| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Mucosal Inflammation Research Group
2 Smooth Muscle Research Group
3 Diabetes & Endocrine Research Group
4
Department of Physiology & Biophysics
5 Department of Pharmacology & Therapeutics, Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
(Received 6 July 2004;
accepted after revision 23 August 2004;
first published online 26 August 2004)
Corresponding author P.-Y. von der Weid: Department of Physiology & Biophysics, Faculty of Medicine, University of Calgary, 3330 Hospital Drive N.W., Calgary, Alberta, Canada T2N 4N1. Email: vonderwe{at}ucalgary.ca
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Impairment of the lymphatic pumping function leads to profound swelling and oedema. Oedema formation also occurs during inflammation as a result of the action of inflammatory mediators on vascular permeability and thus elevation of interstitial fluid pressure. Although interstitial fluid pressure is critical in setting lymphatic pumping rate, the latter is also directly affected by many of the mediators released during inflammation (see review by Johnston (1987) and von der Weid (2001)). Proteinase-activated receptors (PARs), are a family of G protein-coupled receptors that are activated by the proteolytic cleavage of their extracellular amino terminus, unmasking a tethered ligand (Vu et al. 1991). PARs have been shown to play roles in inflammation, nociception and tissue remodelling (Dery et al. 1998; Vergnolle et al. 2001; Hollenberg & Compton, 2002; Ossovskaya & Bunnett, 2004). Importantly, activation of PAR2, a member of this family, produced a large inflammatory oedema in the rat and mouse paw, which is mediated in part by a neurogenic mechanism (Vergnolle et al. 1999; Steinhoff et al. 2000). PAR2 is highly expressed in well-perfused organs and tissues and it has been shown to affect vascular tone markedly in many blood vessel preparations (Cicala, 2002). The role lymphatic pumping plays in the resolution of oedemas and the anatomical similarities that exist between blood and lymphatic vessels, have prompted us to examine whether PAR2 is functionally expressed in lymphatic vessels and whether activation of this receptor modulates lymphatic contractility. Preliminary accounts of some of these findings have been communicated in abstract form (Chan & von der Weid, 2002; von der Weid & Chan, 2004).
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Guinea-pigs (7–15 days of age) of either sex were killed by decapitation during deep anaesthesia induced by inhalation of halothane. This procedure has been approved by the University of Calgary Animal Care and Ethics Committee and conforms to the guidelines established by the Canadian Council on Animal Care. The small intestine with its attached mesentery was rapidly dissected and placed in a physiological saline solution (PSS) of the following composition (mM): CaCl2, 2.5; KCl, 5; MgCl2, 2; NaCl, 120; NaHCO3, 25; NaH2PO4, 1; glucose, 11. The pH was maintained at 7.4 by constant bubbling with 95% O2–5% CO2.
RT-PCR
Lymphatic vessels were dissected out from the mesentery and pooled into RNase- and DNase-free collection tubes containing RNAlater (Qiagen, Mississauga, ON, Canada). Because of the small size of the vessels and the need for immediate immersion into the RNAlater solution, assessment of the amount of tissue mass was not possible. Small amounts (< 30 mg) of mesentery, lymph node and jejunum were also obtained. After RNA extraction (RNAeasy® Protect Mini Kit, Qiagen), the cDNA was synthesized using superscript RT enzyme and then amplified by adding 2 µl of the product to the PCR buffer containing 2 mM of each of the deoxynucleotides, 0.4 µM of each of the 3' and 5' primers for both PAR2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and 3 units of Taq DNA polymerase. After an initial denaturation step (94°C for 3 min), amplification was performed using DNA denaturation at 94°C for 45 s, primer annealing to single stranded DNA at 55°C for 1 min and DNA amplification at 72°C for 1 min, for 37 cycles (PAR2) and 25 cycles (GAPDH), before a final elongation step at 72°C for 10 min and a cool down to 4°C. The PCR products were separated on a 1% agarose gel and visualized by ethidium bromide staining. The guinea-pig primers for PAR2 (CATGTTCAGCTACTTCCTCTCCTT, forward, and GGTTTTTAACACTGGTGGAGCTTGA, reverse (Corvera et al. 1999) were used to amplify a 472 bp fragment, which was then purified with the QIAquick PCR Purification Kit (Qiagen), and sequenced by the University of Calgary Core DNA Service. The housekeeping gene GAPDH, with the following rodent primer sequence CGGAGTCAACGGATTTGGTCGTAT (forward) and AGCCTTCTCCATGGTGGTGAAGAC (reverse) (Cenac et al. 2002), was used as an internal positive control to ensure the efficiency of the procedure. Additional controls were made in the absence of cDNA to test for contamination with genomic DNA. A positive control for PAR2 expression was performed using guinea-pig small intestine which is known to express the receptor, particularly in the submucosal plexus (Reed et al. 2003) and myenteric nerves (Gao et al. 2002).
Vessel constriction measurements
Lymphatic tissue was prepared as previously described (von der Weid et al. 1996; Fox & von der Weid, 2002). Briefly, small collecting lymphatic vessels (diameter < 230 µm) from the jejunal and ileal regions were dissected together with their associated artery and vein and left intact within the surrounding mesentery. The mesentery was used to pin out the tissues on the Sylgard-coated base of a 2 ml organ bath. The bath was mounted on the stage of an inverted microscope (CK40, Olympus) and continuously superfused at a flow rate of 3 ml min–1 with PSS heated to 36°C. To induce a consistent rate of vessel constrictions, the vessel lumen was perfused through a fine glass micropipette inserted into a cut opening of the vessel. The cannula was connected to an infusion pump via Teflon tubing allowing the vessel lumen to be perfused in the direction of the valves at a flow rate of 2.5 µl min–1. This flow rate was very reliable in inducing a regular rhythmical contractile activity in lymphatic vessels in the range of diameters used in the study. The contraction frequency usually settled at about 80% of the maximum rate and was maintained for the duration of the experiment (typically 3–4 h). As the Ca2+ concentration in normal PSS tended to block the cannula, a low-calcium solution, in which 0.3 mM CaCl2 was substituted for 2.5 mM, was used. Perfusion with this solution did not alter vessel contractile activity nor endothelial responsiveness (von der Weid et al. 1996; Fox & von der Weid, 2002). Lymphatic vessel chambers or lymphangions were observed by video-microscopy, with diameter changes and constriction frequency continuously measured with a video-dimension analyser (Model V94, Living Systems Instrumentation, Burlington, VT, USA). This device, designed to sense the optically denser wall of the vessel, at a chosen scan line seen on the monitor, followed any change in vessel diameter with a rapid (< 20 ms) time resolution. Data were then recorded on a computer via an analog-to-digital converter (PowerLab/4SP, ADInstruments, Mountain View, CA, USA). Preparations were allowed a 30 min equilibration period prior to the first agonist application. Drug treatments were only performed on vessels with a consistent pumping frequency of at least 4–5 constrictions min–1 during the minimal 30 min equilibrium period. A 5 min control period of contractile activity was recorded prior to the addition of a test solution containing an agonist, antagonist or inhibitor at various concentrations. In experiments in which the effects of inhibitors were investigated, agonists were tested first as a control and a second time after the inhibitor was present for at least 15 min in the superfusion in the continuous presence of the inhibitor. A wash-out period of at least 30 min was allowed between successive applications of SLIGRL-NH2. This period was considered sufficient, as two successive applications 30 min apart gave responses that were not significantly different (P = 0.15, see Fig. 4C). The number of constrictions per minute was counted for the 5 min preceding the treatment (control), the treatment period and the 10 min of wash out for each drug application. Time course–frequency histograms were expressed as a percentage of the mean of the 5 min control value. Vessel constriction frequencies and their potential changes were also assessed by examining the mean of the consecutive 3 min period showing the greatest response compared with the mean of the 5 min control period. The PAR2-activating peptide, SLIGRL-NH2 was added to the superfusate for 4 min. A 1 min treatment with trypsin was observed to be optimal, with a longer application causing adverse effects on lymphatic pumping, such as a long-lasting decreased or irregular frequency.
|
The procedure has been previously described (von der Weid, 2001; Fox & von der Weid, 2002). Briefly, lymphatic vessels and attached mesentery were pinned onto a small organ bath (volume 100 µl), mounted on the stage of an inverted microscope (TMS, Nikon) and continuously superfused with PSS heated to 36°C at a flow rate of 3 ml min–1, causing a change-over time of < 7 s. Impalements of smooth muscle cells were obtained from the adventitial side of a lymphatic vessel using conventional glass intracellular microelectrodes filled with 0.5 M KCl (resistance 150–250 M
). Electrodes were connected to an amplifier (Intra 767, World Precision Instruments, Sarasota, FL, USA) through an Ag–AgCl half-cell. Resting membrane potential was monitored on a digital oscilloscope (VC6525, Hitachi) and simultaneously recorded on a computer via an analog-digital converter (PowerLab/4SP, ADInstrument, Mountain View, CA, USA). In order to ensure simplified electrical properties of the smooth muscle, vessels were cut into short segments (125–350 µm) with fine dissecting scissors. In this situation, electrical activity, even though generated at localized foci within the smooth muscle, produced a similar potential change in all the smooth muscle cells of the segment (van Helden, 1993).
Lymphatic smooth muscle impalements were characterized by a sharp drop in potential that settled after 10–15 s to a value typically more negative than –45 mV. Impalements were maintained for more than 5 min in > 90% of the cases and up to 1–3 h optimally. In experiments where the effects of agonists were studied in the presence of antagonists or inhibitors, agonists were applied first as a control and then, at least 20 min later, in the presence of the antagonist that had been superfused for at least 10 min. This protocol was usually performed during the same impalement. However, in some instances, successive impalements were obtained from neighbouring cells in the same segment. In preliminary recordings, no significant difference in the responses was found during successive applications (20 min intervals) of the same agonist, at the same concentration. Depolarizing events greater than 1 mV were considered as STDs and their activity was assessed by measuring their frequency and amplitude. STD frequency and amplitude, occurring during an interval of 15–60 s (depending on the stability of the recording, but typically 30 s), before application of agonists (SLIGRL-NH2, LRGILS-NH2, trypsin or ACh), were compared with that occurring during a period of the same duration while the maximum response to the agonist was observed.
Destruction of the endothelium
The lymphatic endothelium was destroyed in vitro following a procedure previously described (Gao et al. 1999; Fox & von der Weid, 2002). In brief, a fine glass micropipette was inserted into the lumen of a cut vessel. The micropipette, connected to an infusion pump via Teflon tubing, was used to luminally perfuse the vessel with PSS in the direction of the valves. This procedure induced rhythmical constrictions of the vessel. To destroy the endothelium, small air bubbles were then passed in repeated streams (5–6 times for 5–10 s, rate 3–5 ml min–1) via the micropipette through the vessel lumen. The success of the endothelial destruction was confirmed by applying ACh (10 µM) followed by sodium nitroprusside (100 µM) in the superfusion solution, while the vessel lumen was perfused. Absence of the ACh-induced decrease in pumping that was observed in intact vessels and a decrease in pumping to sodium nitroprusside were used as confirmation of the success of the endothelium removal. Endothelial destruction based on this testing procedure proved to be successful in about 50% of treated vessels. The use of sodium nitroprusside was necessary, as it has been shown that 40% of guinea-pig mesenteric lymphatic vessels with an intact endothelium exhibit a high basal production of nitric oxide and hence do not respond in any way to either ACh or sodium nitroprusside (von der Weid et al. 1996). Loss of endothelium function was confirmed further during the electrophysiological experiments by monitoring the absence of an endothelium-derived hyperpolarization and decrease in STD activity in response to 10 µM ACh. Membrane potential responses to ACh are very reliable, as they occur in more than 95% of the recordings in preparations with a functional endothelium (von der Weid et al. 1996, 2001).
Chemicals and drugs
The PAR2-activating peptide, SLIGRL-NH2, and its inactive reverse sequence control, LRGILS-NH2, were obtained from the peptide synthesis facilities at the University of Calgary (> 95% purity by HPLC and mass spectrometry). Acetylcholine, sodium nitroprusside, trypsin, NG-nitro-L-arginine (L-NNA), indomethacin and tetrodotoxin (TTX) were purchased from Sigma/Aldrich; PGE2 and iloprost were from Cayman Chemicals (Ann Arbor, MI, USA) and ODQ 1H-[1,2,4]oxadiazole [4,3-a]quinoxalin-1-one from Alexis Corp. (San Diego, CA, USA). Drugs were dissolved in DMSO except SLIGRL-NH2, LIRGLS-NH2 and trypsin (25 mM Hepes, pH 7.4), L-NNA (0.1 M HCl) and indomethacin (ethanol) to give 10 mM stock solutions, which were then diluted in PSS to achieve the appropriate concentration. The final concentration of each vehicle was always 
0.1% (v/v), a concentration that had no effect on lymphatic contractile and electrical functions.
Statistical analysis
Data are expressed as means ± one standard error of the mean (S.E.M). Statistical significance was assessed using a two tailed paired Student's t test (unless specified in the text), with P < 0.05 being considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We examined the presence of PAR2 mRNA in mesenteric lymphatic vessels using RT-PCR. A PCR product of the predicted size of 472 bp (Corvera et al. 1999) was amplified from RNA extracted from lymphatic vessels (n = 7 of 8 animals) and small intestine (jejunum, n = 12 of 13; Fig. 1A). These products were sequenced and compared with those published on the National Institutes of Health GenBank database (http://www.ncbi.nlm.nih.gov:80/blast/Blast.cgi). The PCR product from the lymphatic vessels and small intestine showed 80 and 78% homology, respectively, to the published Rattus norvegicus (Norway rat) PAR2 sequence. The complete sequence of the guinea-pig PAR2 has yet to be documented (reference: NM_053897). No PCR product was amplified when the PCR reaction was run without addition of the synthesized cDNA obtained from the RT reaction. The internal positive control with a housekeeping gene GAPDH was also found at an expected band size of 306 bp.
|
Intraluminal perfusion of mesenteric lymphatic vessels induced a rhythmical and regular constriction–relaxation cycle (vasomotion) with a frequency ranging from 4 to 19 min–1 (mean 8.6 ± 0.2 min–1, n = 164). Addition of SLIGRL-NH2 induced a decrease in lymphatic vasomotion (Fig. 2). This effect was observed over a rather limited range of concentrations, as the first observable response occurred at peptide concentrations of 0.5 µM (85 ± 3% of control, n = 3) and response was near maximal between 5 µM (63 ± 4% of control, n = 64) and 10 µM (66 ± 5% of control, n = 29). At 50 µM, SLIGRL-NH2 caused the constriction frequency to decrease to 47 ± 13% of the control rate (n = 6), which was not remarkably different from the values observed at lower concentration. The inhibition began on average 2–3 min after the beginning of the treatment, culminated at about 4–6 min and lasted for 8–10 min. The reverse sequence peptide LRGILS-NH2 caused no changes in the lymphatic constriction frequency. However, at high concentration (50 µM), a delayed, but very small decrease in constriction rate was observed (74 ± 5% of basal rate, n = 8, Fig. 2D).
|
Trypsin applied for 1 min induced a decrease in the rate of lymphatic constriction (Fig. 2C). The decrease was to 73 ± 5% of control at 5 U ml–1 (n = 36) and to 67 ± 7% of control at 10 U ml–1 (n = 4). Compared to a 1 min treatment of 10 µM SLIGRL-NH2 (59 ± 20%, n = 4), the trypsin response was shorter in duration. Again the strongest response occurred about 2–3 min after the addition of the agonist.
Increase in constriction rate in response to PAR2 agonists
In addition to the substantial inhibitory response observed with the PAR2 activation by SLIGRL-NH2 and trypsin, both agonists also caused an increase in constriction frequency in some preparations. This excitatory response was irregular and appeared more prominently at higher concentrations (see for example Fig. 2A, bottom trace), with 10 µM SLIGRL-NH2 causing a maximal increase in constriction frequency to 139 ± 8% of control (n = 29, P < 0.0001). These increases were observed mainly within the first minutes of treatment.
Role of the endothelium in the lymphatic vessel responses to PAR2 agonists
The function of the endothelium in modulating lymphatic constriction rate has been shown to be important in many vessels and with different chemical mediators (reviewed in von der Weid, 2001). To evaluate whether the lymphatic endothelium was involved in the modulation of lymphatic constriction rate by SLIGRL-NH2, we performed experiments on vessels with non-functional endothelium. In these endothelium-denuded vessels, the inhibitory response to SLIGRL-NH2 (5–10 µM) was greatly attenuated and reversed from 54 ± 12% to 98 ± 2% of the control, before and after endothelial denudation, respectively (n = 3, Fig. 3C).
|
The involvement of nitric oxide in the response to SLIGRL-NH2 was examined using the NO synthase inhibitor, L-NNA. In the presence of 100 µM L-NNA, SLIGRL-NH2 decreased the constriction frequency to 77 ± 12% of control at 5 µM (n = 4) and 78 ± 6% of control at 10 µM (n = 5). These values were not significantly different from those obtained in the same vessels before application of the inhibitor (57 ± 17% of control at 5 µM, n = 4 and 62 ± 5% of control at 10 µM, n = 5). The values obtained during L-NNA treatment were comparable to those attained during a second application of SLIGRL-NH2 (76 ± 9% of control at 5 µM, n = 10, Fig. 3C).
Cyclooxygenase products are prominent chemical mediators produced both constitutively and in inflammatory conditions. The possibility of some of them playing a role in the PAR2 agonist-induced response was examined in the presence of the non-selective cyclo-oxygenase inhibitor indomethacin (10 µM). The decrease in constriction frequency elicited by SLIGRL-NH2 was significantly reduced by this blocker, as demonstrated in Fig. 3. The response was largely reduced for 1 µM SLIGRL-NH2 (50 ± 17% of control before versus 88 ± 10% of control with indomethacin, n = 4, P = 0.14) and was significantly different for 5 µM SLIGRL-NH2 (49 ± 14% of control before versus 88 ± 8% of control with indomethacin, n = 4, P = 0.01). To assess further a role for cyclo-oxygenase metabolites in the response to PAR2 activation, lymphatic vessel contractile activity was evaluated in the presence of PGE2 or iloprost, the stable prostanoid receptor IP-receptor agonist. Application of iloprost (0.1 µM) or PGE2 (0.1–1 µM) caused a decrease in constriction frequency (Fig. 4).
Role of nerve stimulation in the lymphatic vessel responses to PAR2 agonists
PAR2 has been shown to be present on nerve terminals, its activation leading to neurotransmitter release (Steinhoff et al. 2000) via induction of action potentials (Amadesi et al. 2004). In order to evaluate the potential contribution of PAR2 receptors located on nerve terminals in the inhibitory response on lymphatic pumping, we investigated the response to SLIGRL-NH2 in the presence of tetrodotoxin (TTX). As illustrated in Fig. 3C, SLIGRL-NH2 (1 and 5 µM) decreased constriction frequency to 67 ± 8% (n = 5) and 47 ± 17% of control (n = 5), respectively, in the presence of 1 µM TTX. These values were not different from those obtained in control conditions in the same preparations (75 ± 9% and 57 ± 10% of the control for 1 and 5 µM SLIGRL-NH2, respectively).
Effects of PAR2 agonist on the lymphatic smooth muscle membrane potential
Microelectrode recordings obtained from short lymphatic vessel segments (length 125–350 µm) revealed a mean smooth muscle resting potential value of –51 ± 1 mV (n = 54). Superfusion of these preparations with SLIGRL-NH2 caused changes mainly characterized by a hyperpolarization reaching a peak amplitude of 7.8 ± 1.4 mV at 5 µM (n = 16; Fig. 5Ab). Smooth muscle in lymphatic segments exhibited spontaneous transient depolarizations (STDs) that were observed in about 95% of the recordings. STDs of sufficient amplitude or summation of such events were shown to generate action potentials and associated constrictions (van Helden, 1993). During the hyperpolarization induced by SLIGRL-NH2, STD activity was reduced in a concentration-dependent manner (Fig. 5Bc). At 10 µM SLIGRL-NH2, the STD frequency was significantly reduced to 50 ± 13% of control and the STD amplitude to 76 ± 4% of control (n = 9, P < 0.05). In most of the preparations SLIGRL-NH2 also caused a significant increase in STD frequency (P < 0.05 for 5 and 10 µM), which generally preceded the hyperpolarization and sometimes culminated in action potentials (see Fig. 5).
|
|
The SLIGRL-NH2-induced hyperpolarization was not observed in endothelium-denuded vessel segments and was abolished during superfusion with the cyclo-oxygenase inhibitor indomethacin (10 µM, Fig. 7). Both treatments also significantly abrogated the sustained SLIGRL-NH2-induced decrease in STDs (Fig. 7Bb).
|
Effects of iloprost and PGE2 on the lymphatic smooth muscle membrane potential
Both iloprost (0.1 µM) and PGE2 (1 µM) caused a significant hyperpolarization of the smooth muscle membrane potential, accompanied by a decrease in STD amplitude and frequency (Fig. 8). Importantly, STD activity was transiently increased in the early phase of the PGE2 action, mimicking the action of SLIGRL-NH2 and trypsin. This increase was observed with iloprost in only 2 out of 4 recordings.
|
KATP channel opening has been consistently observed to be responsible for agonist-induced hyperpolarizations in lymphatic vessel preparations (von der Weid, 1998; Chan & von der Weid, 2003). The role of KATP channels in the hyperpolarization induced by SLIGRL-NH2 was thus evaluated in the presence of glibenclamide. The SLIGRL-NH2-induced hyperpolarization was abolished by 1 µM glibenclamide (Fig. 9). Moreover, glibenclamide also blocked hyperpolarizations caused by trypsin (5 U ml–1), PGE2 (1 µM) and iloprost (0.1 µM, Fig. 9 and data not shown for iloprost).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Our study is the first examining a potential role of PARs in regulating lymphatic vessel function. Our findings can be compared with data obtained with vascular preparations, which are similar in morphology and are also a conduit for fluid. A relaxation or vasodilatation in response to PAR2 activation, which can be interpreted as analogous to the decrease in lymphatic constriction frequency, has been described in the majority of blood vessels studied to date (Cicala, 2002). Moreover, studies using vascular preparations in vitro have consistently demonstrated an endothelial dependency of the smooth muscle relaxation, in response to PAR2 agonists (Al-Ani et al. 1995; Saifeddine et al. 1996; Emilsson et al. 1997; Roy et al. 1998; Bhattacharya & Cohen, 2000; Hamilton & Cocks, 2000; Trottier et al. 2000; Hamilton et al. 2001; Nakayama et al. 2001; McGuire et al. 2002; McLean et al. 2002). In agreement with these studies, data obtained in vivo from rat basilar arteries and human forearm and hand blood vessels have also presented evidence of PAR2-mediated vasorelaxation (Sobey & Cocks, 1998; Robin et al. 2003).
In many vascular beds, NO has been held accountable as the endothelium-derived vasodilatory agent released during PAR2 activation (Al-Ani et al. 1995; Emilsson et al. 1997; Moffatt & Cocks, 1998; Roy et al. 1998; Sobey & Cocks, 1998; Trottier et al. 2000; Nakayama et al. 2001). In other blood vessels, however, the relaxant effect was attributed at least in part to an endothelium-derived hyperpolarization factor (EDHF) (Trottier et al. 2000; McGuire et al. 2002; McLean et al. 2002). In our study, we found no role for NO and demonstrated that cyclo-oxygenase products probably derived from the endothelium were the primary mediators for the PAR2 inhibitory effects on lymphatic contractile and electrical activities. Prostanoids were also suggested to be responsible for PAR2-induced contraction of rat urinary bladder (Nakayama et al. 2001) and gastric longitudinal smooth muscle (Al-Ani et al. 1995), as the responses were significantly inhibited by 10 µM indomethacin.
The effects of inhibitors of cyclo-oxygenase and other arachidonate metabolism products in lymphatic vessels have been extensively investigated in earlier studies (Johnston & Gordon, 1981; Johnston & Feuer, 1983; Johnston et al. 1983). The results suggest that lymphatic vessels may be capable of generating arachidonate products, which play some role in modulation of the spontaneous activity. Particularly, cyclo-oxygenase and lipoxygenase products induce very powerful excitatory and inhibitory responses in isolated bovine mesenteric lymphatic vessel segments. In the same preparation, non-contracting vessels could be induced to contract rhythmically with a variety of derivatives, the most potent being the stable PGH2/TXA2 mimetic, U46619, and leukotrienes B4, C4 and D4 (Johnston et al. 1983). Arachidonic acid by itself, probably through its conversion in lymphatic cells to stimulatory and inhibitory metabolites, induces a variety of contractile responses in bovine mesenteric lymphatics (Johnston et al. 1983). The ability of the lymphatic endothelium to produce vasoactive prostanoids has also been demonstrated in guinea-pig mesenteric lymphatics, where an enhanced constriction rate in response to substance P and ATP was prevented by indomethacin, imidazole, a TXA2 synthase inhibitor and SQ29548, a PGH2/TXA2 receptor antagonist, suggesting that PGH2/TXA2 was involved as a diffusible activator (Rayner & van Helden, 1997; Gao et al. 1999). PGH2/TXA2 was also shown to mediate the perfusion-induced reduction in diameter and increase in the frequency of vasomotion in microlymphatics of rat iliac lymph node in response to increase in intraluminal flow (Mizuno et al. 1998).
The observation that prostaglandins (mainly PGE2) induced biphasic changes in STD activity similar to that induced by SLIGRL-NH2 and trypsin favours the hypothesis of the involvement of multiple prostaglandin receptors located on the smooth muscle rather than that of smooth muscle PAR2. Although this issue was not directly dealt with in the present study, examination of the pharmacology and signalling pathways of prostaglandin receptors known to be activated by PGE2 and iloprost could provide some support for this hypothesis. The prostanoid receptors, EP2, EP3, EP4 and IP receptors are known to be coupled to the Gs protein–adenylate cyclase–cAMP pathway (see review by Narumiya et al. (1999)). This pathway was shown to be responsible for the glibenclamide-sensitive hyperpolarization and decrease in STD activity in response to isoproterenol and forskolin in the same lymphatic preparation (von der Weid et al. 1996, 2001). Moreover, the observed PGE2-induced increase in STD activity, an effect similar to that seen with U46619 (von der Weid et al. 2001), could involve TP or EP1 receptors, which are coupled to the Gq protein–phospholipase C–inositol-trisphosphate pathway (see review by Narumiya et al. 1999).
The present findings are particularly relevant in the context of inflammation, where the participation of lymphatic vessels in the resolution of inflammation-associated oedema is critical. Lymph flow has been observed to increase during oedemagic stress, via enhanced lymphatic pumping (Benoit et al. 1989; Benoit & Zawieja, 1992). This pumping increase has been generally attributed to the mechanical effects of inflammation-associated oedema per se. However, in addition to its high susceptibility to fluid load, lymphatic vessel contractile activity is also directly altered by mediators released during the inflammatory process and which certainly gain access to the vicinity of the lymphatic vessels or to the lymphatic circulation. Data mainly obtained in vitro showed that lymphatic pumping is impaired in the presence of prostanoids (see above), nitric oxide or histamine, for example, an effect independent of their action on vascular permeability (see review by Johnston, 1987 and von der Weid, 2001). Given that proteinases are also thought to be released during inflammation, the possibility exists for activation of PARs expressed in lymphatic vessels. Importantly, recent studies suggest that PAR2 exerts pro-inflammatory actions during the early phase of the inflammation and promotes oedema (Vergnolle et al. 1999). In light of our findings, it is thus tempting to propose that the effect of PAR2 activation on lymphatic pumping by impairing oedema resolution could at least in part contribute to the pro-inflammatory action of PAR2 activation. Identity of the proteinase(s) that may be responsible for the in vivo activation of PAR2 in an inflammatory setting remains to be characterized.
In conclusion, we have identified functional PAR2 in guinea-pig mesenteric lymphatic vessels. Activation of this receptor with trypsin and SLIGRL-NH2 induced a decrease in lymphatic constriction frequency correlated with a hyperpolarization and a decrease in STD activity. This response is suggested to be endothelium dependent and, unlike the typical NO-based effect found in most systems, seems to be mediated by cyclo-oxygenase metabolites. With respect to the role PAR2 may play in vascular dysfunction and in inflammation, PAR2-induced inhibition of lymphatic contractility leading to a likely decrease in transport of interstitial fluid may initiate or exacerbate a disease state such as hypotension, and may prolong or intensify inflammation-induced oedema.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Amadesi S, Nie J, Vergnolle N, Cottrell GS, Grady EF, Trevisani M, Manni C, Geppetti P, McRoberts JA, Ennes H, Davis JB, Mayer EA & Bunnett NW (2004). Protease-activated receptor 2 sensitizes the capsaicin receptor transient receptor potential vanilloid receptor 1 to induce hyperalgesia. J Neurosci 24, 4300–4312.
Benoit JN & Zawieja DC (1992). Effects of f-Met-Leu-Phe-induced inflammation on intestinal lymph flow and lymphatic pump behavior. Am J Physiol 262, G199–202.[Medline]
Benoit JN, Zawieja DC, Goodman AH & Granger HJ (1989). Characterization of intact mesenteric lymphatic pump and its responsiveness to acute edemagenic stress. Am J Physiol 257, H2059–2069.[Medline]
Bhattacharya A & Cohen ML (2000). Vascular contraction and relaxation to thrombin and trypsin: thrombomodulin preferentially attenuates thrombin-induced contraction. J Pharmacol Exp Ther 295, 284–290.
Cenac N, Coelho AM, Nguyen C, Compton S, Andrade-Gordon P, MacNaughton WK, Wallace JL, Hollenberg MD, Bunnett NW, Garcia-Villar R, Bueno L & Vergnolle N (2002). Induction of intestinal inflammation in mouse by activation of proteinase-activated receptor-2. Am J Pathol 161, 1903–1915.
Chan AK & von der Weid P-Y (2002). Effect of PAR-2 activation on guinea-pig mesenteric lymphatic vessels. Faseb J 16, A77.[CrossRef]
Chan AK & von der Weid P-Y (2003). 5-HT decreases contractile and electrical activities in lymphatic vessels of the guinea-pig mesentery: role of 5-HT 7-receptors. Br J Pharmacol 139, 243–254.[CrossRef][Medline]
Cicala C (2002). Protease activated receptor 2 and the cardiovascular system. Br J Pharmacol 135, 14–20.[CrossRef][Medline]
Corvera CU, Dery O, McConalogue K, Gamp P, Thoma M, Al-Ani B, Caughey GH, Hollenberg MD & Bunnett NW (1999). Thrombin and mast cell tryptase regulate guinea-pig myenteric neurons through proteinase-activated receptors-1 and -2. J Physiol 517, 741–756.
Dery O, Corvera CU, Steinhoff M & Bunnett NW (1998). Proteinase-activated receptors: novel mechanisms of signaling by serine proteases. Am J Physiol 224, C1429–1452.
Emilsson K, Wahlestedt C, Sun MK, Nystedt S, Owman C & Sundelin J (1997). Vascular effects of proteinase-activated receptor 2 agonist peptide. J Vasc Res 34, 267–272.[Medline]
Fox JL & von der Weid P-Y (2002). Effects of histamine on the contractile and electrical activity in isolated lymphatic vessels of the guinea-pig mesentery. Br J Pharmacol 136, 1210–1218.[CrossRef][Medline]
Gao C, Liu S, Hu HZ, Gao N, Kim GY, Xia Y & Wood JD (2002). Serine proteases excite myenteric neurons through protease-activated receptors in guinea pig small intestine. Gastroenterology 123, 1554–1564.[CrossRef][Medline]
Gao J, Zhao J, Rayner SE & van Helden DF (1999). Evidence that the ATP-induced increase in vasomotion of guinea-pig mesenteric lymphatics involves an endothelium-dependent release of thromboxane A2. Br J Pharmacol 127, 1597–1602.[CrossRef][Medline]
Hamilton JR & Cocks TM (2000). Heterogeneous mechanisms of endothelium-dependent relaxation for thrombin and peptide activators of protease-activated receptor-1 in porcine isolated coronary artery. Br J Pharmacol 130, 181–188.[CrossRef][Medline]
Hamilton JR, Frauman AG & Cocks TM (2001). Increased expression of protease-activated receptor-2 (PAR2) and PAR4 in human coronary artery by inflammatory stimuli unveils endothelium-dependent relaxations to PAR2 and PAR4 agonists. Circ Res 89, 92–98.
Hollenberg MD & Compton SJ (2002). International Union of Pharmacology. XXVIII. Proteinase-activated receptors. Pharmacol Rev 54, 203–217.
Johnston MG (1987). Interaction of inflammatory mediators with the lymphatic vessel. Pathol Immunopathol Res 6, 177–189.[Medline]
Johnston MG & Feuer C (1983). Suppression of lymphatic vessel contractility with inhibitors of arachidonic acid metabolism. J Pharmacol Exp Ther 226, 603–607.
Johnston MG & Gordon JL (1981). Regulation of lymphatic contractility by arachidonate metabolites. Nature 293, 294–297.[CrossRef][Medline]
Johnston MG, Kanalec A & Gordon JL (1983). Effects of arachidonic acid and its cyclo-oxygenase and lipoxygenase products on lymphatic vessel contractility in vitro. Prostaglandins 25, 85–98.[CrossRef][Medline]
McGuire JJ, Hollenberg MD, Andrade GP & Triggle CR (2002). Multiple mechanisms of vascular smooth muscle relaxation by the activation of proteinase-activated receptor 2 in mouse mesenteric arterioles. Br J Pharmacol 135, 155–169.[CrossRef][Medline]
McLean PG, Aston D, Sarkar D & Ahluwalia A (2002). Protease-activated receptor-2 activation causes EDHF-like coronary vasodilation: selective preservation in ischemia/reperfusion injury: involvement of lipoxygenase products, VR1 receptors, and C-fibers. Circ Res 90, 465–472.
Mizuno R, Koller A & Kaley G (1998). Regulation of the vasomotor activity of lymph microvessels by nitric oxide and prostaglandins. Am J Physiol 274, R790–796.[Medline]
Moffatt JD & Cocks TM (1998). Endothelium-dependent and -independent responses to protease-activated receptor-2 (PAR-2) activation in mouse isolated renal arteries. Br J Pharmacol 125, 591–594.[CrossRef][Medline]
Nakayama T, Hirano K, Nishimura J, Takahashi S & Kanaide H (2001). Mechanism of trypsin-induced endothelium-dependent vasorelaxation in the porcine coronary artery. Br J Pharmacol 134, 815–826.[CrossRef][Medline]
Narumiya S, Sugimoto Y & Ushikubi F (1999). Prostanoid receptors: structures, properties, and functions. Physiol Rev 79, 1193–1226.
Ossovskaya VS & Bunnett NW (2004). Protease-activated receptors: contribution to physiology and disease. Physiol Rev 84, 579–621.
Rayner SE & van Helden DF (1997). Evidence that the substance P-induced enhancement of pacemaking in lymphatics of the guinea-pig mesentery occurs through endothelial release of thromboxane A2. Br J Pharmacol 121, 1589–1596.[CrossRef][Medline]
Reed DE, Barajas-Lopez C, Cottrell G, Velazquez-Rocha S, Dery O, Grady EF, Bunnett NW & Vanner SJ (2003). Mast cell tryptase and proteinase-activated receptor 2 induce hyperexcitability of guinea-pig submucosal neurons. J Physiol 547, 531–542.
Robin J, Kharbanda R, Mclean P, Campbell R & Vallance P (2003). Protease-activated receptor 2-mediated vasodilatation in humans in vivo: role of nitric oxide and prostanoids. Circulation 107, 954–959.
Roy SS, Saifeddine M, Loutzenhiser R, Triggle CR & Hollenberg MD (1998). Dual endothelium-dependent vascular activities of proteinase-activated receptor-2-activating peptides: evidence for receptor heterogeneity. Br J Pharmacol 123, 1434–1440.[CrossRef][Medline]
Saifeddine M, Al-Ani B, Cheng CH, Wang L & Hollenberg MD (1996). Rat proteinase-activated receptor-2 (PAR-2): cDNA sequence and activity of receptor-derived peptides in gastric and vascular tissue. Br J Pharmacol 118, 521–530.[Medline]
Sobey CG & Cocks TM (1998). Activation of protease-activated receptor-2 (PAR-2) elicits nitric oxide-dependent dilatation of the basilar artery in vivo. Stroke 29, 1439–1444.
Steinhoff M, Vergnolle N, Young SH, Tognetto M, Amadesi S, Ennes HS, Trevisani M, Hollenberg MD, Wallace JL, Caughey GH, Mitchell SE, Williams LM, Geppetti P, Mayer EA & Bunnett NW (2000). Agonists of proteinase-activated receptor 2 induce inflammation by a neurogenic mechanism. Nat Med 6, 151–158.[CrossRef][Medline]
Toland HM, McCloskey KD, Thornbury KD, McHale NG & Hollywood MA (2000). Ca2+-activated Cl– current in sheep lymphatic smooth muscle. Am J Physiol 279, C1327–1335.
Trottier G, Hollenberg M, Wang X, Gui Y, Loutzenhiser K & Loutzenhiser R (2000). PAR-2 elicits afferent arteriolar vasodilation by NO-dependent and NO-independent actions. Am J Physiol 282, F891–897.
van Helden DF (1993). Pacemaker potentials in lymphatic smooth muscle of the guinea-pig mesentery. J Physiol 471, 465–479.
van Helden DF, von der Weid P-Y & Crowe MJ (1995). Electrophysiology of lymphatic smooth muscle. In Interstitium, Connective Tissue, and Lymphatics, ed. Bert J, Laine GA, McHale NG, Reed R & WINLOVE P, pp. 221–236. Portland Press, London.
van Helden DF, von der Weid P-Y & Crowe MJ (1996). Intracellular Ca2+ release: a basis for electrical pacemaking in lymphatic smooth muscle. In Smooth Muscle Excitation, ed. Tomita T & Bolton TB, pp. 355–373. Academic Press, London.
Vergnolle N, Hollenberg MD, Sharkey KA & Wallace JL (1999). Characterization of the inflammatory response to proteinase-activated receptor-2 (PAR2) -activating peptides in the rat paw. Br J Pharmacol 127, 1083–1090.[CrossRef][Medline]
Vergnolle N, Wallace JL, Bunnett NW & Hollenberg MD (2001). Protease-activated receptors in inflammation, neuronal signaling and pain. Trends Pharmacol Sci 22, 146–152.[CrossRef][Medline]
von der Weid P-Y (1998). ATP-sensitive K+ channels in smooth muscle cells of guinea-pig mesenteric lymphatics: role in nitric oxide and beta-adrenoceptor agonist-induced hyperpolarizations. Br J Pharmacol 125, 17–22.[CrossRef][Medline]
von der Weid P-Y (2001). Lymphatic vessel pumping and inflammation – the role of spontaneous constrictions and underlying electrical pacemaker potentials. Aliment Pharmacol Ther 15, 1115–1129.[CrossRef][Medline]
von der Weid P-Y & Chan AK (2004). PAR-2 activation depresses spontaneous lymphatic vessel pumping via the release of endothelium-derived prostanoids. Memorias Do Instituto Oswaldo Cruz (in press).
von der Weid PY, Crowe MJ & van Helden DF (1996). Endothelium-dependent modulation of pacemaking in lymphatic vessels of the guinea-pig mesentery. J Physiol 493, 563–575.
von der Weid P-Y, Zhao J & van Helden DF (2001). Nitric oxide decreases pacemaker activity in lymphatic vessels of guinea pig mesentery. Am J Physiol 280, H2707–2716.
Vu TK, Hung DT, Wheaton VI & Coughlin SR (1991). Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation. Cell 64, 1057–1068.[CrossRef][Medline]
|
Acknowledgements |
|---|
This article has been cited by other articles:
|
|
 |
|
  T. F. Wu, C. J. Carati, W. K. MacNaughton, and P.-Y. von der Weid Contractile activity of lymphatic vessels is altered in the TNBS model of guinea pig ileitis Am J Physiol Gastrointest Liver Physiol, October 1, 2006; 291(4): G566 - G574. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Yu. Gasheva, D. C. Zawieja, and A. A. Gashev Contraction-initiated NO-dependent lymphatic relaxation: a self-regulatory mechanism in rat thoracic duct J. Physiol., September 15, 2006; 575(3): 821 - 832. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
