HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 559/2/355    most recent jphysiol.2004.066233v2 jphysiol.2004.066233v1 Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Meier, J. Articles by Grantyn, R. Search for Related Content PubMed PubMed Citation Articles by Meier, J. Articles by Grantyn, R.

Developmental Physiology, Johannes Müller Institute, Humboldt University Medical School (Charité), D-10117 Berlin, Germany

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Alternative splicing generates two variants of the GABA_AR 2-subunit, 2S and 2L, which differ by insertion of the amino acid sequence LLRMFSFK into the large cytoplasmic loop between transmembrane domains 3 and 4. This additional sequence within the GABA_AR 2L-subunit contains the potential protein kinase C (PKC) phosphorylation site serine 343 (Ser343). In the present study we intended to determine the capacity of these two splice variants to accumulate at inhibitory synaptic terminals and to colocalize with gephyrin, and to find out whether phosphorylation of Ser343 has any effect on GABA_AR distribution. Green fluorescent protein (GFP)-tagged large cytoplasmic loops of GABA_AR 2S and 2L (GFP::2S/L) were used as surrogates for full-length receptors to study the function of the individual 2S and 2L peptides in transfected spinal cord neurones (SCNs) and COS-7 cells. It was found that GFP::2L displayed a significantly higher capacity to accumulate at inhibitory synapses than GFP::2S. GABA_AR GFP::2S accumulation at inhibitory postsynaptic sites was suppressed to the extent that GFP::2S assumed a diffuse cytosolic distribution. PKC activation facilitated the postsynaptic clustering of GFP::2L but not of GFP::2S. This required the Ser343 residue, since substituting Ala343 for Ser343 produced a diffuse cytosolic localization pattern, like that of GFP::2S. Furthermore, upon PKC activation Discosoma Red2-tagged GABA_AR 2L (DsRed 2::2L) colocalized with gephyrin in transfected COS-7 cells. These results support the idea that alternative splicing regulates the access of GABA_ARs to inhibitory postsynaptic sites in a Ser343 phosphorylation-regulated way.

(Received 8 April 2004; accepted after revision 25 June 2004; first published online 2 July 2004)
Corresponding author J. Meier: Developmental Physiology, Johannes Müller Institute, Humboldt University Medical School (Charité), Tucholskystrasse 2, D-10117 Berlin, Germany. Email: jochen.meier{at}charite.de

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Fast synaptic inhibition in the supramedullar brain is largely mediated by ionotropic -amino-butyric acid type A receptors (GABA_ARs). They constitute the target of various drugs, such as barbiturates, neurosteroids and some anaesthetics, and their malfunction can underlie some forms of epilepsy, schizophrenia, anxiety and depression, as well as chronic drug abuse (for reviews see Kittler & Moss, 2001; Moss & Smart, 2001). GABA_ARs form functional chloride-permeable channels by assembly of five out of 16 subunits into hetero-oligomeric pentamers (for a review see Kittler & Moss, 2003). At synaptic sites they form clusters that colocalize with gephyrin (Schweizer et al. 2003).

Gephyrin is a glycine receptor (GlyR)-tubulin bridging molecule that has initially been purified in association with the GlyR ß-subunit (Prior et al. 1992). A similar gephyrin-dependent mechanism has also been proposed for the postsynaptic stabilization of GABA_ARs, but in this case receptor stabilization requires the availability of the 2-subunit (Kirsch et al. 1995; Essrich et al. 1998; Baer et al. 2000). Two splice variants of the GABA_AR 2-subunit have been described so far (Whiting et al. 1990). The long splice variant (2L) differs from the short isoform (2S) by the presence of the eight amino acid insert LLRMFSFK which bears the protein kinase C (PKC) phosphorylation site, Ser343 (Whiting et al. 1990; Moss et al. 1992).

PKC-mediated phosphorylation of GABA_AR subunits has been shown to play an important role in the modulation of GABA_AR activity (Moss et al. 1992; Machu et al. 1993; Krishek et al. 1994; Wang et al. 2003) and postsynaptic anchoring (Meier et al. 2003). Ser343 phosphorylation has attracted considerable attention since it was shown to produce the strongest attenuation of GABA-activated currents (Krishek et al. 1994). However, the effects of GABA_AR 2 mRNA splicing and Ser343 phosphorylation on postsynaptic GABA_AR anchoring have remained unclear.

Full-length green fluorescent protein (GFP)-tagged GABA_AR sequences (1, ß2 and 2L) were used to study the mechanisms of receptor anchoring at GABAergic synapses (Kittler et al. 2001b). However, adequate targeting of transfected GABA_AR channels requires coexpression of , ß and -subunits, and this precludes the gaining of information about the individual contribution of these subunits to postsynaptic receptor anchoring. Here we analysed the distribution of GFP-tagged large cytoplasmic loops of the GABA_AR 2-subunit in transfected spinal cord neurones (SCNs) to find out whether: (i) GABA_AR 2S and 2L loops differ in their capacity to accumulate at inhibitory synaptic terminals; (ii) PKC-mediated phosphorylation affects the distribution of any of the 2 loops; and (iii) the Ser343 residue of the 2L loop is among the targets for PKC-induced phosphorylation.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
All experiments were carried out according to the guidelines laid down by the Landesamt für Arbeitsschutz, Gesundheit und technische Sicherheit Berlin (T0406/98). Rats were deeply anaesthetised with ether before sacrifice by decapitation.

RT and cDNA constructs

RNA was isolated from adult rat spinal cord using Trizol (Invitrogen Life Technologies, Carlsbad, CA, USA). Complementary DNA (cDNA) was obtained by reverse transcription (SuperscriptII, GibcoBRL, Bethesda, MD, USA) of RNA using oligo-dT primer. PCR conditions were: 30 cycles of 45 s at 95°C, 45 s at 58°C and 1 min at 72°C. For green fluorescent protein (GFP)-receptor loop chimeras (GFP::2S/L), PCR amplimers comprising the cytoplasmic loop were obtained using oligonucleotides (5'GGGGAATTCGCATTATTTTGTGAGCAACCGG3' and 5'GGGGGATCCTCAGGAGTCCATTTTGGCAATGCG3'). After subcloning using EcoRI and BamHI into the mammalian expression vectors pEGFP-C1 and pDsRed2-C1 (Clontech, Palo Alto, CA, USA) we distinguished between GABA_AR 2S and 2L loops with the following primers (S/L: 5'CAAGGTCTCCTATGTCACAGC3' and 5'AAGGCGGTAGGGAAGAAGATC3', yielding 377 and 401 bp, respectively). Green fluorescent protein-tagged gephyrin (GeC2,6) was isolated by RT-PCR as previously described (Meier & Grantyn, 2004). Final constructs were verified by DNA sequencing. Oligonucleotides used for the RT-PCR analysis of the GABA_AR subunit expression in DIV12 SCNs have been described elsewhere (Meier et al. 2002).

Site-directed mutagenesis

Site-directed mutagenesis was performed using the GeneEditor system (Promega, Madison, WI, USA). The GABA_AR 2L loop was subcloned into Bluescript using EcoRI and BamHI. The 5'-phosphorylated oligonucleotide 5'CTTCGGATGTTTGCCTTCAAGG3' served to exchange the Ser343 residue against alanine (S343A). The resulting 2L–S343A loop was re-cloned into pEGFP-C1 and verified by DNA sequencing.

Cell culture and transfection

Spinal cord neurones (SCNs) of embryonic day 14 Wistar rats were prepared as previously described (Meier et al. 2002) and maintained on top of spinal cord glia cells in Neurobasal medium (GibcoBRL) supplemented with B27 (GibcoBRL) and 1% fetal calf serum (Brewer & Cotman, 1989). Transfection was carried out after 12 days in vitro (DIV) using Effectene reagent, as previously described (Meier & Grantyn, 2004). COS-7 cells were transfected using FuGENE6 reagent (Roche Diagnostics, Mannheim, Germany). After 72 h of protein expression, African green monkey kidney fibroplast cells (COS-7 line) cells were processed for immunocytochemistry.

Antibodies

The mouse monoclonal antibodies (mAbs) recognized gephyrin (mAb7a, 1:200, Pfeiffer et al. 1984; Alexis Biochemicals, San Diego, CA, USA) and DsRed (1:100, Clontech). Polyclonal antibodies (pAbs) were guinea-pig anti-vesicular inhibitory amino acid transporter (VIAAT; 1:800, Dumoulin et al. 1999; Chemicon, Temecula, CA, USA), guinea-pig anti-GABA_AR 2 (1:4000, Fritschy & Mohler, 1995) and rabbit anti-GFP (1:300, Molecular Probes, Eugene, OR, USA]. For multiple labelling, mAbs and pAbs were combined. To ensure that labelling was specifically due to primary antibodies we replaced them with similarly diluted normal serum from the same species. Secondary antibodies were carboxymethyl-indocyanine (Cy3 and Cy5), fluorescein-isothiocyanate (FITC), coupled and purchased from Jackson ImmunoResearch Laboratories (West Grove, PA, USA), or AlexaFluor350, coupled and purchased from Molecular Probes.

Immunocytochemistry and quantification

Immunofluorescence was performed as previously described (Meier & Grantyn, 2004). Images were acquired using a 12-bit cooled CCD camera (Ch250, Photometrics, Tucson, AZ, USA) mounted on a standard epifluorescence microscope (objective 100x, Axiovert, Carl Zeiss, Jena, Germany). Appropriate filters (XF22, XF32, XF110-2 and XF136-2; Omega Optical Inc., Brattleboro, VT, USA) allowed the detection of FITC, Cy3, Cy5 or AlexaFluor350 fluorescence.

To distinguish between diffuse fluorescence signals and clusters, images were background subtracted within the linear range of an 8 bit grey scale. Fluorescence intensity profiles were obtained along GFP-expressing dendrites (NIH Image software). GFP distributes diffusely within the cytosol (Llopis et al. 1998). The standard deviation (S.D.) of the mean of this diffuse fluorescence signal was obtained and compared with the S.D. of GFP::2S and GFP::2L. The respective values are 9.1 ± 0.9 (GFP, n = 85), 15.1 ± 1.4 (GFP::2S, n = 51) and 35.8 ± 2.5 (GFP::2L, n = 58). This is the first indication that the fluorescence patterns obtained with GFP::2S and GFP::2L were significantly different (P < 0.001, Student's unpaired t test). The classification of a fluorescence signal as a cluster required that its maximal fluorescence above the mean value exceeded the S.D. of the diffuse GFP fluorescence 3 times (3 criterion). In addition, a threshold was set at one-third of the maximal fluorescence of a presumed cluster. Classification as a cluster required the width of the fluorescence peak at the threshold to be in the range of 3 (0.33 µm) and 30 pixels (3.3 µm).

To determine colocalization, images were merged. For colocalization of two clusters of immunogens, we required that >50% of the pixels reflecting one immunogen should show colocalization with a coherent cluster of the corresponding other immunogen. The term ‘apposition’ is used when two immunogens are closely associated (distance <5 pixels and overlap <50%). Colocalized clusters were counted within a region of interest comprising the soma and 50 µm of proximal dendrites. A colocalization index was defined by evaluation of colocalization (apposition) of corresponding immunoreactivities and expressed as the percentage fraction of the number of colocalized clusters and the total number of clusters of a given immunoreactivity.

Since we could not determine the distribution of our expression constructs by cell surface staining of the antigens, we analysed the fluorescence distribution along a line delineating the outer perimeter of the COS-7 cells, i.e. the plasma membrane (e.g. Kins et al. 2000).

If not mentioned otherwise, values were obtained from 10–20 cells in 3 independent experiments and expressed as means ± S.E.M. The level of significance was determined by Student's unpaired t test and is indicated by one (P < 0.05), two (P < 0.01) or three (P < 0.001) asterisks.

	Results

Top Abstract Introduction Methods Results Discussion References

 
The large intracellular loop of GABA_AR 2S accumulates ineffectively at inhibitory postsynaptic sites

GABA_AR 2S and 2L large intracellular loops were tagged with GFP to visualize their subcellular localization. With the resulting constructs (GFP::2S/L), SCNs were transfected on DIV12 and displayed GFP fluorescence after 16 h of protein expression. According to the approach to discriminate between diffuse and clustered fluorescence (Methods), GFP::2S was found diffusely distributed within the neuronal cytosol (Fig. 1Aa and B). Occasionally GFP::2S formed clusters (e.g. Fig. 1B, high-power view, arrow). VIAAT-immunostaining of inhibitory presynaptic terminals revealed that GFP::2S rarely accumulated opposite inhibitory terminals (Fig. 1B). The fraction of VIAAT-immunoreactive terminals that colocalized with GFP::2S was 14.4 ± 2.1% (Fig. 1C, left-hand, shaded column). To find out whether the occasional binding of GFP::2S to postsynaptic molecules was associated with the presence of endogenous gephyrin, we performed triple immunofluorescence staining, as shown in Fig. 1B. When GFP::2S clustered opposite VIAAT-immunoreactive terminals GFP::2S was likely to colocalize with gephyrin (Fig. 1B, high-power view, arrow). The fraction of postsynaptic GFP::2S that colocalized with gephyrin was 83.3 ± 16.7% (Fig. 1C, right-hand, hatched column). These experiments show that GABA_AR GFP::2S accumulates with low efficacy at gephyrin-containing postsynaptic sites.

View larger version (61K): [in this window] [in a new window]   Figure 1.  The large intracellular loop of GABAAR 2S accumulates ineffectively at inhibitory postsynaptic sites A, images of GFP::2S (a), GFP::2L (b) and GFP (c) fluorescence in neurones and corresponding fluorescence intensity plots along the lines delineated by dotted rectangles. B, representative image of a SCN containing GFP::2S and VIAAT, left hand to the high power views of the delineated region. Note that in case of colocalization with VIAAT, GFP::2S is associated with gephyrin immunoreactivity (arrows). C, fraction of VIAAT-immunoreactive terminals that contained GFP::2S (C, left-hand y-axis) and fraction of VIAAT- and GFP::2S-immunoreactive synapses that contained gephyrin (C, right-hand y-axis). The number of analysed neurones (n) was 51, 3 independent experiments each. Scale bars: 10 µm; high-power views, 2 µm.

The large intracellular loop of GABA_AR 2L accumulates at inhibitory postsynaptic sites with significantly higher efficacy than 2S

To find out whether DIV12 SCNs express the GABA_AR 2L splice variant, RT-PCR analysis was performed. As shown in Fig. 2A, DIV12 SCNs expressed the GABA_AR subunits (target) 1–3, ß2, ß3, 2S and 2L. Upper bands represent the internal control ß-actin, which was coamplified in the same PCR reaction tubes to visualize equal amounts of cDNA. Since DIV12 SCNs expressed both GABA_AR 2S and 2L splice variants, we examined the ability of GFP::2L to accumulate at inhibitory postsynaptic sites. As shown in Fig. 1Ab and B, GFP::2L also tended to distribute diffusely within the neuronal cytosol. However, in contrast to GFP::2S, GFP::2L aggregates were easily distinguishable from the diffuse GFP signal (Figs 1Ab, 1Ac and 2B). VIAAT immunostaining revealed that GFP::2L aggregates were associated with inhibitory presynaptic terminals (Fig. 2B, high-power view, arrows). Of the examined VIAAT-immunoreactive boutons, 47.7 ± 3.4% colocalized with, or were apposed to, GFP::2L (Fig. 2C, left-hand, shaded column). This fraction was significantly (P < 0.001, Student's unpaired t test) higher than the respective value obtained for GFP::2S. To find out whether the postsynaptic accumulation of GFP::2L was associated with the presence of endogenous gephyrin, triple immunofluorescence staining was performed as shown in Fig. 2B. Of the synapses that displayed association of GFP::2L with VIAAT, 85.3 ± 4.8% also contained gephyrin (Fig. 2B, high-power view, arrows and Fig. 2C, right-hand, hatched column). To rule out the possibility that lack of colocalization between GFP::2S or GFP::2L and VIAAT was due to an absence of gephyrin in front of VIAAT-positive terminals, we determined the respective fractions of VIAAT terminals that displayed colocalization with gephyrin. We found that gephyrin accumulated equally at VIAAT sites in GFP::2S-transfected (87.0 ± 2.5%, n = 51) and GFP::2L-transfected neurones (91.3 ± 1.8%, n = 58). We therefore concluded that, in comparison with GFP::2S, GFP::2L has a significantly higher capacity to accumulate at gephyrin-containing postsynaptic sites.

View larger version (47K): [in this window] [in a new window]   Figure 2.  The large intracellular loop of GABAAR 2L accumulates at inhibitory postsynaptic sites with significantly higher efficacy than 2S A, RT-PCR on DIV12 SCNs. Transcripts coding for the GABAAR 1-, 2-, 3-, ß2-, ß3-, 2S- and 2L-subunits (target) were found. The upper bands correspond to the amplification product of ß-actin. Targets and ß-actin have always been coamplified in the same reaction tube to ensure a comparable amount of cDNA within each PCR reaction. B, representative image of a SCN containing GFP::2L and VIAAT. Note that in case of colocalization with VIAAT, GFP::2L is associated with gephyrin immunoreactivity (arrows). C, fraction of VIAAT-immunoreactive terminals that contained GFP::2L (C, left-hand y-axis) and fraction of VIAAT- and GFP::2L-immunoreactive synapses that contained gephyrin (C, right-hand y-axis). The number of analysed neurones (n) was 58, 3 independent experiments each. M, DNA molecular weight marker. Scale bars: 10 µm; high-power views, 2 µm.

Competition for postsynaptic accumulation between endogenous 2-containing GABA_ARs and GABA_AR GFP::2L, but not GFP::2S

To ensure that the GFP-tagged GABA_AR 2 loops can be used as surrogates for full-length GABA_ARs, we analysed whether the transfected loops competed with endogenous GABA_ARs for postsynaptic accumulation. SCNs were transfected with GFP::2S or GFP::2L, and triple labelling experiments were performed to visualize the GFP signal together with endogenous 2-containing GABA_ARs and gephyrin. If the transfected GABA_AR 2 loops and endogenous GABA_AR 2 shared a common postsynaptic binding site, GFP::2L should compete with endogenous GABA_AR 2. Transfection of GFP::2S had no effect on the distribution of endogenous 2-containing GABA_ARs (Fig. 3Aa–c, arrows). In nontransfected and GFP::2S-transfected neurones, 80.9 ± 2.6 and 79.1 ± 3.4% of gephyrin clusters, respectively, were immunoreactive for endogenous 2-containing GABA_ARs (Fig. 3C). However, whenever GFP::2L was associated with endogenous gephyrin (Fig. 3Ba–c, dendrite of a transfected neurone, crossed arrows) endogenous 2-containing GABA_ARs were almost entirely excluded from postsynaptic loci. In GFP::2L-transfected neurones, the fraction of gephyrin clusters that contained endogenous 2-containing GABA_ARs decreased significantly to a value of 40.8 ± 3.6% (Fig. 3C). This decrease was due to a competition between endogenous 2-containing GABA_ARs and transfected GFP::2L, since the fraction of GFP::2L-associated gephyrin clusters that colocalized with endogenous 2-containing GABA_ARs was only 10.5 ± 3.8% (Fig. 3C, right-hand, hatched column). As a control, in the same field of view, the association of endogenous 2-containing GABA_ARs with gephyrin in nontransfected neurones remained unaltered (Fig. 3Ba–c, arrows, and C). Therefore, it is likely that GFP::2L and endogenous 2-containing GABA_ARs share a common binding site in the postsynaptic apparatus of inhibitory synapses.

View larger version (69K): [in this window] [in a new window]   Figure 3.  Competition for postsynaptic accumulation between endogenous 2-containing GABAARs and GABAAR GFP::2L, but not GFP::2S Aa, representative image of a neurone containing GFP::2S. Ab and c, corresponding endogenous GABAAR 2 and gephyrin immunoreactivities, respectively. Ba, representative image of a dendrite containing GFP::2L. Bb and c, corresponding endogenous GABAAR 2 and gephyrin immunoreactivities, respectively. Note that in case of GFP::2S expression, endogenous GABAAR 2 and gephyrin are colocalized (arrows). When GFP::2L is present (dendrite of a transfected neurone), endogenous GABAAR 2 is no longer associated with gephyrin (crossed arrows). As a control, in the same field of view, endogenous GABAAR 2 and gephyrin remain associated in nontransfected neurones (arrows). C, fraction of gephyrin clusters that colocalized with endogenous GABAAR 2 (left-hand columns) in nontransfected, GFP::2S- and GFP::2L-transfected neurones, and fraction of GFP::2L-associated gephyrin clusters that were colocalized with endogenous GABAAR 2 (right-hand, hatched column). The number of analysed neurones (n) was 40 (nontransfected), 30 (GFP::2S transfected) and 35 (GFP::2L transfected), 3 independent experiments each. Scale bar: 10 µm.

PKC phosphorylation of Ser343 facilitates postsynaptic accumulation of GFP::2L

It has previously been shown that PKC activation facilitates postsynaptic accumulation of GABA_ARs in embryonic CNS brain slices (Meier et al. 2003). We therefore explored the possibility that postsynaptic accumulation of GABA_AR GFP::2S or GFP::2L could be enhanced by increasing the PKC activity. Short-term treatment with the phorbol ester phorbol-12,13-dibutyrate (PDBu) (1 µM, 30 min before fixation) had no effect on the distribution of GFP::2S (Figs 4Aa and 5D). Again, we assume that a diffuse GFP::2S signal reflects the absence of postsynaptic accumulation or binding to components within the postsynaptic protein network. However, PDBu treatment (Figs 4Ba and 5D) caused a significant increase in the fraction of VIAAT-immunoreactive terminals colocalizing with GFP::2L (76.5 ± 4.6%) versus controls (47.7 ± 3.4%). The PDBu effect on the GFP::2L distribution could be antagonized by coapplication of the PKC blocker chelerythrine chloride (CC; Figs 4Bb and 5D). In that case, the level of colocalization (8.3 ± 3.3%) dropped to values comparable with the postsynaptic accumulation of GFP::2S. Since CC alone (Figs 4Bc and 5D) reduced postsynaptic GFP::2L accumulation to levels (9.6 ± 4.5%) comparable with those of GFP::2S, it seems that a basal PKC phosphorylation underlies the higher capacity of GFP::2L to accumulate at inhibitory postsynaptic sites.

View larger version (102K): [in this window] [in a new window]   Figure 4.  Effect of PDBu treatment on postsynaptic GFP::2S and GFP::2L accumulation Thirty minutes before fixation, cultures were exposed to 1 µM PDBu (Aa and Ba), PDBu and 2 µM chelerythrine chloride (CC; Ab and Bb), or CC alone (Ac and Bc). Merged representative images of neurones expressing (in green online) GFP::2S (Aa–c), or GFP::2L (Ba–c), and corresponding VIAAT immunoreactivity (in red online). Below, high-power views corresponding to the delineated regions in Ba–c. Note the GFP::2L-selective enhancement by PDBu of postsynaptic loop accumulation (compare Aa with Ba). Irrespective of PDBu exposure, CC treatment leads to diffuse GFP distribution, comparable with that of GFP::2S (compare Bb and c with Ab and c). Quantification of the illustrated experiment is shown in Fig. 5. The number of analysed neurones (n) was 30 in each case, 3 independent experiments. Scale bar: 10 µm; high-power views, 2 µm.

View larger version (84K): [in this window] [in a new window]   Figure 5.  Elimination of the PKC phosphorylation site Ser343 impairs postsynaptic accumulation of GFP::2L A, representative image of a neurone containing GFP::2L–S343A together with endogenous VIAAT and gephyrin immunoreactivities. B, fraction of VIAAT-immunoreactive terminals that contained GFP::2L–S343A (left-hand y-axis) and fraction of VIAAT- and GFP::2L–S343A-immunoreactive synapses that contained gephyrin (right-hand y-axis). C, representative image of a PDBu-treated (30 min, 1 µM) neurone displaying GFP::2L–S343A fluorescence and VIAAT immunoreactivity. D, fraction of VIAAT-immunoreactive terminals colocalized with GFP::2S, GFP::2L and GFP::2L–S343A under the indicated experimental conditions. Part of the quantification (colocalization between GFP::2S or GFP::2L and VIAAT under control conditions) shown in D has already been shown in Figs 1C and 2C. The number of analysed neurones (n) was 42, 3 independent experiments. Scale bar: 10 µM.

To finally find out whether PDBu treatment would allow for association of gephyrin with 2L in non-neuronal cells, we cotransfected COS-7 cells with GFP-tagged gephyrin and DsRed2-tagged 2L. To rule out optical filter cross-talk, the distribution of both proteins was visualized by indirect immunofluorescence using Alexa350- and Cy5-coupled secondary antibodies (Fig. 6A, GeC2,6::GFP and DsRed2::2L in false colours green and red, respectively (online)). As expected, under control conditions DsRed2::2L colocalized with a minor fraction (Fig. 6B, 12.4 ± 5.8%) of intracellular gephyrin aggregates. To our surprise, however, short-term PDBu treatment (30 min, 1 µM) resulted in a significant increase of this fraction to a value of 53.7 ± 6.7% (Fig. 6B). In 74% of cotransfected cells (Fig. 6C), PDBu treatment stimulated the appearance of a distinct population of small gephyrin spots (Fig. 6Ab, arrows) and, in addition, provoked the spatial association of gephyrin with the presumed plasma membrane (Fig. 6Ab, arrowheads). The projection area of the small gephyrin spots was 6-fold smaller than that of the usually observed gephyrin aggregates (0.18 ± 0.01 versus 1.1 ± 0.1 µm², Fig. 6D). In PDBu-treated cells, when gephyrin occurred in small aggregates or when it decorated the plasma membrane, it colocalized with DsRed2::2L (Fig. 6B–D). This PDBu effect was not observed when CC was present, except that small gephyrin aggregates were still found in 46% of cotransfected cells (Fig. 6Ac, arrows, and D).

View larger version (41K): [in this window] [in a new window]   Figure 6.  Co-expression of DsRed2::2L and GeC2,6::GFP (corresponding to clone P1) in COS-7 cells Representative images of COS-7 cells expressing DsRed2::2L and GeC2,6::GFP under control conditions (Aa), after short-term PDBu treatment (30 min, 1 µM; Ab) and after combined PDBu and CC treatment (30 min, 1 µM and 2 µM; Ac). Arrowhead in Ab refers to the presumed plasma membrane location of both GABAAR DsRed2::2L and GeC2,6::GFP in the case of PDBu treatment. Arrows indicate the incidence of small gephyrin spots, which occur in addition to the aggregates usually observed. B, histogram illustrating the effect of PDBu treatment on the fraction of gephyrin aggregates colocalized with GABAAR 2L. C, fraction of cotransfected COS-7 cells displaying the indicated subcellular gephyrin localization. D, projection area of gephyrin aggregates under the given experimental conditions. CC, 2 µM chelerythrine chloride; and PM, presumed plasma membrane. The number of analysed COS-7 cells (n) was 30 in each case, 3 independent experiments. Scale bars: 10 µm; high-power views, 3.2 µm.

	Discussion

Top Abstract Introduction Methods Results Discussion References

Here we chose the large cytoplasmic loops of the GABA_AR 2S- and 2L-subunits: (i) to characterize their individual binding efficacy to the postsynaptic proteome; and (ii) to rule out side-effects, such as phosphorylation-induced alterations in the cycling rate of full-length GABA_ARs between cell surface and intracellular compartments (Kittler et al. 2000). We obtained evidence that the GFP-tagged large cytoplasmic loop of the GABA_AR 2L-subunit accumulates at inhibitory postsynaptic sites with significantly higher efficacy than the GABA_AR 2S loop. This difference was even more pronounced after short-term PKC activation. The fact that postsynaptic GABA_AR 2L loop accumulation was sensitive to the PKC antagonist chelerythrine chloride even in the absence of PDBu suggests that a basal level of PKC activity may be required for postsynaptic GABA_AR localization.

That PKC-mediated phosphorylation has profound effects on inhibitory synaptic transmission has been shown before (Brandon et al. 1999, 2000, 2002; Henneberger et al. 2002; Meier et al. 2003), but it is new that elimination of the PKC phosphorylation site Ser343 in 2L loops affects the cellular distribution of this loop to resemble that of 2S. Therefore, we have evidence to propose that the relative amount of 2S and 2L isoforms and the phosphorylation status of Ser343 are critical for the control of GABA_AR access to inhibitory postsynaptic sites.

Postsynaptic GABA_AR stabilization requires gephyrin, and this conclusion has been confirmed in GABA_AR 2-gene-depletion experiments (Essrich et al. 1998; Schweizer et al. 2003). However, a direct interaction of purified GABA_AR preparations with gephyrin has not been demonstrated (Meyer et al. 1995; Kannenberg et al. 1997). Our finding that in non-neuronal cells, a widely used assay system (Kirsch et al. 1995; Kins et al. 1999, 2000; Kneussel et al. 1999, 2000; Grosskreutz et al. 2001), recruitment of GABA_AR 2L loops to intracellular gephyrin aggregates required PKC activation provides a possible explanation for this failure. Nonetheless, a number of questions still need to be answered. (i) Is the association of the GABA_AR 2L loop with gephyrin related to phosphorylation-induced changes in gephyrin? (ii) Does recruitment of gephyrin to the plasma membrane depend on the phosphorylation of gephyrin, or the GABA_AR 2L loop, or both? (iii) Is the association of gephyrin and GABA_AR 2L a prerequisite for their targeting to the plasma membrane?

It has been shown that gephyrin is a phosphoprotein (Langosch et al. 1992). However, it seems unlikely that the phosphorylation status of gephyrin contributes to the regulation of GABA_AR binding, since the kinase that phosphorylates gephyrin is endogenous to highly purified GlyR preparations (Langosch et al. 1992). As for question (ii), a recent study on intracellular GlyR trafficking identified GlyR binding to gephyrin as an important determinant for their membrane delivery (Hanus et al. 2004). It is conceivable that the association of the GABA_AR 2L-subunit with gephyrin, which is facilitated upon PKC activation, plays a similar role (Studler et al. 2004) by providing a permissive conformation of gephyrin or the GABA_AR 2L-subunit. (iii) Collybistin and GABARAP also contribute to the regulation of receptor delivery to the postsynaptic membrane (Kins et al. 2000; Kittler et al. 2001a). Therefore, other proteins, including yet unknown phosphoproteins, need still to be considered in the GABA_AR trafficking to and anchoring at the postsynaptic plasma membrane.

Our results may be considered provocative because there is previous evidence that under some experimental conditions GABA_AR 2S and 2L can substitute for each other (Homanics et al. 1999; Baer et al. 2000). However, considering that those conclusions were drawn from rescue experiments on the genetic background of GABA_AR 2-gene deficiency (Homanics et al. 1999; Baer et al. 2000), it may well be that GABA_AR 2S-subunits were only functional because there was no GABA_AR 2L to compete with GABA_AR 2S for gephyrin binding sites.

Our experiments revealed that in comparison with the 2S loop the isolated GABA_AR 2L loop displayed a higher efficacy of postsynaptic accumulation. However, this does not preclude a certain contribution of GABA_AR 2S to postsynaptic anchoring. In our experiments with neuronal cultures the transfected neurones continued to express endogenous GABA_AR 2S- and 2L-subunits, which then competed with the transfected loops. This might have resulted in a competitive disadvantage for the GABA_AR 2S loops.

The relative significance of GABA_AR 2L may in addition be age dependent. It is known that during development GABA_AR 2L is up-regulated to become the predominant isoform in mature GABAergic synapses (Wang & Burt, 1991; Poulter et al. 1993; Roberts & Kellogg, 2000). This underscores the physiological relevance of the additional LLRMFSFK sequence in mature CNS structures. However, at earlier developmental stages, or under specific experimental conditions, postsynaptic GABA_AR accumulation may be enabled by other GABA_AR subunits. For example, the GABA_AR 3-subunit was shown to substitute for the missing GABA_AR 2 (Baer et al. 1999). Triller and colleagues demonstrated that in hippocampal cultures GABA_AR ß3-subunits formed postsynaptic clusters at gephyrin-containing inhibitory synapses before 2-subunits were recruited to inhibitory synapses (Danglot et al. 2003). In embryonic collicular slices, which still lacked the GABA_AR 2L isoform, postsynaptic GABA_AR stabilization was also enhanced after activation of PKC (Meier et al. 2003).

This issue remains attractive because there is increasing evidence that a disturbance of the 2S–2L balance correlates with disease. During the past 30 years, extensive efforts have been made to gain more information about the mechanisms underlying schizophrenia. Multiple alterations at the molecular level have been described, including a decrease in the expression level of the GABA transporter GAT1, the GABA synthesizing enzyme GAD67 and the tissue GABA content (Volk & Lewis, 2002; Volk et al. 2002; Lewis et al. 2004). Today, the deficient GABA neurotransmission within the prefrontal cortex is considered to contribute to schizophrenia. In this context, it is particularly interesting that schizophrenic persons displayed altered expression levels of various GABA_AR subunits, including a predominance of GABA_AR 2L over 2S transcript levels in the prefrontal cortex (Huntsman et al. 1998) and an increase in the expression of GABA_AR 2 (Volk et al. 2002). An altered relationship between GABA release and postsynaptic GABA_AR density may reflect a compensatory process aimed at keeping GABAergic transmission at a safe level. In any case, these clinical findings, along with our results and developmental studies (Wang & Burt, 1991; Poulter et al. 1993; Roberts & Kellogg, 2000), underline the important role of the GABA_AR 2L-subunit in activity-related synaptic reorganization.

	References

Top Abstract Introduction Methods Results Discussion References

 
Baer K, Essrich C, Balsiger S, Wick MJ, Harris RA, Fritschy JM & Luscher B (2000). Rescue of 2 subunit-deficient mice by transgenic overexpression of the GABA_A receptor 2S or 2L subunit isoforms. Eur J Neurosci 12, 2639–2643.[CrossRef][Medline]

Baer K, Essrich C, Benson JA, Benke D, Bluethmann H, Fritschy JM & Luscher B (1999). Postsynaptic clustering of -aminobutyric acid type A receptors by the 3 subunit in vivo. Proc Natl Acad Sci U S A 96, 12860–12865.[Abstract/Free Full Text]

Brandon NJ, Delmas P, Kittler JT, McDonald BJ, Sieghart W, Brown DA, Smart TG & Moss SJ (2000). GABA_A receptor phosphorylation and functional modulation in cortical neurons by a protein kinase C-dependent pathway. J Biol Chem 275, 38856–38862.[Abstract/Free Full Text]

Brandon NJ, Jovanovic JN, Smart TG & Moss SJ (2002). Receptor for activated C kinase-1 facilitates protein kinase C-dependent phosphorylation and functional modulation of GABA(A) receptors with the activation of G-protein-coupled receptors. J Neurosci 22, 6353–6361.[Abstract/Free Full Text]

Brandon NJ, Uren JM, Kittler JT, Wang H, Olsen R, Parker PJ & Moss SJ (1999). Subunit-specific association of protein kinase C and the receptor for activated C kinase with GABA type A receptors. J Neurosci 19, 9228–9234.[Abstract/Free Full Text]

Brewer GJ & Cotman CW (1989). Survival and growth of hippocampal neurons in defined medium at low density: advantages of a sandwich culture technique or low oxygen. Brain Res 494, 65–74.[CrossRef][Medline]

Danglot L, Triller A & Bessis A (2003). Association of gephyrin with synaptic and extrasynaptic GABA(A) receptors varies during development in cultured hippocampal neurons. Mol Cell Neurosci 23, 264–278.1016/S1044-7431(03)00069-1[CrossRef][Medline]

Dumoulin A, Rostaing P, Bedet C, Levi S, Isambert MF, Henry JP, Triller A & Gasnier B (1999). Presence of the vesicular inhibitory amino acid transporter in GABAergic and glycinergic synaptic terminal boutons. J Cell Sci 112, 811–823.[Abstract]

Essrich C, Lorez M, Benson JA, Fritschy JM & Luscher B (1998). Postsynaptic clustering of major GABA_A receptor subtypes requires the 2 subunit and gephyrin. Nat Neurosci 1, 563–571.1038/2798[CrossRef][Medline]

Fritschy JM & Mohler H (1995). GABA_A-receptor heterogeneity in the adult rat brain: differential regional and cellular distribution of seven major subunits. J Comp Neurol 359, 154–194.[CrossRef][Medline]

Grosskreutz Y, Hermann A, Kins S, Fuhrmann JC, Betz H & Kneussel M (2001). Identification of a gephyrin-binding motif in the GDP/GTP exchange factor collybistin. Biol Chem 382, 1455–1462.[CrossRef][Medline]

Hanus C, Vannier C & Triller A (2004). Intracellular association of glycine receptor with gephyrin increases its plasma membrane accumulation rate. J Neurosci 24, 1119–1128.1523/JNEUROSCI.4380-03.2004[Abstract/Free Full Text]

Henneberger C, Jüttner R, Rothe T & Grantyn R (2002). Postsynaptic action of BDNF on GABAergic synaptic transmission in the superficial layers of the mouse superior colliculus. J Neurophysiol 88, 595–603.[Abstract/Free Full Text]

Homanics GE, Harrison NL, Quinlan JJ, Krasowski MD, Rick CE, De Blas AL, Mehta AK, Kist F, Mihalek RM, Aul JJ & Firestone LL (1999). Normal electrophysiological and behavioral responses to ethanol in mice lacking the long splice variant of the 2 subunit of the -aminobutyrate type A receptor. Neuropharmacology 38, 253–265.1016/S0028-3908(98)00177-4[CrossRef][Medline]

Huntsman MM, Tran BV, Potkin SG, Bunney WEJ & Jones EG (1998). Altered ratios of alternatively spliced long and short 2 subunit mRNAs of the -amino butyrate type A receptor in prefrontal cortex of schizophrenics. Proc Natl Acad Sci U S A 95, 15066–15071.1073/pnas.95.25.15066[Abstract/Free Full Text]

Kannenberg K, Baur R & Sigel E (1997). Proteins associated with 1-subunit-containing GABA_A receptors from bovine brain. J Neurochem 68, 1352–1360.[Medline]

Kins S, Betz H & Kirsch J (2000). Collybistin, a newly identified brain-specific GEF, induces submembrane clustering of gephyrin. Nat Neurosci 3, 22–29.[CrossRef][Medline]

Kins S, Kuhse J, Laube B, Betz H & Kirsch J (1999). Incorporation of a gephyrin-binding motif targets NMDA receptors to gephyrin-rich domains in HEK 293 cells. Eur J Neurosci 11, 740–744.1046/j.1460-9568.1999.00527.x[CrossRef][Medline]

Kirsch J, Kuhse J & Betz H (1995). Targeting of glycine receptor subunits to gephyrin-rich domains in transfected human embryonic kidney cells. Mol Cell Neurosci 6, 450–461.[CrossRef][Medline]

Kittler JT, Delmas P, Jovanovic JN, Brown DA, Smart TG & Moss SJ (2000). Constitutive endocytosis of GABA_A receptors by an association with the adaptin AP2 complex modulates inhibitory synaptic currents in hippocampal neurons. J Neurosci 20, 7972–7977.[Abstract/Free Full Text]

Kittler JT & Moss SJ (2001). Neurotransmitter receptor trafficking and the regulation of synaptic strength. Traffic 2, 437–448.1034/j.1600-0854.2001.20702.x[CrossRef][Medline]

Kittler JT & Moss SJ (2003). Modulation of GABA(A) receptor activity by phosphorylation and receptor trafficking: implications for the efficacy of synaptic inhibition. Curr Opin Neurobiol 13, 341–347.1016/S0959-4388(03)00064-3[CrossRef][Medline]

Kittler JT, Rostaing P, Schiavo G, Fritschy JM, Olsen R, Triller A & Moss SJ (2001a). The subcellular distribution of GABARAP and its ability to interact with NSF suggest a role for this protein in the intracellular transport of GABA_A receptors. Mol Cell Neurosci 18, 13–25.1006/mcne.2001.1005[CrossRef][Medline]

Kittler JT, Wang J, Connolly CN, Vicini S, Smart TG & Moss SJ (2001b). Analysis of GABA_A receptor assembly in mammalian cell lines and hippocampal neurons using 2 subunit green fluorescent protein chimeras. Mol Cell Neurosci 16, 440–452.10.1006/mcne.2000.0882[CrossRef]

Kneussel M, Haverkamp S, Fuhrmann JC, Wang H, Wassle H, Olsen RW & Betz H (2000). The -aminobutyric acid type A receptor (GABAAR)-associated protein GABARAP interacts with gephyrin but is not involved in receptor anchoring at the synapse. Proc Natl Acad Sci U S A 97, 8594–8599.1073/pnas.97.15.8594[Abstract/Free Full Text]

Kneussel M, Hermann A, Kirsch J & Betz H (1999). Hydrophobic interactions mediate binding of the glycine receptor ß-subunit to gephyrin. J Neurochem 72, 1323–1326.1046/j.1471-4159.1999.0721323.x[CrossRef][Medline]

Krishek BJ, Xie X, Blackstone C, Huganir RL, Moss SJ & Smart TG (1994). Regulation of GABA_A receptor function by protein kinase C phosphorylation. Neuron 12, 1081–1095.1016/0896-6273(94)90316-6[CrossRef][Medline]

Langosch D, Hoch W & Betz H (1992). The 93 kDa protein gephyrin and tubulin associated with the inhibitory glycine receptor are phosphorylated by an endogenous protein kinase. FEBS Lett 298, 113–117.1016/0014-5793(92)80034-E[CrossRef][Medline]

Lewis DA, Volk DW & Hashimoto T (2003). Selective alterations in prefrontal cortical GABA neurotransmission in schizophrenia: a novel target for the treatment of working memory dysfunction. Psychopharmacology (Berl) 174, 143–150.[Medline]

Llopis J, McCaffery JM, Miyawaki A, Farquhar MG & Tsien RY (1998). Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins. Proc Natl Acad Sci U S A 95, 6803–6808.1073/pnas.95.12.6803[Abstract/Free Full Text]

Machu TK, Firestone JA & Browning MD (1993). Ca²⁺/calmodulin-dependent protein kinase II and protein kinase C phosphorylate a synthetic peptide corresponding to a sequence that is specific for the 2L subunit of the GABA_A receptor. J Neurochem 61, 375–377.[Medline]

Meier J, Akyeli J, Kirischuk S & Grantyn R (2003). GABA_A receptor activity and PKC control inhibitory synaptogenesis in CNS tissue slices. Mol Cell Neurosci 23, 600–613.1016/S1044-7431(03)00079-4[CrossRef][Medline]

Meier J, De Chaldee M, Triller A & Vannier C (2000). Functional heterogeneity of gephyrins. Mol Cell Neurosci 16, 566–577.1006/mcne.2000.0899[CrossRef][Medline]

Meier J & Grantyn R (2004). A gephyrin-related mechanism restraining glycine receptor anchoring at GABAergic synapses. J Neurosci 24, 1398–1405.1523/JNEUROSCI.4260-03.2004[Abstract/Free Full Text]

Meier J, Jüttner R, Kirischuk S & Grantyn R (2002). Synaptic anchoring of glycine receptors in developing collicular neurons under control of metabotropic glutamate receptor activity. Mol Cell Neurosci 21, 324–340.1006/mcne.2002.1161[CrossRef][Medline]

Meyer G, Kirsch J, Betz H & Langosch D (1995). Identification of a gephyrin binding motif on the glycine receptor ß subunit. Neuron 15, 563–572.1016/0896-6273(95)90145-0[CrossRef][Medline]

Moss SJ, Doherty CA & Huganir RL (1992). Identification of the cAMP-dependent protein kinase and protein kinase C phosphorylation sites within the major intracellular domains of the ß1, 2S, and 2L subunits of the -aminobutyric acid type A receptor. J Biol Chem 267, 14470–14476.[Abstract/Free Full Text]

Moss SJ & Smart TG (2001). Constructing inhibitory synapses. Nat Rev Neurosci 2, 240–250.1038/35067500[Medline]

Pfeiffer F, Simler R, Grenningloh G & Betz H (1984). Monoclonal antibodies and peptide mapping reveal structural similarities between the subunits of the glycine receptor of rat spinal cord. Proc Natl Acad Sci U S A 81, 7224–7227.[Abstract/Free Full Text]

Poulter MO, Barker JL, O'Carroll AM, Lolait SJ & Mahan LC (1993). Co-existent expression of GABA_A receptor ß2, ß3 and 2 subunit messenger RNAs during embryogenesis and early postnatal development of the rat central nervous system. Neurosci 53, 1019–1033.10.1016/0306-4522(93)90486-Y[CrossRef][Medline]

Prior P, Schmitt B, Grenningloh G, Pribilla I, Multhaup G, Beyreuther K, Maulet Y, Werner P, Langosch D & Kirsch J (1992). Primary structure and alternative splice variants of gephyrin, a putative glycine receptor-tubulin linker protein. Neuron 8, 1161–1170.[CrossRef][Medline]

Roberts AA & Kellogg CK (2000). Synchronous postnatal increase in 1 and 2L GABA_A receptor mRNAs and high affinity zolpidem binding across three regions of rat brain. Brain Res Dev Brain Res 119, 21–32.[CrossRef][Medline]

Schweizer C, Balsiger S, Bluethmann H, Mansuy IM, Fritschy JM, Mohler H & Luscher B (2003). The 2 subunit of GABA(A) receptors is required for maintenance of receptors at mature synapses. Mol Cell Neurosci 24, 442–450.1016/S1044-7431(03)00202-1[CrossRef][Medline]

Studler B, Sidler C & Fritschy JM (2004). Differential regulation of GABA_A receptor and gephyrin postsynaptic clustering in immature hippocampal neuronal cultures. FENS Abstract 2, A080.14.

Volk DW & Lewis DA (2002). Impaired prefrontal inhibition in schizophrenia: relevance for cognitive dysfunction. Physiol Behav 77, 501–505.1016/S0031-9384(02)00936-8[CrossRef][Medline]

Volk DW, Pierri JN, Fritschy JM, Auh S, Sampson AR & Lewis DA (2002). Reciprocal alterations in pre- and postsynaptic inhibitory markers at chandelier cell inputs to pyramidal neurons in schizophrenia. Cereb Cortex 12, 1063–1070.1093/cercor/12.10.1063[Abstract/Free Full Text]

Wang JB & Burt DR (1991). Differential expression of two forms of GABA_A receptor 2-subunit in mice. Brain Res Bull 27, 731–735.1016/0361-9230(91)90054-N[CrossRef][Medline]

Wang J, Liu S, Haditsch U, Tu W, Cochrane K, Ahmadian G, Tran L, Paw J, Wang Y, Mansuy I, Salter MM & Lu Y (2003). Interaction of calcineurin and type-A GABA receptor 2 subunits produces long-term depression at CA1 inhibitory synapses. J Neurosci 23, 826–836.[Abstract/Free Full Text]

Whiting P, McKernan RM & Iversen LL (1990). Another mechanism for creating diversity in -aminobutyrate type A receptors: RNA splicing directs expression of two forms of 2 phosphorylation site. Proc Natl Acad Sci U S A 87, 9966–9970.[Abstract/Free Full Text]

	Acknowledgements

 
We thank U. Neumann for excellent technical assistance. Dr J.-M. Fritschy generously provided the GABA_AR 2 antibody. This work was supported by the Deutsche Forschungsgemeinschaft (grant SFB 515 B2 to R.G.).

This article has been cited by other articles:

				K. Mizuta, D. Xu, Y. Pan, G. Comas, J. R. Sonett, Y. Zhang, R. A. Panettieri Jr., J. Yang, and C. W. Emala Sr. GABAA receptors are expressed and facilitate relaxation in airway smooth muscle Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1206 - L1216. [Abstract] [Full Text] [PDF]

				G. G. Leparc and R. D. Mitra Non-EST-based prediction of novel alternatively spliced cassette exons with cell signaling function in Caenorhabditis elegans and human Nucleic Acids Res., May 11, 2007; 35(10): 3192 - 3202. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 559/2/355    most recent jphysiol.2004.066233v2 jphysiol.2004.066233v1 Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Meier, J. Articles by Grantyn, R. Search for Related Content PubMed PubMed Citation