| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
School of Biomedical Sciences, University of Leeds, Leeds LS2 9JT, UK
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
(Received 26 March 2004;
accepted after revision 9 July 2004;
first published online 14 July 2004)
Corresponding author D. J. Beech: School of Biomedical Sciences, University of Leeds, Leeds LS2 9JT, UK.Email: d.j.beech{at}leeds.ac.uk
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The human TRPC5 gene was cloned as part of a survey of a region of the X chromosome associated with non-syndromic mental retardation (Sossey-Alaoui et al. 1999). The reading frame of the gene has only been published as fragments of the genomic sequence and the functional properties are unknown. However rabbit TRPC5 is closely related (99% identity at the amino acid level) and a single report suggests it is a store-operated Ca2+ permeable channel (Philipp et al. 1998). Mouse TRPC5, which is 97% identical to human TRPC5, has been studied more extensively and is described as lacking store-operated properties (Okada et al. 1998; Schaefer et al. 2000; Kanki et al. 2001; Strubing et al. 2001; Venkatachalam et al. 2003). Instead it shows clear activation following receptor activation (e.g. muscarinic or histamine receptors) (Plant & Schaefer, 2003). In this study we cloned the reading frame of human TRPC5 and produced stable tetracycline-inducible expression in HEK293 cells. We focused on the functional properties of human TRPC5 and in particular on the activation mechanisms and on whether there is a relationship between store depletion and the function of human TRPC5.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Full length human TRPC5 cDNA was cloned from plasmids 6A1 and 2B11 containing two overlapping TRPC5 fragments (gifts from AK Srivastava) (Sossey-Alaoui et al. 1999). Primers (5'–3') TATCGGTACCGCCACCATGGCCCCACTGTACTAC (i) and TTGATGAACAGCCCAAGG (iii) were used to amplify the N-terminal fragment of TRPC5 DNA from 6A1. Primers CCATTGGGTTCCTGTTTC (ii) and ATTATCTCGAGTTAGAGGCGAGTTGTAAC (iv) were used to amplify the C-terminal fragment of hTRPC5 DNA from 2B11. The two overlapping DNA fragments were mixed and amplified again using primers (i) and (iv) to generate the full reading frame of human TRPC5 DNA, which was subsequentially subcloned into kpn I and xho I sites of pcDNA4/TO vector (Invitrogen). When hTRPC5/pcDNA4/TO was sequenced and compared with TRPC5 accession number AF054568, a point mutation was evident (G1363A). Therefore, the corresponding TRPC5 fragment was amplified by RT-PCR from human saphenous vein total RNA. Sequencing revealed alanine at position 1363. Direct sequencing from 6A1 confirmed the result.
Cell culture and stable transfection
HEK293 cells stably expressing Tet repressor from the pcDNA6/TR plasmid (T-REx 293 cell line, Invitrogen) were grown in Dulbecco's modified Eagle's medium-F12 media (Invitrogen) supplemented with 10% fetal bovine serum and penicillin (50 units ml–1) and streptomycin (0.5 mg ml–1) at 37°C in a 5% CO2 incubator. hTRPC5/pcDNA4 was transfected into TREx cells using lipofectamine 2000 reagent (Invitrogen). Cells stably expressing TRPC5 were selected by 5 µg ml–1 blasticidin and 400 µg ml–1 zeocin (Invitrogen). When applicable, cells were incubated with tetracycline (1 µg ml–1) for 24 h to induce the expression of TRPC5. Twenty-eight clones were maintained and screened for TRPC5 expression.
Ca2+ imaging
Cells were pre-incubated with 1 µM of the acetoxmethyl ester of the fluorescent Ca2+ indicator fura PE3 (fura PE3-AM; Calbiochem) at 37°C for 1 h in standard bath solution (see below), followed by a 30 min wash period room temperature. Recordings were made alternately from test and control cells.
Fluorescence was observed with an inverted microscope (Zeiss, Martinsried, Germany), and a xenon arc lamp provided excitation light, the wavelength of which was selected by a monochromator (Till Photonics, Gräfelfing, Germany). Experiments were performed at room temperature, and emission was collected via a 510-nm filter and sampled by a CCD camera (Orca ER; Hamamatsu, Japan). Images were sampled every 10 s in pairs for the two excitation wavelengths (340 and 380 nm) and analysed off-line using regions of interest to select individual cells. [Ca2+]i is expressed as the ratio of the emission intensities for 340 and 380 nm (R340/380). Imaging was controlled by Openlab 2 software (Image Processing & Vision Company Ltd, UK). Standard bath solution contained (mM): NaCl 130, KCl 5, D-glucose 8, Hepes 10, MgCl21.2, CaCl2 1.5; pH was titrated to 7.4 with NaOH. Ca2+-free solution was standard bath solution in which the CaCl2 was omitted. In some experiments, 0.4 mM EGTA was included in this solution, as indicated in figure legends.
Electrophysiology
Voltage clamp was performed at room temperature (23–26°C) with the whole-cell patch configuration. Signals were amplified with an Axopatch 200 A patch clamp amplifier and controlled with pClamp software 6.0 (Axon). Patch pipettes were made from borosilicate glass capillary tubing with an outside diameter of 1 mm (Clark Electromedical Instruments, Reading, UK). After fire-polishing and filling with pipette solution, the resistance was 3–5 M
. Signals were sampled at 3 kHz and filtered at 1 kHz. For the experiments shown in Figs 1E and F, 3 and 5C and D, the Ca2+-containing, Cs+-containing patch pipette solution contained (mM): CsCl 130, EGTA 10, MgCl2 2, Hepes 10, Na2ATP 5, CaCl2 5.7; pH was titrated to 7.2 with CsOH and osmolarity was 290 mOsm. For Ca2+-free pipette solution CaCl2 was omitted and EGTA reduced to 1 mM. The unbound Mg2+ and Mg.ATP concentrations of these two pipette solutions were 105 µM and 1.86 mM (Ca2+-containing) and 106 µM and 1.88 mM (Ca2+-free), respectively. The recording chamber had a volume of 150 µl and superfusion was continuous at 2 ml min–1.
|
|
|
|
HEK-TRPC5 cells were grown on 100-mm tissue culture dishes. The cell monolayer was washed once with phosphate-buffered saline (PBS) at room temperature and cells removed using 1 ml of chilled PBS supplemented with a protease inhibitor mixture (Sigma). The cells were pelleted at 4°C and then lysed at 4°C for 30 min using 1 ml of lysis buffer (10 mM Tris/HCl, 100 mM NaCl, 10 mM EDTA, 0.5% NP-40 and 0.5% sodium deoxycholate; pH 7.8), supplemented with protease inhibitor mixture. The lysate was centrifuged at 10 000 g for 5 min and the supernatant (approximately 40 µg total protein) run on an 8% SDS-PAGE gel before being transferred to HybondTM-P (polyvinylidene difluoride) membrane (Amersham). Immunoblots were probed with a rabbit polyclonal anti-TRPC5 antibody (T5C3) generated against the peptide CKLLDSSEDVFETWGE.
Real-time RT-PCR
Total RNA was extracted using Tri Reagent and subjected to DNase I digestion (Ambion). RNA (1 µg) was reverse transcribed using enhanced avian myeloblastosis virus (AMV) (Sigma) and Oligo(dT15) primer. Genomic DNA was controlled for by omitting reverse transcriptase. DNA was quantified using the Roche Lightcycler II system and SYBR Green I. DNA was amplified using the following protocol for 30 cycles: 10 min hotstart at 95°C; 10 s at 95°C, 6 s at 55°C, and 14 s at 72°C. PCR primers (5'–3') were: GTCATCAAGCAAACGCT (forward) and AGGCTAGAGGGCATTC (reverse). Crossing points (Cp) were determined using fit-points methodology (Lightcycler software 3.5) and RNA relative abundance calculated using 2 Cp (TRPC5)/2 Cp (ß–actin).
Data analysis
Data sets are expressed as mean ±S.E.M. for n cells. For each set of experiments n indicates the number of individual cells analysed. The number of individual recordings (coverslips) is given in parentheses. Statistical comparisons were made using unpaired Students t test with a probability P < 0.05 indicating a significant difference.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Receptor activation of human TRPC5
Ca2+ imaging was used to explore activation of TRPC5 by stimulation of endogenous muscarinic receptors with carbachol. Induction of TRPC5 increased the amplitude of the carbachol response and made it more sustained (Fig. 1C). The response in non-induced cells was transient and abolished by pre-treatment with thapsigargin (Tg), an inhibitor of the sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA) but not plasma membrane Ca2+ ATPase (PMCA) (Thastrup et al. 1990; Kennedy & Mangini, 1996) (Fig. 1D). This indicates that the transient response was entirely due to Ca2+-release from intracellular stores. In contrast, thapsigargin failed to prevent the sustained carbachol-induced response in TRPC5-induced cells (Fig. 1D). Carbachol also activated TRPC5 in whole-cell patch-clamp recordings from cells treated with thapsigargin (Fig. 1E and F). The current–voltage relationship was curved and reversal of polarity occurred between 0 and –10 mV (see also Figs 2 and 5). The complex shape of the relationship may be caused by Mg2+ block, as indicated for mouse TRPC5 (Schaefer et al. 2000). In summary, these data indicate that one activator of TRPC5 comes from a component of the muscarinic signalling cascade other than Ca2+ release. This is ‘receptor activation’.
External ionic activation
Lanthanides such as Gd3+ potentiate receptor-activated mouse TRPC5 (Jung et al. 2003; Plant & Schaefer, 2003). However, a striking feature of human TRPC5 is that Gd3+ stimulates in the complete absence of exogenous receptor activation (Fig. 2A and B). Gd3+ did not evoke Ca2+ release, had no effect in non-induced cells (Fig. 2A) and was effective at inducing TRPC5-mediated current in whole-cell recordings with 1 mM GDP-ß-S in the patch pipette (n= 3, data not shown). Therefore, Gd3+ was not acting as an agonist at G-protein-coupled receptors and had an effect that was distinct from that of carbachol. Basal activity of TRPC5 was not detectable by Ca2+ imaging (Figs 2C and 4D) and so Gd3+ was presumably not enhancing spontaneous activity. Changing the bath Ca2+ concentration from 0.1 to 1.5 mM had no effect, but 5–10 mM Ca2+ was a powerful stimulant (Fig. 2D–F). With strong buffering of
|
Intracellular Ca2+ activation
A modest elevation of intracellular Ca2+ to 200 nM has been shown to stimulate mouse TRPC5 (Okada et al. 1998; Strubing et al. 2001; Plant & Schaefer, 2003). This effect is also observed in human TRPC5 in the absence of GTP in the patch pipette or receptor stimulation (Fig. 3). This is ‘Ca2+ activation’.
Store-operated properties of human TRPC5
To investigate whether human TRPC5 has store-operated properties we employed a standard protocol in which Ca2+ stores were first depleted by treatment of cells with thapsigargin in Ca2+-free solution. Extracellular Ca2+ was then added back to observe the ‘store-operated’ Ca2+-re-entry signal. In the first set of experiments we used 3 mM Ca2+, as previously described (Philipp et al. 1998). Because of a substantial endogenous store-operated mechanism, the Ca2+-re-entry signal was large in non-induced cells (Fig. 4A). Induction of TRPC5 expression led to a slight elevation of the plateau phase of the re-entry signal (Fig. 4A). In the absence of store-depletion, the signals were much smaller and there was no effect of TRPC5 (Fig. 4B). The possible effect of TRPC5 shown in Fig. 4A is obviously complicated by a large endogenous signal and there is also some risk of ‘external ionic activation’ because of the high (3 mM) Ca2+o concentration employed. Therefore, we reduced the bath Ca2+ concentration to 1.5 mM and suppressed the endogenous signal with 10 µM Gd3+, a potent inhibitor of native store-operated channels in HEK293 cells (Luo et al. 2001). EGTA was not included because it binds Gd3+ with high affinity. This revised protocol led to a reduction in the endogenous signal by > 95%, whereas the TRPC5 signal was about 6 times larger (Fig. 4C cf. Fig. 4A). The TRPC5 signal depended on pre-treatment with thapsigargin (Fig. 4C cf. Fig. 4D) and did not result from ‘external ionic activation’ because 10 µM Gd3+ alone was insufficient to evoke a fura-PE3 signal (Fig. 4D). Nevertheless, it would seem that 10 µM Gd3+ potentiated (and certainly did not inhibit) the TRPC5 signal – arguing against Ca2+ activation via Ca2+ entry through endogenous channels being the cause of the store-operated properties of TRPC5.
The data in Fig. 4C can be used to argue against Ca2+ activation as the explanation for store-operated properties of TRPC5 but not to exclude this possibility. Therefore, we developed a protocol for studying Ba2+ entry through TRPC5 because Ba2+ is a poor substitute for Ca2+ in the Ca2+-dependent regulation of other ion channels (Wiser et al. 2002; McHugh et al. 2003). The results were striking: in TRPC5-induced cells, store depletion markedly enhanced the Ba2+ entry, whereas without store depletion there was no effect of TRPC5 (Fig. 5A cf. Fig. 5B). Therefore, store-depletion induced TRPC5 activity in the absence of Ca2+. Intriguingly, 0.1 mM Gd3+ was ineffective as a direct activator of TRPC5 in the presence of 0.5 mM Ba2+ rather than 1.5 mM Ca2+ (Fig. 5B cf. Fig. 2A). To further address the role of Ca2+ activation we performed whole-cell patch-clamp recordings with [Ca2+]i buffered to 200 nM via the patch pipette. This caused tonic Ca2+ activation of TRPC5 but store depletion evoked additional current that was significantly larger in Tet-induced (tet+) compared with control (tet–) cells (P < 0.05, n= 6 for each group) (Fig. 5C). In the tet+ cells only, the induced current had a current–voltage relationship that was characteristic of TRPC5 (Fig. 5D cf. Plant & Schaefer, 2003). Therefore, although TRPC5 is a Ca2+-dependent channel its store-operated properties do not seem to be explained by Ca2+ activation.
Multiplicity of activation in single HEK293 cells
Based on the above data we suggest that human TRPC5 is activated by a multiplicity of distinct signals including ‘receptor’, ‘external ionic’, ‘calcium’ and ‘store’. A study of the related TRPC3 protein has previously suggested dual activation (‘store’ and ‘receptor’) but that the channel exists exclusively in one activation mode depending on the level of heterologous expression (Vazquez et al. 2003). The data of Fig. 5C indicate that ‘Ca2+’ and ‘store’ activation occur in the same cell and thus that differing expression levels may not explain the multiplicity. To explore this further we used Ca2+ imaging to test different activation signals on isolated cells, and thus on the single expression levels of these cells (Fig. 6). The TRPC5-dependent ‘store-operated’ Ca2+-re-entry signal and ‘receptor activation’ both occurred in a single cell (Fig. 6A–D), as did ‘external ionic’ and ‘receptor’ activation (Fig. 6E and F). Analysis of 43 isolated cells in 10 independent experiments revealed that 26 (60.5%) had store- and receptor-operated signals, 12 (27.9%) showed only a store-operated response, and five (11.6%) only a receptor-operated response. Despite complete depletion of carbachol-sensitive Ca2+ stores (Fig. 1D), activation of TRPC5 by store depletion was less efficacious than receptor activation. Analysis of all the cells that gave both types of response showed that the store-operated Ca2+-re-entry signal was 44.84% of the maximum response observed once carbachol had been applied (e.g. Fig. 6D). Gd3+ is not less efficacious but was used at a low concentration (cf. Fig. 2A) to avoid maximal activation prior to application of carbachol.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
‘Receptor activation’ of TRPC5 has been studied extensively for mouse TRPC5 but the signal transduction mechanism remains incompletely understood. A G-protein is involved and U73122 inhibits the response (Kanki et al. 2001; Plant & Schaefer, 2003). The latter indicates a requirement for a phospholipase C but we do not know if a product of phosphateidyl inositol 4,5-bisphosphate is the signal activating TRPC5. Diacyglycerols have no effect on TRPC5, or inhibit it (Hofmann et al. 1999; Schaefer et al. 2000; Venkatachalam et al. 2003). A dependence on inositol 1,4,5-trisphosphate (IP3) receptor function has been proposed but several investigators find no effect of IP3 or IP3 receptors (Kanki et al. 2001; Strubing et al. 2001; Venkatachalam et al. 2003). Perhaps it is surprising that protein kinase C inhibits TRPC5, an effect that will counter the overall activation produced by muscarinic agonists. Ca2+-release from intracellular stores is an unlikely trigger underlying ‘receptor activation’ because there is agreement that depletion of Ca2+ stores does not prevent the response (Fig. 1D) (Schaefer et al. 2000). The TRPC5 channels are nevertheless Ca2+-dependent and thus Ca2+ release might facilitate activation. As with receptor activation, the mechanism of Ca2+ activation is unknown. TRPC5 interacts with calmodulin but the function of calmodulin is that of negative-feedback transducer in other TRPCs (Tang et al. 2001; Singh et al. 2002). ‘External ionic activation’ would seem to result from direct external binding of ions such as Gd3+ and Ca2+ to the outer vestibule of the channel (Jung et al. 2003). Previously this has been seen as a facilitator or potentiator in the context of activation via G-protein-coupled receptors, but our data indicate a direct activation mechanism because the effect occurred without receptor/G-protein activation and we could not detect tonic activity that would be necessary if Gd3+ is purely a facilitator. Synergism between the effects of different activators nevertheless seems likely and is indicated by some of our data.
‘Store operation’ of channels and the link with TRP is debated (Venkatachalam et al. 2002; Zitt et al. 2002; Beech et al. 2003; Clapham, 2003; Nilius, 2003). The implication of the term ‘store operated’ is that the channel is activated by a signal transmitted from depleted intracellular Ca2+ stores. Of course many channels are activated by a signal from stores and that signal is Ca2+, but this is usually a transient signal and not thought to be the long-lasting messenger mediating activation of store-operated Ca2+ channels. We sought to determine whether human TRPC5 simply possesses store-operated properties as studied by a standard Ca2+-re-entry protocol after store depletion (Vazquez et al. 2003). In the absence of Gd3+, TRPC5 slightly enhanced an already large endogenous store-operated Ca2+-entry signal – weak evidence of store-operated properties intrinsic to TRPC5. However, in the presence of Gd3+ the result was striking, human TRPC5 having clear store-operated properties (Fig. 4C). This experimental manoeuvre may be the primary factor underlying the difference between our data and that in previous studies of TRPC5 (see below). The store-operated properties are unlikely to be explained by Ca2+ activation because they occurred when thapsigargin prevented any further Ca2+ release and endogenous Ca2+ entry was strongly suppressed (Figs 4C and 5A), extracellular Ca2+ was replaced by Ba2+ (Fig. 5A) and intracellular Ca2+ was buffered by EGTA (Fig. 5C). However, proof that a distinct signal exists between stores and TRPC5, and the identity of such a signal, remains unclear. TRPC5 has nevertheless been shown to be a binding partner of homer and thus may couple to intracellular stores by ‘conformational coupling’ to the IP3 receptor, as described for TRPC1 (Yuan et al. 2003).
Our finding of ‘store-operated’ properties of human TRPC5 appears to conflict with the absence of such properties in mouse TRPC5 (Okada et al. 1998; Schaefer et al. 2000; Kanki et al. 2001; Strubing et al. 2001; Venkatachalam et al. 2003). Also constitutive activity has been described for mouse TRPC5 (Yamada et al. 2000), whereas it is lacking in human TRPC5. In terms of amino acid sequence, human and rabbit TRPC5 diverge by only about 1%, whereas they diverge from mouse and rat sequences by about 3%. These are relatively small percentage differences but they occur almost exclusively in the C-terminus, a region involved in coupling of Drosophila TRP to stores (Sinkins et al. 1996). Intriguingly, store-operated properties have been described for rabbit TRPC5 (Philipp et al. 1998), the protein most closely related to human TRPC5. Along similar lines, mouse TRPC7 is described as exclusively receptor operated and human TRPC7 as exclusively ‘store operated’ (Okada et al. 1999; Riccio et al. 2002). It is therefore conceivable that TRPC5 function has marked species dependence. Nevertheless, our study differs from previous studies firstly because we employed Gd3+ to suppress endogenous signals and secondly because we show multiplicity of activation in the single cell.
Demonstration of such multiplicity means it is not a matter of store operated or not, or receptor operated or not, but that the channel can have both properties, and more. It may only be the regulatory context of the cell, or a subcompartment of the cell, that shifts the balance between different characteristics. An experimental protocol may further increase the emphasis on one property or another. In about 10% of cells we found that store depletion failed to activate TRPC5 but receptor activation was effective; in about a further 25% there was a response to store depletion but not to receptor activation. This is akin to the proposal for TRPC3, which may be exclusively store- or receptor-operated depending on the expression level (Vazquez et al. 2003). However, in a high number of cells (60%) we find TRPC5 has both properties, and other activation mechanisms are evident. This occurs with the single expression level of a single cell, which tells us that the same channel protein has more than one activation mechanism. This may occur because the same channel exists in different protein signalling complexes within the same cell, or because the same channel signalling complex can respond to different signals.
Conceptually, multiplicity of activation resembles the recent proposal for TRPV4, which is broadly in the same protein family as TRPC5 and about 8% identical (Vriens et al. 2004). The physiological implications of multiplicity of activation are unknown but such a characteristic could enable a channel to act as an integrator of different external signals. Alternatively it might be a means to increase functional diversity without creating new genes: for example, the TRPC5 gene may encode a store-operated channel in the context of one cell type and a receptor-operated channel in another.
In conclusion, we reveal human TRPC5 is susceptible to a multiplicity of activation signals in a single cell. We suggest that, unlike many types of ion channels with a single critical activation mechanism, TRPC5 is a sensor of more than one factor with the capacity to be activated by each in its own right. This would seem to include sensing of Ca2+ handling by the endoplasmic reticulum.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Beech DJ, Xu SZ, McHugh D & Flemming R (2003). TRPC1 store-operated cationic channel subunit. Cell Calcium 33, 433–440.[CrossRef][Medline]
Casteels R & Droogmans G (1981). Exchange characteristics of the noradrenaline-sensitive calcium store in vascular smooth muscle cells or rabbit ear artery. J Physiol 317, 263–279.
Clapham DE (2003). TRP channels as cellular sensors. Nature 426, 517–524.[CrossRef][Medline]
Cui J, Bian JS, Kagan A & McDonald TV (2002). CaT1 contributes to the stores-operated calcium current in Jurkat T-lymphocytes. J Biol Chem 277, 47175–47183.
Hofmann T, Obukhov AG, Schaefer M, Harteneck C, Gudermann T & Schultz G (1999). Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature 397, 259–263.1038/16711[CrossRef][Medline]
Ju YK, Wu MJ, Chaulet H, Marciniec T, Graham RM & Allen DG (2003). IGF-1 enhances a store-operated Ca2+ channel in skeletal muscle myoblasts: involvement of a CD20-like protein. J Cell Physiol 197, 53–60.1002/jcp.10347[CrossRef][Medline]
Jung S, Muhle A, Schaefer M, Strotmann R, Schultz G & Plant TD (2003). Lanthanides potentiate TRPC5 currents by an action at extracellular sites close to the pore mouth. J Biol Chem 278, 3562–3571.1074/jbc.M211484200
Kanki H, Kinoshita M, Akaike A, Satoh M, Mori Y & Kaneko S (2001). Activation of inositol 1,4,5-trisphosphate receptor is essential for the opening of mouse TRP5 channels. Mol Pharmacol 60, 989–998.
Karaki H, Ozaki H, Hori M, Mitsui-Saito M, Amano K, Harada K, Miyamoto S, Nakazawa H, Won KJ & Sato K (1997). Calcium movements, distribution, and functions in smooth muscle. Pharmacol Rev 49, 157–230.
Kennedy BG & Mangini NJ (1996). Plasma membrane calcium-ATPase in cultured human retinal pigment epithelium. Exp Eye Res 63, 547–556.1006/exer.1996.0145[CrossRef][Medline]
Lee N, Chen J, Sun L, Wu S, Gray KR, Rich A, Huang M, Lin JH, Feder JN, Janovitz EB, Levesque PC & Blanar MA (2003). Expression and characterization of human transient receptor potential melastatin 3 (hTRPM3). J Biol Chem 278, 20890–20897.1074/jbc.M211232200
Lewis RS (1999). Store-operated calcium channels. Adv Second Messenger Phosphoprotein Res 33, 279–307.[Medline]
Luo D, Broad LM, Bird GS & Putney JW Jr (2001). Signaling pathways underlying muscarinic receptor-induced [Ca2+]i oscillations in HEK293 cells. J Biol Chem 276, 5613–5621.1074/jbc.M007524200
McHugh D, Flemming R, Xu SZ, Perraud AL & Beech DJ (2003). Critical intracellular Ca2+ dependence of transient receptor potential melastatin 2 (TRPM2) cation channel activation. J Biol Chem 278, 11002–11006.1074/jbc.M210810200
Minke B & Cook B (2002). TRP channel proteins and signal transduction. Physiol Rev 82, 429–472.
Montell C, Birnbaumer L & Flockerzi V (2002a). The TRP channels, a remarkably functional family. Cell 108, 595–598.[CrossRef][Medline]
Montell C, Birnbaumer L, Flockerzi V, Bindels RJ, Bruford EA, Caterina MJ, Clapham DE, Harteneck C, Heller S, Julius D, Kojima I, Mori Y, Penner R, Prawitt D, Scharenberg AM, Schultz G, Shimizu N & Zhu MX (2002b). A unified nomenclature for the superfamily of TRP cation channels. Mol Cell 9, 229–231.1016/S1097-2765(02)00448-3[CrossRef][Medline]
Nilius B (2003). From TRPs to SOCs, CCEs, and CRACs: consensus and controversies. Cell Calcium 33, 293–298.1016/S0143-4160(03)00042-3[CrossRef][Medline]
Okada T, Inoue R, Yamazaki K, Maeda A, Kurosaki T, Yamakuni T, Tanaka I, Shimizu S, Ikenaka K, Imoto K & Mori Y (1999). Molecular and functional characterization of a novel mouse transient receptor potential protein homologue TRP7. Ca2+-permeable cation channel that is constitutively activated and enhanced by stimulation of G protein-coupled receptor. J Biol Chem 274, 27359–27370.1074/jbc.274.39.27359
Okada T, Shimizu S, Wakamori M, Maeda A, Kurosaki T, Takada N, Imoto K & Mori Y (1998). Molecular cloning and functional characterization of a novel receptor-activated TRP Ca2+ channel from mouse brain. J Biol Chem 273, 10279–10287.1074/jbc.273.17.10279
Parekh AB & Penner R (1997). Store depletion and calcium influx. Physiol Rev 77, 901–930.
Philipp S, Hambrecht J, Braslavski L, Schroth G, Freichel M, Murakami M, Cavalie A & Flockerzi V (1998). A novel capacitative calcium entry channel expressed in excitable cells. EMBO J 17, 4274–4282.1093/emboj/17.15.4274[CrossRef][Medline]
Plant TD & Schaefer M (2003). TRPC4 and TRPC5: receptor-operated Ca2+-permeable nonselective cation channels. Cell Calcium 33, 441–450.1016/S0143-4160(03)00055-1[CrossRef][Medline]
Putney JW Jr & McKay RR (1999). Capacitative calcium entry channels. Bioessays 21, 38–46.[CrossRef][Medline]
Riccio A, Mattei C, Kelsell RE, Medhurst AD, Calver AR, Randall AD, Davis JB, Benham CD & Pangalos MN (2002). Cloning and functional expression of human short TRP7, a candidate protein for store-operated Ca2+ influx. J Biol Chem 277, 12302–12309.1074/jbc.M112313200
Schaefer M, Plant TD, Obukhov AG, Hofmann T, Gudermann T & Schultz G (2000). Receptor-mediated regulation of the nonselective cation channels TRPC4 and TRPC5. J Biol Chem 275, 17517–17526.1074/jbc.275.23.17517
Singh BB, Liu X, Tang J, Zhu MX & Ambudkar IS (2002). Calmodulin regulates Ca2+-dependent feedback inhibition of store-operated Ca2+ influx by interaction with a site in the C terminus of TrpC1. Mol Cell 9, 739–750.1016/S1097-2765(02)00506-3[CrossRef][Medline]
Sinkins WG, Vaca L, Hu Y, Kunze DL & Schilling WP (1996). The COOH-terminal domain of Drosophila TRP channels confers thapsigargin sensitivity. J Biol Chem 271, 2955–2960.1074/jbc.271.6.2955
Sossey-Alaoui K, Lyon JA, Jones L, Abidi FE, Hartung AJ, Hane B, Schwartz CE, Stevenson RE & Srivastava AK (1999). Molecular cloning and characterization of TRPC5 (HTRP5), the human homologue of a mouse brain receptor-activated capacitative Ca2+ entry channel. Genomics 60, 330–340.1006/geno.1999.5924[CrossRef][Medline]
Strubing C, Krapivinsky G, Krapivinsky L & Clapham DE (2001). TRPC1 and TRPC5 form a novel cation channel in mammalian brain. Neuron 29, 645–655.1016/S0896-6273(01)00240-9[CrossRef][Medline]
Tang J, Lin Y, Zhang Z, Tikunova S, Birnbaumer L & Zhu MX (2001). Identification of common binding sites for calmodulin and inositol 1,4,5-trisphosphate receptors on the carboxyl termini of trp channels. J Biol Chem 276, 21303–21310.1074/jbc.M102316200
Thastrup O, Cullen PJ, Drobak BK, Hanley MR & Dawson AP (1990). Thapsigargin, a tumor promoter, discharges intracellular Ca2+ stores by specific inhibition of the endoplasmic reticulum Ca2+-ATPase. Proc Natl Acad Sci U S A 87, 2466–2470.
Vazquez G, Wedel BJ, Trebak M, St John Bird G & Putney JW Jr (2003). Expression level of the canonical transient receptor potential 3 (TRPC3) channel determines its mechanism of activation. J Biol Chem 278, 21649–21654.1074/jbc.M302162200
Venkatachalam K, Van Rossum DB, Patterson RL, Ma HT & Gill DL (2002). The cellular and molecular basis of store-operated calcium entry. Nat Cell Biol 4, E263–E272.1038/ncb1102-e263[CrossRef][Medline]
Venkatachalam K, Zheng F & Gill DL (2003). Regulation of canonical transient receptor potential (TRPC) channel function by diacylglycerol and protein kinase C. J Biol Chem 278, 29031–29040.1074/jbc.M302751200
Vennekens R, Voets T, Bindels RJ, Droogmans G & Nilius B (2002). Current understanding of mammalian TRP homologues. Cell Calcium 31, 253–264.1016/S0143-4160(02)00055-6[CrossRef][Medline]
Vriens J, Watanabe H, Janssens A, Droogmans G, Voets T & Nilius B (2004). Cell swelling, heat, and chemical agonists use distinct pathways for the activation of the cation channel TRPV4. Proc Natl Acad Sci U S A 101, 396–401.1073/pnas.0303329101
Wiser O, Cohen R & Atlas D (2002). Ionic dependence of Ca2+ channel modulation by syntaxin 1A. Proc Natl Acad Sci U S A 99, 3968–3973.1073/pnas.052017299
Yamada H, Wakamori M, Hara Y, Takahashi Y, Konishi K, Imoto K & Mori Y (2000). Spontaneous single-channel activity of neuronal TRP5 channel recombinantly expressed in HEK293 cells. Neurosci Lett 285, 111–114.1016/S0304-3940(00)01033-8[CrossRef][Medline]
Yuan JP, Kiselyov K, Shin DM, Chen J, Shcheynikov N, Kang SH, Dehoff MH, Schwarz MK, Seeburg PH, Muallem S & Worley PF (2003). Homer binds TRPC family channels and is required for gating of TRPC1 by IP3 receptors. Cell 114, 777–789.[CrossRef][Medline]
Zitt C, Halaszovich CR & Luckhoff A (2002). The TRP family of cation channels: probing and advancing the concepts on receptor-activated calcium entry. Prog Neurobiol 66, 243–264.1016/S0301-0082(02)00002-3[CrossRef][Medline]
|
Acknowledgements |
|---|
This article has been cited by other articles:
|
|
 |
|
  H.-T. Ma, Z. Peng, T. Hiragun, S. Iwaki, A. M. Gilfillan, and M. A. Beaven Canonical Transient Receptor Potential 5 Channel in Conjunction with Orai1 and STIM1 Allows Sr2+ Entry, Optimal Influx of Ca2+, and Degranulation in a Rat Mast Cell Line J. Immunol., February 15, 2008; 180(4): 2233 - 2239. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Borges, S. Lindstrom, C. Walters, A. Warrier, and M. Wilson Discrete influx events refill depleted Ca2+ stores in a chick retinal neuron J. Physiol., January 15, 2008; 586(2): 605 - 626. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Dattilo, N. J. Penington, and K. Williams Inhibition of TRPC5 Channels by Intracellular ATP Mol. Pharmacol., January 1, 2008; 73(1): 42 - 49. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. A. Nichols, A. F. Dengler, E. M. Nakagawa, M. Bashkin, B. T. Paul, J. Wu, and G. M. Khan A Constitutive, Transient Receptor Potential-like Ca2+ Influx Pathway in Presynaptic Nerve Endings Independent of Voltage-gated Ca2+ Channels and Na+/Ca2+ Exchange J. Biol. Chem., December 7, 2007; 282(49): 36102 - 36111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Semtner, M. Schaefer, O. Pinkenburg, and T. D. Plant Potentiation of TRPC5 by Protons J. Biol. Chem., November 16, 2007; 282(46): 33868 - 33878. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. W. Putney Jr New molecular players in capacitative Ca2+ entry J. Cell Sci., June 15, 2007; 120(12): 1959 - 1965. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Rey, S. H. Young, R. Papazyan, M. S. Shapiro, and E. Rozengurt Requirement of the TRPC1 Cation Channel in the Generation of Transient Ca2+ Oscillations by the Calcium-sensing Receptor J. Biol. Chem., December 15, 2006; 281(50): 38730 - 38737. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. F. Jackson Vascular smooth muscle store-operated Ca2+ channels: what a TRP! Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2592 - H2594. [Full Text] [PDF]
|
|
|
|
 |
|
 S.-Z. Xu, K. Muraki, F. Zeng, J. Li, P. Sukumar, S. Shah, A. M. Dedman, P. K. Flemming, D. McHugh, J. Naylor, et al. A Sphingosine-1-Phosphate-Activated Calcium Channel Controlling Vascular Smooth Muscle Cell Motility Circ. Res., June 9, 2006; 98(11): 1381 - 1389. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. T. Smyth, L. Lemonnier, G. Vazquez, G. S. Bird, and J. W. Putney Jr. Dissociation of Regulated Trafficking of TRPC3 Channels to the Plasma Membrane from Their Activation by Phospholipase C J. Biol. Chem., April 28, 2006; 281(17): 11712 - 11720. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Hui, D. McHugh, M. Hannan, F. Zeng, S.-Z. Xu, S.-u.-H. Khan, R. Levenson, D. J. Beech, and J. L. Weiss Calcium-sensing mechanism in TRPC5 channels contributing to retardation of neurite outgrowth J. Physiol., April 1, 2006; 572(1): 165 - 172. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Shimizu, T. Yoshida, M. Wakamori, M. Ishii, T. Okada, M. Takahashi, M. Seto, K. Sakurada, Y. Kiuchi, and Y. Mori Ca2+-calmodulin-dependent myosin light chain kinase is essential for activation of TRPC5 channels expressed in HEK293 cells J. Physiol., January 15, 2006; 570(2): 219 - 235. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. F. Odell, J. L. Scott, and D. F. Van Helden Epidermal Growth Factor Induces Tyrosine Phosphorylation, Membrane Insertion, and Activation of Transient Receptor Potential Channel 4 J. Biol. Chem., November 11, 2005; 280(45): 37974 - 37987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Ordaz, J. Tang, R. Xiao, A. Salgado, A. Sampieri, M. X. Zhu, and L. Vaca Calmodulin and Calcium Interplay in the Modulation of TRPC5 Channel Activity: IDENTIFICATION OF A NOVEL C-TERMINAL DOMAIN FOR CALCIUM/CALMODULIN-MEDIATED FACILITATION J. Biol. Chem., September 2, 2005; 280(35): 30788 - 30796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Tolhurst, C. Vial, C. Leon, C. Gachet, R. J. Evans, and M. P. Mahaut-Smith Interplay between P2Y1, P2Y12, and P2X1 receptors in the activation of megakaryocyte cation influx currents by ADP: ev |
R340/380) for five separate cells, showing responses to re-application of Ca2+ and to CCH. EGTA was excluded from all solutions. E and F, TRPC5 induced (E) or non-induced (F) cells were washed in 1.5 mM Ca2+ solution for 30 min, then perfused in the same solution containing 25 µM Gd3+, followed by the addition of 100 µM CCH. Traces for five isolated cells were shown in each case.