| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Physiology, Campus Gasthuisberg, KU Leuven, Leuven, Belgium
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionSupplementary materialReferences |
|---|
(Received 29 June 2004;
accepted after revision 25 August 2004;
first published online 26 August 2004)
Corresponding author B. Nilius: Laboratorium voor Fysiologie, Campus Gasthuisberg, KU Leuven, Herestraat 49, B-3000 Leuven, Belgium. Email: bernd.nilius{at}med.kuleuven.ac.be
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionSupplementary materialReferences |
|---|
So far, TRPM4 channels have only been studied in heterologous expression systems (Launay et al. 2002; Nilius et al. 2003, 2004) but have also been identified as endogenous currents in HEK 293 cells (Launay et al. 2002). The functional analysis of this channel turned out to be relatively difficult because of the decay of channel activity in whole-cell and cell-free patch clamp measurements. The reason for this decay is not yet known. Very likely, the Ca2+ sensitivity of TRPM4 is regulated and partly or sometimes completely lost during the experiment, as has been suggested for the related TRPM5 desensitization (Liu & Liman, 2003).
This study focuses on properties of human TRPM4. In the first part, we present a quantitative approach to predict the observed changes in voltage dependence due to desensitization, indicating that Ca2+ and voltage sensitivity are interdependent. In the second part, we identify decavanadate (DV) as a strong modifier of TRPM4 channel gating. We were led by a recent report of Csanady & Adam-Vizi, 2004) who reported that the ATP block of Ca2+-activated non-selective cation channels in brain capillary endothelium is antagonized by DV, a compound known to interact with ATP binding sites. DV contains six negative charges that induce strong electrostatic interactions with sites accumulating positive charges, such as the ATP binding sites of various ABC ATPases, e.g. SERCA pumps (Toyoshima et al. 2000; Clausen et al. 2003) or the ATP, actin and DV binding myosin head segment, subfragment 1 (Tiago et al. 2004). Our results indicate that in contrast to the endogenous channels in brain capillary endothelium DV does not antagonize ATP block of TRPM4, but rather acts as channel activator by inhibiting voltage-dependent closure of the channel.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionSupplementary materialReferences |
|---|
Human embryonic kidney cells, HEK293, were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% (v/v) human serum, 2 mM L-glutamine, 2 U ml–1 penicillin and 2 mg ml–1 streptomycin at 37°C in a humidity controlled incubator with 10% CO2.
Transient expression of hTRPM4 and mutagenesis
We used the recombinant bicistronic expression plasmid pdiTRPM4b, which carries the entire protein-coding region for the human TRPM4b (accession number AX443227) (Nilius et al. 2003) or mouse TRPM5 (accession number AY280364) (Perez et al. 2002) and for the green fluorescent protein (GFP) coupled by an internal ribosomal entry site (IRES) sequence. HEK293 cells were transiently transfected with the pdiTRPM4b/pdiTRPM5 vector using previously described methods and successfully transfected cells were visually identified by their green fluorescence in the patch clamp set up (Nilius et al. 2003). To evaluate the mechanisms of decavanadate (DV) action, we constructed a chimera in which the TRPM4 C-terminus was exchanged by the TRPM5 C-terminus. The rationale behind this is that we did not observe ATP effects on TRPM5 (N. D. Ullrich et al. unpublished observations). The chimera was obtained using the standard PCR overlap extension technique (Ho et al. 1989) with the human TrpM4 cDNA and the mouse TrpM5 cDNA as the templates; both constructed in the pCAGGSM2/IresGFP. The C-terminal part of TrpM4 cDNA (from aa G1047) was replaced by the corresponding sequence of the TrpM5 cDNA (from aa Q981 until stop codon). The replacement sequence was created by standard PCR overlap extension (Ho et al. 1989). We used the following primers: on TrpM4 cDNA, forward primer; gacggcggacccagccg and reverse primer; gcaccacctggaatgtgtaactgaacatggc: and on TrpM5 cDNA forward primer; cagttacacattccaggtggtgcaaggcaatgc and reverse primer; cggcttcggccagtaacg (overlapping sequences are in bold italic). The chimerical overlap PCR fragments were replaced into pCAGGSM2/TrpM4/IresGFP using Asc I and Cla I restriction enzymes. The sequence of the chimera was verified by sequence analysis. For evaluation of a putative DV binding site, we deleted the N-terminal or the C-terminal stretch in TRPM4 (332RDRIRR, 1136RARDKR). Deletions were constructed by the same overlap technique (Ho et al. 1989). Identical clusters of positive charges are not present in TRPM5. These sites resemble part of a putative ATP binding site in ABC ATPases comprising a stretch FSRDRK (Clausen et al. 2003).
Solutions
The extracellular solution for cell-attached measurements and the pipette solution for inside-out patch clamp measurements contained (mM): 156 NaCl, 5 CaCl2, 1 MgCl2, 10 glucose, 10 Hepes, buffered at pH 7.4 with NaOH. Before patch excision, the extracellular bath solution was changed to an ‘internal solution’ for inside-out patch clamp measurements, which contained (mM): 156 NaCl or KCl, 1 MgCl2, 10 Hepes, 5 EGTA. The Ca2+ concentration of this solution was adjusted between 100 nM and 1000 µM by adding appropriate amounts of CaCl2, as calculated by the CaBuf program (ftp://ftp.cc.kuleuven.ac.be/pub/droogmans/cabuf.zip). The pH of all solutions was adjusted to 7.2 with NaOH. In all inside-out studies, internal solutions were ATP free. All experiments were performed at room temperature (22–25°C).
Decavanadate was prepared as described in detail elsewhere (Csanady & Adam-Vizi, 2004). DV was applied from a stock solution of 50 mM Na3VO4 at pH 2.0, because DV is the major vanadium species at this pH. This stock solution was stored at +4°C and used within 24 h and was diluted into the bath just before each experiment (< 60 min). In all applications, we took care to only use solutions with a faint yellow colour, which is indicative of the presence of vanadate in the decamer form.
Electrophysiology
Currents were monitored in the inside-out patch clamp configuration with an EPC-9 (HEKA Elektronik, Lambrecht, Germany). Patch electrodes had a DC resistance between 2 and 4 M
. An Ag–AgCl wire was used as a reference electrode. Sampling interval was 500 µs and filter setting was 1 kHz. In most of the experiments, we applied step protocols from a holding potential of 0 mV consisting of 500 ms steps to –100 mV followed by a 250 ms step to +100 mV. The interval between the pulses was 2 s. Patches were excised in the internal pipette solution at various intracellular Ca2+ concentrations. The first data point during a time course experiment was obtained within 2 s after excision, which corresponds to the stimulation interval. All DV experiments were done in symmetrical Na+-containing solutions.
Data analysis
Electrophysiological data were analysed using WinASCD software (ftp://ftp.cc.kuleuven.ac.be/pub/droogmans/winascd.zip). Origin 7.0 (OriginLab, Northampton, MA, USA) was used to fit dose–response curves and the kinetic model described below. Significance was tested by the two sample Student's t test (P < 0.05 for significance). Pooled data are given as means ± S.E.M. of n cells.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionSupplementary materialReferences |
|---|
Figure 1A shows continuous recordings of TRPM4 currents in inside-out patches in response to repetitive voltage steps to –100 and +100 mV, immediately after patch excision in three different Ca2+ concentrations. Current amplitudes at all three Ca2+ concentrations decline with time after patch excision (Fig. 1A, left panel): the rate and extent of ‘desensitization’ are inversely related to the Ca2+ concentration applied to the inside of the patch. Interestingly, the current declines faster and to a larger extent at negative than at positive potentials. From the overlay of the currents at –100 and +100 mV (Fig. 1A, right panel) it can be appreciated that the kinetics of current activation immediately after patch excision is faster than at the stationary level, and that [Ca2+] has profound effects on current amplitude and activation rate. Also note that the currents at 3 µM Ca2+ are smaller than those at 100 and 300 µM Ca2+, as expected for a Ca2+-activated channel. Typically, these time courses scatter substantially (see supplementary information).
|
A kinetic model for the Ca2+-activated and voltage-dependent TRPM4 channel
Since a quantitative analysis of TRPM4 currents in excised patches is not feasible immediately after patch excision due to the rapid current decay, we have limited our analysis to the late phase, when the currents have reached a ‘quasi’ stationary level. Figure 2A shows current traces from a single patch at different Ca2+ concentrations during voltage steps ranging from –100 to +180 mV (increment 40 mV) applied from a holding potential of 0 mV. In Fig. 2B and C, we summarize the pooled data from several patches representing the voltage dependence of the initial value of the tail current recorded at –100 mV and the time constants of current relaxation. The current amplitudes were normalized to their asymptotic value at the highest Ca2+ concentration. From these data we conclude that higher cytoplasmic Ca2+ concentrations lead to larger current amplitudes, a slight leftward shift of the voltage-dependent activation curves and faster time constants for current activation at positive potentials.
|
|
|
C and C* represent the Ca2+-free and Ca2+-bound closed state of the channel, O its open state. 
(V) increases and ß(V) decreases exponentially with voltage V. Ca2+ binding (Kd = k–1/k1) is assumed to be much faster than voltage-dependent gating. The steady-state channel open probability PO and time constant 
of (de)activation for this model are given by:
|
| (1) |
. It also predicts that the open probability approaches unity at high Ca2+ concentrations and strong positive potentials, which justifies equating the normalized current amplitudes in Fig. 2B with open probabilities. A global fit of these equations to the experimental data of Fig. 2B and C, represented by the continuous lines, yielded the following parameters: Kd = 87 µM, (V) = 0.0057 exp(0.0060 V) and ß(V) = 0.033 exp(–0.019 V). The dashed line represents simulated PO values at the end of the 400 ms voltage pulse in 10 µM Ca2+. This line fits these experimental data better than the steady-state PO, as the steady state, especially at high positive voltages, is not fully reached at the end of the voltage steps.
The current traces in Fig. 2D simulated with the fitted parameters, assuming an ohmic open channel conductance and a reversal potential of 0 mV, resemble closely the experimental traces shown in Fig. 2A. Currents were calculated by:
|
| (2) |
were obtained from eqn (1), PO(
), PO(0) refer to steady-state and initial PO values, respectively. Again, due to this variable desensitization in different individual cells and cell batches, the estimation of the KD values scatter substantially (see supplementary data). Modulation of TRPM4 by decavanadate
We have reported previously that ATP in its free form (ATP4–) is a potent blocker of TRPM4 (Nilius et al. 2004). The vanadate decamer decavanadate (DV) has been widely used as a tool to interact with ATP binding, and ATP block of a non-selective Ca2+-activated cation channel in brain capillary endothelium was recently shown to be antagonized by DV (Csanady & Adam-Vizi, 2004). We have therefore extended our study to the effects of DV on TRPM4 currents. Figure 3 illustrates the effects of 10 µM DV on TRPM4 currents when applied to the intracellular side of the patch. DV, which was applied after TRPM4 currents had reached a stationary level, induced a fast and fully reversible increase of inward current (Fig. 3A). Except for a small reduction at high DV concentrations (not in all cells) it had only minor effects on outward current (Fig. 3A). DV exerted pronounced effects on current kinetics (Fig. 3B): the typical current deactivation at negative and current activation at positive potentials was virtually abolished in the presence of 10 µM DV, indicating that DV strongly affects the gating of TRPM4 channels (n > 20 cells).
|
Effect of decavanadate on the instantaneous current–voltage relation of TRPM4
The pronounced effect of DV on inward current amplitude and the lack of significant effect on the steady-state outward current amplitude could, in theory, be due to a DV-induced inward rectification of the TRPM4 channel. We have therefore evaluated the instantaneous current–voltage relation at negative potentials, using the protocol shown in Fig. 4A. After a pre-pulse to +100 mV, the membrane was clamped back to various negative potentials and the current immediately after stepping back to these potentials was determined. This protocol was applied to an inside-out patch either in the absence or in the presence of 10 µM DV. From the current–voltage relation (Fig. 4B) it can be seen that DV does not enhance the instantaneous current amplitude at any potential. It is therefore unlikely that the enhanced inward current in the presence of DV is due to a DV-induced inward rectification of TRPM4. The small reduction of the current amplitude at negative potentials may be due to the same blocking action of DV that reduces current amplitudes at positive potentials.
|
Both the enhanced inward current and the apparent lack of gating are consistent with a substantial slowing down of channel closure due to shift of the voltage dependence of ß(V) to more negative potentials. This would result in an increased open probability, especially at negative voltages. To confirm this, we have applied a classical tail current protocol to assess the fraction of open channels at various voltages. In order to cover an as wide as possible voltage range, we have measured the instantaneous amplitude of tail currents at –160 mV (Fig. 4C). These tail currents deactivate rapidly and almost completely in the absence of DV, but more slowly and incomplete in the presence of DV. The tail current amplitudes were converted to PO, i.e. normalized to the asymptotic current amplitude in the same patch at high [Ca2+] and strong positive potentials in the absence/presence of DV. The result of such an analysis is shown in Fig. 4D (pooled data from 6 cells). Assuming that DV does not affect Kd, we can deduce ß(V)/(V) from the fit of these normalized data with eqn (1). We obtained ß(V)/(V) = 4.4 exp(–0.032 V) in the absence of DV compared with ß(V)/(V) = 0.12 exp(–0.0048 V) in the presence of 10 µM DV. Because the tail currents in the presence of DV are much slower than under control conditions, the change in ß(V)/(V) is probably due to a change in ß(V) rather than (V). Assuming that the effect of DV is entirely due to an effect on ß(V), simulated current traces ((V) was taken from the controls, Fig. 2) recapitulate the experimental traces remarkably well (Fig. 4C, right panel).
Effects of decavanadate on the block of TRPM4 by ATP
Although the action of DV is clearly distinct from that of ATP, it cannot be excluded that DV affects the ATP block by some competitive action at ATP binding sites. We have therefore compared the concentration dependence of ATP block in the absence and presence of 5 µM DV. Figure 5A shows an example of the currents activated by 300 µM Ca2+ in the presence of DV, and subsequent block by different concentrations of ATP. Application of 8 µM free ATP4– (corrected for the applied Ca2+ concentration of 300 µM) resulted in a fast and nearly complete block of the current (Fig. 5A), which was completely reversible (data not shown). Figure 5B shows some representative current traces in the presence of various ATP4– concentrations that were used to evaluate the concentration dependence of the block. Figure 5C shows the fraction of unblocked current at +100 and –100 mV in the presence of various concentrations of ATP4–. The block by ATP4– could be described by:
|
| (3) |
|
Preliminary experiments have shown that ATP does not block TRPM5 channels (N. D. Ullrich et al. unpublished observations). This finding has prompted us to test the effects of DV on TRPM5. Surprisingly, DV, applied under the same conditions as for TRPM4, has no effect on TRPM5 currents (Fig. 6). Panel A shows the typical increase of the inward current in TRPM4 immediately after application of DV. The traces on the right show the dramatic increase in current amplitude at negative potentials and the very slow kinetics of the current. Typically for TRPM4 is that a ‘quasi’ stationary current level is reached after patch excision. In contrast, TRPM5 shows a rapid and complete desensitization (Fig. 6B). However, application of DV did not delay this decay and did not detectably increase the current amplitude at negative potentials. Because the C-terminus of TRPM4 but not that of TRPM5 contains a putative ATP binding site resembling part of the nucleotide (decavanadate) binding site in SERCA, we have constructed a chimeric protein by exchanging the C-termini between both channels (TRPM4_CM5). As shown in Fig. 6C, the TRPM4 channel containing the C-terminus of TRPM5 shows a complete desensitization similar to that of TRPM5, which was not affected by DV. These data are summarized in Fig. 6D, showing current amplitudes before and 6 s (three sweeps) after application of DV at –100 and +100 mV. The dramatic increase of the current at –100 mV as observed for wild type TRPM4 was absent in both TRPM5 and TRPM4_CM5. The effects at +100 mV were not significant. Obviously, the C-terminus of TRPM4 is required for the action of DV.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionSupplementary materialReferences |
|---|
Our linear three-state kinetic scheme used for the description of dependence of PO and of of (de)activation of the TRPM4 currents on [Ca2+] and voltage during the stationary phase after patch excision was also used to characterize the effects of decavanadate, a compound that competes with ATP at ATP-binding sites, as described for ATP-dependent transport proteins, especially for SERCA Ca2+ pumps (Csermely et al. 1985; Hua et al. 2000; Toyoshima et al. 2000). It has also been described that DV increases single channel conductance of NSCs (Popp & Gögelein, 1992; Csanady & Adam-Vizi, 2003) and is an activator of NSC channels in endothelium by antagonizing the ATP block (Csanady & Adam-Vizi, 2004). Here we show that DV modulates channel activity of TRPM4 heterologously expressed in HEK 293 cells, mainly by interfering with channel gating. From our analysis we conclude that the most likely effect of DV is a dramatic shift of the voltage dependence of channel closing (ß(V)) towards negative potentials, resulting in a strongly reduced voltage -dependence of PO in the investigated voltage range. As a consequence, robust inward currents occur at negative potentials, and the time-dependent components of the current during voltage step are small. This activation occurs in the micromolar range, and is not due to a substantial change in Ca2+ affinity of the channel. A similar effect of decavanadate has been recently described for NSCs in brain capillary endothelium (Csanady & Adam-Vizi, 2004), and was explained by a slowed channel closure caused by a high-affinity binding of DV to the open conformation of the channel (EC50 of 90 nM). In this same paper, Csanady & Adam-Vizi (2004) described an antagonistic effect of DV on the ATP block of these channels. They explained this ATP block by a high-affinity binding of ATP in the closed channel conformation, but competitively at the same site as DV. These effects of DV on ATP block are at variance with our present observation in TRPM4 channels, showing that DV actually sensitized ATP block and decreased the IC50 by a factor of 10. It is difficult to reconcile these data with a model whereby ATP and DV preferentially bind to the same site in the open and closed channel configuration, respectively. We assume that DV binds to a site, which interacts with the voltage-sensing mechanism (channel closing). The question remains how DV acts on TRPM4. Although it has been suggested that DV may act via lipid peroxidation of the membrane (Soares et al. 2003; Tiago et al. 2004), we think that this explanation is unlikely because of the very fast onset and the fast and complete reversibility of DV effects on TRPM4.
The unexpected finding that ATP blocks both inward and outward currents in the presence of DV suggests that the ATP block might be voltage independent, which is in contrast with our previous contention that ATP would act as an open pore blocker in the absence of DV. Our results therefore suggest that DV binds to a site, which modulates the voltage dependence of the channel rather than interfering with the blocking site of ATP4–.
To evaluate the mechanisms of DV action, we have first tested whether the closely related channel TRPM5 responds to DV. TRPM5 was insensitive to ATP4– at concentrations as high as 1 mM (N. D. Ullrich et al. unpublished observations). It might therefore not be completely unexpected that DV did not affect TRPM5. DV has been successfully used to identify the ATP binding site in SERCA (Toyoshima et al. 2000). Such a binding site shows some clear plasticity and depends on a structural motif rather than on a specific peptide sequence (Clausen et al. 2003). Decavanadate binding in the SERCA Ca2+ ATPase occurs in a spatial structure to which the nucleotide binding domain N, the actuator domain A, and the phosphorylation domain P all contribute (Hua et al. 2000). A putative ATP binding site in ABC ATPases is composed of elements with the sequences TETAL, FSRDRK, KGAPE, RCLALA (Clausen et al. 2003). Especially interesting are highly positively charged sites, which have also been identified in the head segment of myosin (called subfragment 1) and bind DV (Tiago et al. 2004). The intracellular domains of TRPM4 contain multiple regions with a high density of positively charged residues. One of these sites is located in the C-terminus of TRPM4 and confers a stretch of six amino acids with four positive and one negative charge (136RARDKR, R/K mutant). Such a motif is lacking in TRPM5. We have therefore first constructed a chimera of TRPM4 containing the C-terminus of TRPM5. This chimera shows some properties of TRPM5, i.e. a complete and rapid desensitization after patch excision, but lacks any effect of DV. Likewise, the R/K mutant also showed a complete lack of DV effect. Interestingly, the R/K mutant and also the chimeras showed changes in desensitization. It can be speculated that these sites are important for regulation of the Ca2+ sensitivity of TRPM4 and may be also involved in ATP binding. However, such a possible binding is different from the blocking site, because the chimeric channels showed a similar block by ATP4– as the wild type TRPM4 channels (IC50 = 0.5 µM ATP4–, data not shown, n = 3 for three concentrations).
A similar motif was found in the N-terminus of TRPM4, namely 332RDRIRR, which also comprises four positive charges and one negative charge. Deletions of these motifs resulted in functional channels, which could still be, in contrast to the C-terminal deletion, modulated by DV. All these data together suggest that the C-terminus of TRPM4 is crucially involved in regulation of gating, and is at least part of the DV acceptor that can dramatically modulate the kinetic behaviour of this channel. However, this C-terminal site is very probably different from the blocking site for ATP4–.
In conclusion, we have identified DV as the first strong modulator of voltage-dependent gating in the Ca2+-activated cation channel TRPM4. DV might represent a novel tool to modulate endogenous TRPM4-mediated NSCs and may provide a possible way to differentiate between TRPM4 and TRPM5, and may contribute to our understanding of TRPM4 gating. Finally, it is tempting to speculate that an endogenous molecule with properties similar to those of DV may act as a physiological ligand for TRPM4.
|
Supplementary material |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionSupplementary materialReferences |
|---|
This material can also be found at: http://www.blackwellpublishing.com/products/journals/suppamt/tjp/tjp524/tjp524sm.htm
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionSupplementary materialReferences |
|---|
Colquhoun D, Neher E, Reuter H & Stevens CF (1981). Inward current channels activated by intracellular Ca in cultured cardiac cells. Nature 294, 752–754.[CrossRef][Medline]
Csanady L & Adam-Vizi V (2003). Ca2+- and voltage-dependent gating of Ca2+- and ATP-sensitive cationic channels in brain capillary endothelium. Biophys J 85, 313–327.
Csanady L & Adam-Vizi V (2004). Antagonistic regulation of native Ca2+- and ATP-sensitive cation channels in brain capillaries by nucleotides and decavanadate. J General Physiol 123, 743–757.
Csermely P, Varga S & Martonosi A (1985). Competition between decavanadate and fluorescein isothiocyanate on the Ca2+-ATPase of sarcoplasmic reticulum. Eur J Biochem 150, 455–460.[Medline]
Egorov AV, Hamam BN, Fransen E, Hasselmo ME & Alonso AA (2002). Graded persistent activity in entorhinal cortex neurons. Nature 420, 173–178.[CrossRef][Medline]
Eto W, Hirano K, Hirano M, Nishimura J & Kanaide H (2003). Intracellular alkalinization induces Ca2+ influx via non-voltage-operated Ca2+ channels in rat aortic smooth muscle cells. Cell Calcium 34, 477–484.[CrossRef][Medline]
Guinamard R, Chatelier A, Lenfant J & Bois P (2004). Activation of the Ca2+-activated nonselective cation channel by diacylglycerol analogues in rat cardiomyocytes. J Cardiovasc Electrophysiol 15, 342–348.[Medline]
Guinamard R, Rahmati M, Lenfant J & Bois P (2002). Characterization of a Ca2+-activated nonselective cation channel during dedifferentiation of cultured rat ventricular cardiomyocytes. J Membr Biol 188, 127–135.[CrossRef][Medline]
Halonen J & Nedergaard J (2002). Adenosine 5'-monophosphate is a selective inhibitor of the brown adipocyte nonselective cation channel. J Membr Biol 188, 183–197.[CrossRef][Medline]
Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR (1989). Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59.[CrossRef][Medline]
Hofmann T, Chubanov V, Gudermann T & Montell C (2003). TRPM5 is a voltage-modulated and Ca2+-activated monovalent selective cation channel. Current Biol 13, 1153–1158.[CrossRef][Medline]
Hua S, Inesi G & Toyoshima C (2000). Distinct topologies of mono- and decavanadate binding and photo-oxidative cleavage in the sarcoplasmic reticulum ATPase. J Biol Chem 275, 30546–30550.
Hurwitz CG, Hu VY & Segal AS (2002). A mechanogated nonselective cation channel in proximal tubule that is ATP sensitive. Am J Physiol 283, F93–104.
Koch J & Korbmacher C (1999). Osmotic shrinkage activates nonselective cation (NSC) channels in various cell types. J Membr Biol 168, 131–139.[CrossRef][Medline]
Koivisto A, Siemen D & Nedergaard J (2000). Norepinephrine-induced sustained inward current in brown fat cells: alpha(1)-mediated by nonselective cation channels. Am J Physiol 279, E963–977.
Launay P, Fleig A, Perraud AL, Scharenberg AM, Penner R & Kinet JP (2002). TRPM4 is a Ca2+-activated nonselective cation channel mediating cell membrane depolarization. Cell 109, 397–407.[CrossRef][Medline]
Liman ER (2003). Regulation by voltage and adenine nucleotides of a Ca2+-activated cation channel from hamster vomeronasal sensory neurons. J Physiol 548, 777–787.
Liu D & Liman ER (2003). Intracellular Ca2+ and the phospholipid PIP2 regulate the taste transduction ion channel TRPM5. Proc Natl Acad Sci U S A 100, 15160–15165.
Magistretti J & Alonso A (2002). Fine gating properties of channels responsible for persistent sodium current generation in entorhinal cortex neurons. J General Physiol 120, 855–873.
Maruyama Y & Petersen OH (1982). Cholecystokinin activation of single-channel currents is mediated by internal messenger in pancreatic acinar cells. Nature 300, 61–63.[CrossRef][Medline]
Maruyama Y & Petersen OH (1984). Single calcium-dependent cation channels in mouse pancreatic acinar cells. J Membr Biol 81, 83–87.[CrossRef][Medline]
Miyoshi H, Yamaoka K, Garfield RE & Ohama K (2004). Identification of a non-selective cation channel current in myometrial cells isolated from pregnant rats. Pflügers Arch 447, 457–464.[CrossRef][Medline]
Nilius B, Prenen J, Droogmans G, Voets T, Vennekens R, Freichel M, Wissenbach U & Flockerzi V (2003). Voltage dependence of the Ca2+-activated cation channel TRPM4. J Biol Chem 278, 30813–30820.
Nilius B, Prenen J, Voets T & Droogmans G (2004). Intracellular nucleotides and polyamines inhibit the Ca2+-activated cation channel TRPM4b. Pflügers Arch 448, 70–75.[CrossRef][Medline]
Perez CA, Huang L, Rong M, Kozak JA, Preuss AK, Zhang H, Max M & Margolskee RF (2002). A transient receptor potential channel expressed in taste receptor cells. Nature Neurosci 5, 1169–1176.[CrossRef][Medline]
Petersen OH (2002). Cation channels: homing in on the elusive CAN channels. Current Biol 12, R520–522.[CrossRef][Medline]
Pezza RJ, Villarreal MA, Montich GG & Argarana CE (2002). Vanadate inhibits the ATPase activity and DNA binding capability of bacterial MutS. A structural model for the vanadate–MutS interaction at the Walker A motif. Nucl Acids Res 30, 4700–4708.
Popp R & Gögelein H (1992). A calcium and ATP sensitive nonselective cation channel in the antiluminal membrane of rat cerebral capillary endothelial cells. Biochim Biophys Acta 1108, 59–66.[Medline]
Ringer E, Russ U & Siemen D (2000). Beta(3)-adrenergic stimulation and insulin inhibition of non-selective cation channels in white adipocytes of the rat. Biochim Biophys Acta 1463, 241–253.[Medline]
Rodighiero S, De Simoni A & Formenti A (2004). The voltage-dependent nonselective cation current in human red blood cells studied by means of whole-cell and nystatin-perforated patch-clamp techniques. Biochim Biophys Acta 1660, 164–170.[Medline]
Simard JM & Chen M (2004). Regulation by sulfanylurea receptor type 1 of a non-selective cation channel involved in cytotoxic edema of reactive astrocytes. J Neurosurg Anesthesiol 16, 98–99.[CrossRef][Medline]
Soares SS, Aureliano M, Joaquim N & Coucelo JM (2003). Cadmium and vanadate oligomers effects on methaemoglobin reductase activity from Lusitanian toadfish: in vivo and in vitro studies. J Inorg Biochem 94, 285–290.[CrossRef][Medline]
Suh SH, Vennekens R, Manolopoulos VG, Freichel M, Schweig U, Prenen J, Flockerzi V, Droogmans G & Nilius B (1999). Characterisation of explanted endothelial cells from mouse aorta: electrophysiology and Ca2+ signalling. Pflügers Arch 438, 612–620.[CrossRef][Medline]
Suh SH, Watanabe H, Droogrnans G & Nilius B (2002). ATP and nitric oxide modulate a Ca2+ activated non-selective cation current in macrovascular endothelial cells. Pflügers Arch 444, 438–445.[CrossRef][Medline]
Tiago T, Aureliano M & Gutierrez-Merino C (2004). Decavanadate binding to a high affinity site near the myosin catalytic centre inhibits F-actin-stimulated myosin ATPase activity. Biochem 43, 5551–5561.[CrossRef][Medline]
Toyoshima C, Nakasako M, Nomura H & Ogawa H (2000). Crystal structure of the calcium pump of sarcoplasmic reticulum at 2.6 A resolution. Nature 405, 647–655.[CrossRef][Medline]
Wu SN (2003). Large-conductance Ca2+-activated K+ channels: physiological role and pharmacology. Curr Med Chem 10, 649–661.[CrossRef][Medline]
Zhainazarov AB (2003). Ca2+-activated nonselective cation channels in rat neonatal atrial myocytes. J Membr Biol 193, 91–98.[CrossRef][Medline]
|
Acknowledgements |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. Talavera, K. Yasumatsu, R. Yoshida, R. F. Margolskee, T. Voets, Y. Ninomiya, and B. Nilius The taste transduction channel TRPM5 is a locus for bitter-sweet taste interactions FASEB J, May 1, 2008; 22(5): 1343 - 1355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Reading and J. E. Brayden Central Role of TRPM4 Channels in Cerebral Blood Flow Regulation Stroke, August 1, 2007; 38(8): 2322 - 2328. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. A. Crowder, M. S. Saha, R. W. Pace, H. Zhang, G. D. Prestwich, and C. A. Del Negro Phosphatidylinositol 4,5-bisphosphate regulates inspiratory burst activity in the neonatal mouse preBotzinger complex J. Physiol., August 1, 2007; 582(3): 1047 - 1058. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Demion, P. Bois, P. Launay, and R. Guinamard TRPM4, a Ca2+-activated nonselective cation channel in mouse sino-atrial node cells Cardiovasc Res, February 1, 2007; 73(3): 531 - 538. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 |
, 10 µM DV; 
, 1 µM DV). C, concentration–response curve for the DV-induced increase of inward current at –100 mV defined as (IDV – Icont)/Icont, where IDV and Icont represent the current amplitudes in the present and absence of DV. The continous line represents a fit for a Hill equation with an EC50 of 1.9 µM and a slope nH of 1.8 (data from 6 cells).
) and presence (
) of 10 µM DV. C, current traces elicited by 400 ms pulses to potentials ranging from –160 to +140 mV and a subsequent 50 ms step to –160 mV. Note that the deactivation of the inward currents during the step to –160 mV is complete in the absence but not in the presence of 10 µM DV. The patch was exposed to 300 µM Ca2+. D, voltage dependence of the normalized initial tail current amplitudes from 6 cells in the absence and presence of 10 µM DV. The continuous lines represent the open probabilities predicted by the kinetic scheme, assuming that Kd is not affected by DV. The fitted parameters for ß(V)/
) and +100 mV (
, control data obtained at +100 mV and in the absence of DV (compare also 
, during DV). B, DV application to an excised patch of a TRPM5-expressing cell. Same protocol as in A. Note the lack of DV action and the typical complete decay after patch excision. C, same protocol as in A, but from a cell expressing a chimeric channel of TRPM4 containing the C-terminus of TRPM5. D, pooled data from at least 4 cells (excised in 300 µM [Ca2+]i). The relative change of the current was measured 6 s (3 sweeps) after DV application. Data were obtained at –100 (open bars) and +100 mV (filled bars). Negative values indicate a decrease in current amplitude (desensitization). Note the dramatic difference at –100 mV between TRPM5 and the chimera, and TRPM4.
R/K and N-term