causes strain and vice versa (Grigg et al. 2002). Thus, loss of function of an important component of the RA fibre mechanosensor would affect the responses in both experimental configurations. Furthermore, in both our study and that of Price et al. (2000), the activation (von Frey) threshold of RA fibres was unaffected by the ASIC2 knockout, a fact that in our opinion strongly argues against ASIC2 as a crucial component of the RA fibre mechanosensor.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Are C. elegans degenerins or certain ASIC channels mechanosensitive ion channels? The polls on this question are still open. In C elegans, functional degenerins (MEC-4 and MEC-10) and associated proteins (e.g. MEC-2 and MEC-6) are required for body touch sensation of the nematode (Huang et al. 1994). Gain-of-function mutants of the degenerins form ion channels and coexpression of such constitutively active degenerin mutants with ion channel properties and activity (Chelur et al. 2002; Goodman et al. 2002). Thus, degenerins can form ion channel complexes together with associated proteins that are required for touch sensation. Furthermore, the calcium increase provoked by light touch in C. elegans ALM neurones in vivo is abolished in mec-4 loss-of-function mutants, suggesting that mec-4 activity is required for the mechanosensitivity of the touch receptors. The loss-of mechanosensitivity of mec-4 null worms is probably not due to a general alteration of neuronal excitability, since the calcium signals after potassium depolarization in primary culture were similar for wild-type and mec-4 null worms (Suzuki et al. 2003). These data make a very clear case for degenerin ion channel activity being required for certain forms of mechanoperception of the nematode.
However, electrophysiological evidence that degenerins form mechanosensitive cation channels in C. elegans or after heterologous expression is still lacking. Furthermore, there is no evidence that loss of degenerin function causes loss of mechanosensitive currents in acutely dissected worms or in cultured C. elegans cells. In a very recent study, Jospin et al. (2004) analysed the gating properties of the UNC-105 degenerin, a proposed mechanosensitive cation channel (Liu et al. 1996) in acutely dissected worms. While a constitutively active amiloride-sensitive UNC-105 gain-of-function mutant has been recorded in muscle cells of a C. elegans unc-105(n506) strain, no mechanically gated amiloride-sensitive current has been detected in muscle cells from wild-type worms.
Mechanosensation in C. elegans is complex and requires the correct interplay of various transduction pathways. For example, loss of function of EGL-3, a proprotein convertase thought to be involved in neuropeptide processing (Kass et al. 2001), causes insensitivity to body touch. Surprisingly, the same mutation rescues the insensitivity to nose touch caused by genetic inactivation of the ionotropic glutamate receptor GLR-1 in interneurones that are postsynaptic to touch receptors. Therefore, it cannot currently be ruled out that the role of degenerin channels in mechanosensation of the nematode is indirect. For example, a transmitter molecule could be released after mechanical stimulation by the touch receptor or surrounding cells and activate or modulate degenerin channel activity. A similar mechanism, mechanostimulated ATP release and activation of ionotropic purinergic receptors, was proposed for the mechanosensation in mammalian hollow organs (Burnstock, 1999).
As for the ASICs, no alteration of ASIC channel activity by mechanical stimulation could be detected despite efforts by G. Champigny (personal communication) and others (Garcia-Anoveros et al. 2001). Furthermore, the biophysical properties (single-channel conductance, ion selectivity) and pharmacology of mechanosensitive cation channels recorded in primary cultures of mammalian sensory neurones (Cho et al. 2002; Drew et al. 2002) do not match those of heterologously expressed ASIC channels (Waldmann et al. 1997b; Champigny et al. 1998; Sutherland et al. 2001).
While the benzamil sensitivity of the mechanosensitive whole-cell current in the first study of mechanosensitive currents in sensory neurones suggested that ASIC channels might be mechanosensitive cation channels (McCarter et al. 1999), recent studies rather propose that other non-ASIC channels are the mechanosensors. Cho et al. (2002) identified two types of mechanosensitive cation channels in some 1400 excised patches from dorsal root ganglion sensory neurones: ‘low threshold’ (LT) and ‘high threshold’ (HT) cation channels with activation pressure thresholds of 10–20 and 60 mmHg, respectively. Both ion channels discriminate only poorly between Na+ and Ca2+, whereas ASIC2 exhibits a strong preference for monovalent cations. The LT channel has a single channel conductance of 51 pS, which is much higher than that of ASIC2a (13.4 pS) or the heteromultimeric ASIC2a/ASIC2b channel (13.7 pS; (Lingueglia et al. 1997). Conversely, the conductance of the HT channel, 13.7 pS, is very similar to that of ASICs. However, both HT and LT channels were resistant to 200 µM amiloride, a concentration that blocks ASIC2 (Kd= 28 µM; Champigny et al. 1998) and most other ASICs almost entirely. The amiloride insensitivity and a block of mechanically activated currents in rat sensory neurones by Ruthenium Red (IC50= 503 µM), a drug that does not affect ASIC2 (G. Champigny, unpublished observations), was also demonstrated in a different study (Drew et al. 2002). The fact that an ASIC2 or ASIC3 knockout does not affect the amplitude and kinetics of mechanically activated currents recorded from cultured sensory neurones (Drew et al. 2004) also suggests that other non-ASIC channels are the mechanosensors in mammalian sensory neurones.
Degenerin ion channels in C. elegans are associated with other proteins (e.g. MEC-6) that are required for touch perception (Chelur et al. 2002) and, of course, yet unidentified associated proteins might alter channel properties and could be required for the mechanosensitivity of ASICs. To date, two families of stretch-activated ion channels have been identified and reconstituted in heterologous expression systems: the bacterial non-selective mechanosensitive cation channels (MscL and MscS; Booth & Louis, 1999) and the mammalian mechanosensitive K+ channels (TREK and TRAAK; Patel et al. 2001). Both families of mechanosensitive channels do not require coexpression of associated proteins for mechanosensitivity, indicating that tethering to other non-ubiquitous proteins is not a general requirement for mechanosensitivity of ion channels.
In knockout animals, altered expression of related or unrelated transcripts can mask or generate a phenotype. However, the unaltered mechanosensation in the ASIC2 knockout mice is probably not due to compensation by other ASIC subunits since: (i) expression of ASIC1 and ASIC3 is unaltered in ASIC2 knockout mice (Ettaiche et al. 2004); and (ii) ASIC2 is extremely conserved between species (human vs. mouse, 99% identical protein), suggesting that the principal physiological function of ASIC2 cannot tolerate mutations. Therefore, it seems rather unlikely that another ASIC subunit (<65% protein sequence identity) could, at unaltered expression levels, simply replace the function of ASIC2.
The fact that C. elegans degenerins and mammalian ASIC channels both belong to the same protein family does not necessarily imply a similar function, since the protein homology is rather low (25% homology, 13% identity between mec-4 and ASIC2) and both phyla separated more than 1 billion years ago (Hedges, 2002).
In conclusion, the lack of impact (present study) or the rather limited impact (Price et al. 2000) of an ASIC2 knockout on mammalian mechanosensation suggests that ASIC2 is not part of a mechanically gated cation channel important for cutaneous mechanosensation, hearing and visceral mechanonociception.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Alessandri-Haber N, Yeh JJ, Boyd AE, Parada CA, Chen X, Reichling DB et al. (2003). Hypotonicity induces TRPV4-mediated nociception in rat. Neuron 39, 497–511.[CrossRef][Medline]
Babinski K, Catarsi S, Biagini G & Seguela P (2000). Mammalian ASIC2a and ASIC3 subunits co-assemble into heteromeric proton-gated channels sensitive to Gd3+. J Biol Chem 275, 28519–28525.
Babinski K, Le KT & Seguela P (1999). Molecular cloning and regional distribution of a human proton receptor subunit with biphasic functional properties. J Neurochem 72, 51–57.[CrossRef][Medline]
Baron A, Schaefer L, Lingueglia E, Champigny G & Lazdunski M (2001). Zn2+ and H+ are coactivators of acid-sensing ion channels. J Biol Chem 276, 35361–35367.
Baron A, Waldmann R & Lazdunski M (2002). ASIC-like, proton-activated currents in rat hippocampal neurons. J Physiol 539, 485–494.
Bernardini N, Roza C, Sauer SK, Gomeza J, Wess J & Reeh PW (2002). Muscarinic M2 receptors on peripheral nerve endings: a molecular target of antinociception. J Neurosci 22, RC229.
Booth IR & Louis P (1999). Managing hypoosmotic stress: aquaporins and mechanosensitive channels in Escherichia coli. Curr Opin Microbiol 2, 166–169.[CrossRef][Medline]
Burnstock G (1999). Release of vasoactive substances from endothelial cells by shear stress and purinergic mechanosensory transduction. J Anat 194, 335–342.[CrossRef][Medline]
Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD & Julius D (1997). The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389, 816–824.[CrossRef][Medline]
Champigny G, Voilley N, Waldmann R & Lazdunski M (1998). Mutations causing neurodegeneration in Caenorhabditis elegans drastically alter the pH sensitivity and inactivation of the mammalian H+-gated Na+ channel MDEG1. J Biol Chem 273, 15418–15422.
Chelur DS, Ernstrom GG, Goodman MB, Yao CA, Chen L, O'Hagan R & Chalfie M (2002). The mechanosensory protein MEC-6 is a subunit of the C. elegans touch-cell degenerin channel. Nature 420, 669–673.[CrossRef][Medline]
Cho H, Shin J, Shin CY, Lee SY & Oh U (2002). Mechanosensitive ion channels in cultured sensory neurons of neonatal rats. J Neurosci 22, 1238–1247.
Cody AR & Russell IJ (1988). Acoustically induced hearing loss: intracellular studies in the guinea pig cochlea. Hear Res 35, 59–70.[CrossRef][Medline]
Colbert HA, Smith TL & Bargmann CI (1997). OSM-9, a novel protein with structural similarity to channels, is required for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J Neurosci 17, 8259–8269.
Dallos P (1986). Neurobiology of cochlear inner and outer hair cells: intracellular recordings. Hear Res 22, 185–198.[CrossRef][Medline]
Drew LJ, Rohrer DK, Price MP, Blaver KE, Cockayne DA, Cesare P et al. (2004). Acid-sensing ion channels ASIC2 and ASIC3 do not contribute to mechanically activated currents in mammalian sensory neurones. J Physiol 556, 691–710.
Drew LJ, Wood JN & Cesare P (2002). Distinct mechanosensitive properties of capsaicin-sensitive and -insensitive sensory neurons. J Neurosci 22, RC228.
Ernstrom GG & Chalfie M (2002). Genetics of sensory mechanotransduction. Annu Rev Genet 36, 411–453.[CrossRef][Medline]
Escoubas P, De Weille JR, Lecoq A, Diochot S, Waldmann R, Champigny G et al. (2000). Isolation of a tarantula toxin specific for a class of proton-gated Na+ channels. J Biol Chem 275, 25116–25121.
Ettaiche M, Guy N, Hofmann P, Lazdunski M & Waldmann R (2004). Acid-sensing ion channel 2 is important for retinal function and protect against light-induced retinal degeneration. J Neurosci 24, 1005–1012.
Forster C & Handwerker HO (1990). Automatic classification and analysis of microneurographic spike data using a PC/AT. J Neurosci Meth 31, 109–118.[CrossRef][Medline]
Garcia-Anoveros J, Derfler B, Neville-Golden J, Hyman BT & Corey DP (1997). BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels. Proc Natl Acad Sci U S A 94, 1459–1464.
Garcia-Anoveros J, Samad TA, Zuvela-Jelaska L, Woolf CJ & Corey DP (2001). Transport and localization of the DEG/ENaC ion channel BNaC1
to peripheral mechanosensory terminals of dorsal root ganglia neurons. J Neurosci 21, 2678–2686.
Gillespie PG & Walker RG (2001). Molecular basis of mechanosensory transduction. Nature 413, 194–202.[CrossRef][Medline]
Goodman MB, Ernstrom GG, Chelur DS, O'Hagan R, Yao CA & Chalfie M (2002). MEC-2 regulates C. elegans DEG/ENaC channels needed for mechanosensation. Nature 415, 1039–1042.[CrossRef][Medline]
Grigg P & Del Prete Z (2002). Stretch sensitivity of cutaneous afferent neurons. Behav Brain Res 135, 35–41.[CrossRef][Medline]
Guitton MJ, Caston J, Ruel J, Johnson RM, Pujol R & Puel JL (2003). Salicylate induces tinnitus through activation of cochlear NMDA receptors. J Neurosci 23, 3944–3952.
Hamill OP & Martinac B (2001). Molecular basis of mechanotransduction in living cells. Physiol Rev 81, 685–740.
Hamill OP, Marty A, Neher E, Sakmann B & Sigworth FJ (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 391, 85–100.[CrossRef][Medline]
Hedges SB (2002). The origin and evolution of model organisms. Nat Rev Genet 3, 838–849.[CrossRef][Medline]
Huang M & Chalfie M (1994). Gene interactions affecting mechanosensory transduction in Caenorhabditis elegans. Nature 367, 467–470.[CrossRef][Medline]
Jorgensen F & Ohmori H (1988). Amiloride blocks the mechano-electrical transduction channel of hair cells of the chick. J Physiol 403, 577–588.
Jospin M, Mariol MC, Segalat L & Allard B (2004). Patch clamp study of the UNC-105 degenerin and its interaction with the LET-2 collagen in Caenorhabditis elegans muscle. J Physiol 557, 379–388.
Kass J, Jacob TC, Kim P & Kaplan JM (2001). The EGL-3 proprotein convertase regulates mechanosensory responses of Caenorhabditis elegans. J Neurosci 21, 9265–9272.
Kim J, Chung YD, Park DY, Choi S, Shin DW, Soh H et al. (2003). A TRPV family ion channel required for hearing in Drosophila. Nature 424, 81–84.[CrossRef][Medline]
Koltzenburg M, Stucky CL & Lewin GR (1997). Receptive properties of mouse sensory neurons innervating hairy skin. J Neurophysiol 78, 1841–1850.
Kress M & Guenther S (1999). Role of [Ca2+]i in the ATP-induced heat sensitization process of rat nociceptive neurons. J Neurophysiol 81, 2612–2619.
Krishtal O (2003). The ASICs: signaling molecules? Modulators?Trends Neurosci 26, 477–483.[CrossRef][Medline]
Lingueglia E, de Weille JR, Bassilana F, Heurteaux C, Sakai H, Waldmann R et al. (1997). A modulatory subunit of acid sensing ion channels in brain and dorsal root ganglion cells. J Biol Chem 272, 29778–29783.
Liu J, Schrank B & Waterston RH (1996). Interaction between a putative mechanosensory membrane channel and a collagen. Science 273, 361–364.[Abstract]
McCarter GC, Reichling DB & Levine JD (1999). Mechanical transduction by rat dorsal root ganglion neurons in vitro. Neurosci Lett 273, 179–182.[CrossRef][Medline]
McCleskey EW & Gold MS (1999). Ion channels of nociception. Annu Rev Physiol 61, 835–856.[CrossRef][Medline]
McKemy DD, Neuhausser WM & Julius D (2002). Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416, 52–58.[CrossRef][Medline]
Patel AJ, Lazdunski M & Honore E (2001). Lipid and mechano-gated 2P domain K+ channels. Curr Opin Cell Biol 13, 422–428.[CrossRef][Medline]
Patuzzi RB, Yates GK & Johnstone BM (1989). Outer hair cell receptor current and sensorineural hearing loss. Hear Res 42, 47–72.[CrossRef][Medline]
Price MP, Lewin GR, McIlwrath SL, Cheng C, Xie J, Heppenstall PA et al. (2000). The mammalian sodium channel BNC1 is required for normal touch sensation. Nature 407, 1007–1011.[CrossRef][Medline]
Price MP, McIlwrath SL, Xie J, Cheng C, Qiao J, Tarr DE et al. (2001). The DRASIC cation channel contributes to the detection of cutaneous touch and acid stimuli in mice. Neuron 32, 1071–1083.[CrossRef][Medline]
Price MP, Snyder PM & Welsh MJ (1996). Cloning and expression of a novel human brain Na+ channel. J Biol Chem 271, 7879–7882.
Roza C & Reeh PW (2001). Substance P, calcitonin gene related peptide and PGE2 co-released from the mouse colon: a new model to study nociceptive and inflammatory responses in viscera, in vitro. Pain 93, 213–219.[CrossRef][Medline]
Sidi S, Friedrich RW & Nicolson T (2003). NompC TRP channel required for vertebrate sensory hair cell mechanotransduction. Science 301, 96–99.
Strassmaier M & Gillespie PG (2002). The hair cell's transduction channel. Curr Opin Neurobiol 12, 380–386.[CrossRef][Medline]
Su X & Gebhart GF (1998). Mechanosensitive pelvic nerve afferent fibers innervating the colon of the rat are polymodal in character. J Neurophysiol 80, 2632–2644.
Sutherland SP, Benson CJ, Adelman JP & McCleskey EW (2001). Acid-sensing ion channel 3 matches the acid-gated current in cardiac ischemia-sensing neurons. Proc Natl Acad Sci U S A 98, 711–716.
Suzuki H, Kerr R, Bianchi L, Frokjaer-Jensen C, Slone D, Xue J et al. (2003). In vivo imaging of C. elegans mechanosensory neurons demonstrates a specific role for the MEC-4 channel in the process of gentle touch sensation. Neuron 39, 1005–1017.[CrossRef][Medline]
Tominaga M, Caterina MJ, Malmberg AB, Rosen TA, Gilbert H, Skinner K et al. (1998). The cloned capsaicin receptor integrates multiple pain-producing stimuli. Neuron 21, 531–543.[CrossRef][Medline]
Waldmann R, Bassilana F, de Weille J, Champigny G, Heurteaux C & Lazdunski M (1997a). Molecular cloning of a non-inactivating proton-gated Na+ channel specific for sensory neurons. J Biol Chem 272, 20975–20978.
Waldmann R, Champigny G, Bassilana F, Heurteaux C & Lazdunski M (1997b). A proton-gated cation channel involved in acid-sensing. Nature 386, 173–177.[CrossRef][Medline]
Waldmann R, Champigny G & Lazdunski M (1995). Functional degenerin-containing chimeras identify residues essential for amiloride-sensitive Na+ channel function. J Biol Chem 270, 11735–11737.
Waldmann R, Champigny G, Voilley N, Lauritzen I & Lazdunski M (1996). The mammalian degenerin MDEG, an amiloride-sensitive cation channel activated by mutations causing neurodegeneration in Caenorhabditis elegans. J Biol Chem 271, 10433–10436.
Waldmann R & Lazdunski M (1998). H+-gated cation channels: neuronal acid sensors in the NaC/DEG family of ion channels. Curr Opin Neurobiol 8, 418–424.[CrossRef][Medline]
Walker RG, Willingham AT & Zuker CS (2000). A Drosophila mechanosensory transduction channel. Science 287, 2229–2234.
de Weille JR, Bassilana F, Lazdunski M & Waldmann R (1998). Identification, functional expression and chromosomal localisation of a sustained human proton-gated cation channel. FEBS Lett 433, 257–260.[CrossRef][Medline]
|
Acknowledgements |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. L. McCord, S. G. Hayes, and M. P. Kaufman Acid-sensing ion and epithelial sodium channels do not contribute to the mechanoreceptor component of the exercise pressor reflex Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1017 - H1024. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Coric, Y. J. Passamaneck, P. Zhang, A. Di Gregorio, and C. M. Canessa Simple chordates exhibit a proton-independent function of acid-sensing ion channels FASEB J, June 1, 2008; 22(6): 1914 - 1923. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. P. Gannon, L. G. VanLandingham, N. L. Jernigan, S. C. Grifoni, G. Hamilton, and H. A. Drummond Impaired pressure-induced constriction in mouse middle cerebral arteries of ASIC2 knockout mice Am J Physiol Heart Circ Physiol, April 1, 2008; 294(4): H1793 - H1803. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Lingueglia Acid-sensing Ion Channels in Sensory Perception J. Biol. Chem., June 15, 2007; 282(24): 17325 - 17329. [Full Text] [PDF]
|
|
|
|
 |
|
 D. P. Corey What is the hair cell transduction channel? J. Physiol., October 1, 2006; 576(1): 23 - 28. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Poirot, T. Berta, I. Decosterd, and S. Kellenberger Distinct ASIC currents are expressed in rat putative nociceptors and are modulated by nerve injury J. Physiol., October 1, 2006; 576(1): 215 - 234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Jiang, K. K. Rau, R. D. Johnson, and B. Y. Cooper Proton Sensitivity Ca2+ Permeability and Molecular Basis of Acid-Sensing Ion Channels Expressed in Glabrous and Hairy Skin Afferents J Neurophysiol, April 1, 2006; 95(4): 2466 - 2478. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Zhang, F. J. Sigworth, and C. M. Canessa Gating of Acid-sensitive Ion Channel-1: Release of Ca2+ Block vs. Allosteric Mechanism J. Gen. Physiol., January 30, 2006; 127(2): 109 - 117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. S. Mogil, N. M. Breese, M.-F. Witty, J. Ritchie, M.-L. Rainville, A. Ase, N. Abbadi, C. L. Stucky, and P. Seguela Transge |
