|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of
1 Physiology and Pharmacology, Section of Integrative Physiology
2 Surgical Sciences, Section of Integrative Physiology, Karolinska Institute, 171-77 Stockholm, Sweden
3 Arexis AB, 41346 Göteborg, Sweden
| Abstract |
|---|
|
|
|---|
1, decreased AMPK
3 and unchanged AMPK
2 protein expression between MCK-CnA* and wild-type mice (P < 0.05). The loss of AICAR-mediated glucose uptake is coupled to changes in the AMPK isoform expression, suggesting fibre-type dependence of the AICAR responses on glucose uptake. In conclusion, improvements in skeletal muscle glucose transport in response to calcineurin-induced muscle remodelling are limited to insulin action.
(Received 18 May 2005;
accepted after revision 20 June 2005;
first published online 23 June 2005)
Corresponding author J. R. Zierath: Department of Surgical Sciences, Section of Integrative Physiology, Karolinska Institute, von Eulers väg 4, II, SE-171 77 Stockholm, Sweden. Email: juleen.zierath{at}fyfa.ki.se
| Introduction |
|---|
|
|
|---|
Glucose transport can be achieved via phosphatidylinositol (PI) 3-kinase-dependent and -independent mechanisms in skeletal muscle. Insulin-stimulated glucose transport requires the activation of PI 3-kinase, whereas insulin-independent activators of glucose transport, such as exercise/muscle contraction, AICAR (a pharmacological activator of AMP-activated kinase) and hypoxia are PI 3-kinase independent (Lee et al. 1995; Hayashi et al. 1998). Each of these insulin-independent stimuli activate AMP-activated protein kinase (AMPK) (Winder & Hardie, 1996; Merrill et al. 1997; Barnes et al. 2002) and glucose transport in skeletal muscle. Given the diversity in insulin-dependent responses between fast- and slow-twitch skeletal muscle fibre types, insulin-independent responses of AMPK and glucose transport may be related to fibre-type composition.
AMPK is a heterotrimeric protein consisting of a catalytic
-subunit and two regulatory subunits (ß and
) (Hardie & Carling, 1997). Each AMPK subunit has multiple isoforms (specifically
1,
2, ß1, ß2,
1,
2,
3) and distinct tissue expression (Verhoeven et al. 1995; Thornton et al. 1998; Cheung et al. 2000), suggesting distinctive physiological roles for each isoform. The
3 subunit displays a higher level of expression in glycolytic fast-twitch skeletal muscle compared to oxidative slow-twitch skeletal and cardiac muscle (Mahlapuu et al. 2004; Yu et al. 2004). Fibre-type-specific expression of AMPK subunit isoforms may influence the state of AMPK activation and regulation of glucose transport by different AMPK agonists. Interestingly, AICAR increases glucose transport activity in fast-twitch epitrochlearis muscle, but not in slow-twitch soleus muscle of rats (Kaushik et al. 2001; Ai et al. 2002). In addition, gAcrp30 (globular subunit of adiponectin) increases AMPK activity and glucose uptake in rat fast-twitch glycolytic extensor digitorum longus (EDL) muscle, but not in oxidative soleus muscle (Tomas et al. 2002). These studies provide evidence for a fibre-type-dependent response of AMPK to different stimuli.
The fibre-type composition of skeletal muscle is regulated by signal transduction pathways involving calcineurin (Naya et al. 2000), calciumcalmodulin-dependent protein kinase IV (CaMK IV) (Wu et al. 2002), and the peroxisome proliferator
coactivator 1 (PGC-1) (Lin et al. 2002). Recently, using calcineurin transgenic mice, we provided evidence that skeletal muscle remodelling to a slow-twitch phenotype via constitutively active calcineurin enhanced insulin-stimulated glucose transport and protected against the development of dietary-induced (high-fat feeding) insulin resistance (Ryder et al. 2003). However, whether skeletal muscle remodelling influences insulin-independent responses on glucose uptake is unknown. AICAR and contraction induce glucose transport activity in skeletal muscle through a pathway partly mediated via AMPK. Therefore, we hypothesized that fibre-type transformation could lead to alterations in AMPK signalling and glucose uptake. Here we report that although expression of an activated form of calcineurin in skeletal muscle improved the insulin-stimulated glucose transport capacity, AICAR-induced glucose transport was decreased. The reduction in AICAR-mediated glucose uptake was coincident with reduced expression of the AMPK
3 subunit, indicating that AICAR responses are a feature of the fast-twitch phenotype. In contrast, contraction-mediated glucose uptake was similar between wild-type and calcineurin transgenic mice. Our results demonstrate that skeletal muscle reprogramming from a fast- to a slow-twitch phenotype is associated with changes in AMPK subunit isoform expression and diminished AICAR-mediated glucose uptake.
| Methods |
|---|
|
|
|---|
2-Deoxy-D-[1,2-3H]glucose was from American Radiolabeled Chemicals (St Louis, MO, USA) and [U-14C]mannitol was from Moravek Biochemicals (Brea, CA, USA). Human insulin (Actrapid) was from Novo Nordisk (Bagsvaerd, Denmark). 5-Aminoimidazole-4-carboxamide-ß-D-ribofuranoside (AICAR) was from Toronto Research Chemicals (Toronto, Canada). AMPK
1,
2,
1,
2 and
3 subunit antibodies were generated, as described previously (Mahlapuu et al. 2004). Phospho-AMPK (Thr-172) and phospho-ACC (acetyl-CoA carboxylase, Ser-227) antibodies were from Cell Signalling Technology (Beverly, MA, USA) and Upstate Biochemicals (Waltman, MA, USA). Horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G secondary antibodies were from Bio-Rad (Hercules, CA, USA). Enhanced chemiluminescence reagents were from Amersham Biosciences (UK). Other reagents were from Sigma Chemicals (St Louis, MO, USA).
Transgenic mice
A line of transgenic mice expressing a constitutively active form of calcineurin (O'Keefe et al. 1992) under the control of the MCK promoter/enhancer (MCK-CnA* mice) was established at the Karolinska Institute using MCK-CnA* mice that were originally developed at the University of Texas Southwestern Medical Center (Naya et al. 2000). MCK-CnA* mice and wild-type littermates were maintained on a 12 h lightdark cycle and were allowed free access to food and water. On the day of the experiment, food was removed 4 h prior to the study. Mice were anaesthetized via intraperitoneal injection of 2.5% Avertin (0.02 ml (g body wt)1) and EDL muscles were removed for in vitro incubation. The mice were humanely killed by cervical dislocation immediately after muscle dissection. The Ethics Committee on Animal Research in Northern Stockholm approved all experimental procedures.
Muscle incubations
All incubation media were prepared from pre-gassed (95% O25% CO2) stocks of Krebs-Henseleit buffer (KHB) supplemented with 5 mM Hepes and 0.1% bovine serum albumin. Mice were anaesthetized via intraperitoneal injection of 2.5% Avertin (0.02 ml (g body wt)1). Extensor digitorum longus (EDL) muscles were excised and incubated in 1 ml of KHB supplemented with 2 mM pyruvate. Mannitol was used in all incubation media to balance the osmolarity of KHB additives to 20 mM. Incubations were performed at 30°C in a shaking water bath. Muscles were incubated in the absence or presence of either 12 nM insulin or 2 mM AICAR for 40 min (for the analysis of glucose uptake) or 60 min (for AMPK signalling studies). When the effects of muscle contraction were studied, muscle contraction was evoked for the final 10 min of the incubation period using electrical stimulation as described below. Muscles were either frozen between aluminium tongs cooled to the temperature of liquid nitrogen, or incubated for an additional 20 min for the assessment of 2-deoxyglucose uptake, as described below.
Electrical stimulation
Muscles were placed in a stimulation chamber containing 4 ml of KHB and positioned between two platinum electrodes with the distal tendon fixed to the bottom of the incubation chamber. The proximal tendon was fixed to an isometric force transducer and resting tension was adjusted to 0.5 g. Muscles were forced to contract for 10 min via electrical stimulation as previously described (Ryder et al. 2000). Basal muscles were treated identically minus the application of electrical stimulation.
Glucose transport activity
Following pre-incubation, muscles were transferred to vials containing 1 mM 2-deoxy[3H]glucose (2.5 mCi ml1) and 17 mM (when 2 mM AICAR was added) or 19 mM[14C]mannitol (0.7 mCi ml1). Insulin or AICAR was added at concentrations identical to pre-incubation conditions. 2-Deoxyglucose uptake was assessed for 20 min at 30°C. Under these conditions 2-deoxyglucose uptake directly reflects glucose transport activity and not metabolism in mouse skeletal muscle. The total time of AICAR or insulin exposure (pre-incubation plus glucose transport assay) was 60 min. After incubation, muscles were digested in 0.5 M NaOH. Sample aliquots were used for protein determination using a commercially available kit (Coomassie Plus, Pierce, Inc., Rockford, IL, USA). Extracellular space and intracellular 2-deoxyglucose concentration were determined by liquid scintillation counting. Glucose transport activity is expressed as nmol 2-deoxyglucose (mg protein)1 (20 min)1.
Western blot analysis
Muscles were pulverized in microcentrifuge tubes over liquid nitrogen. Powdered muscle was homogenized in 0.4 ml of ice-cold lysis buffer (20 mM Tris (pH 8.0), 137 mM NaCl, 2.7 mM KCl, 10 mM NaF, 1 mM MgCl, 1 mM Na3VO4, 0.2 mM PMSF, 10% glycerol, 1% Triton X-100, 1 µg ml1 aprotinin, 1 µg ml1 leupeptin, and 1 µg ml1 pepstatin A for phospho-AMPK, and AMPK
subunits, or 50 mM Hepes, 1% Triton X-100, 1 mM DTT, 10% glycerol, 1 mM EDTA, 5 mM sodium pyrophosphate, 50 mM NaF and proteolytic enzyme inhibitors for AMPK
subunits). Homogenates were solubilized by end over end mixing for 60 min at 4°C. Homogenates were cleared of insoluble material by centrifugation (12 000 g, 10 min, 4°C). Total protein was determined by using a commercially available kit based on the Bradford method (Bio-Rad). Proteins were solubilized in Laemmli sample buffer. Proteins (40 µg) were separated by SDS-PAGE and transferred to Immobilon-P membranes (Millipore, Bedford, MA, USA). Membranes were blocked with 5% fat-free milk in Tris-buffered saline containing 0.02% Tween 20 (TBST) and probed with the indicated primary antibodies. Membranes were washed in TBST (6 x 10 min), incubated in the goat anti-rabbit secondary antibody, and washed again in TBST. Proteins were visualized by enhanced chemiluminescence (ECL) and quantified by densitometry.
Real-time PCR
Quantification of the AMPK
subunit isoform mRNA expression from mouse EDL muscle was performed using quantitative real-time PCR with the ABI PRISM 7000 Sequence Detector System and fluorescence-based SYBR-green technology (Applied Biosystems, Warrington, UK). Total RNA was prepared from the tissue samples using Trizol reagent (Sigma) and treated with DNase, using a DNA-free kit (Ambion, Huntingdon, UK) according to the manufacturer's instructions. Synthesis of cDNA was performed with oligo(dT) primers using SuperScript First Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). The reaction without reverse-transcriptase was performed for each sample as reverse transcriptase minus control. Real-time PCR reactions contained 400 nM of each PCR primer and 1 x SYBR Green PCR Master Mix (Applied Biosystems). The forward (F) and reverse (R) primer sequences were as follows, 5'3', for mouse Prkag1 (GenBank AH010706)
CAAGTTCCAAGTTGGTGGTATTTG (F) and
CGAACACCATTGGTCACCAG (R), mouse Prkag2 (GenBank NM145401)
ATACTTACCCACAAAAGAAT-CCTCAAG (F) and
AGCTCATCCAGGTTCTGCTTC (R), mouse Prkag3 (GenBank AF525500)
CACGGGAACA-GGTGCATAGG (F) and
GGAGACCACGCCCAGAAGA (R), acidic ribosomal phosphoprotein PO (GenBank BC003833)
GAGGAATCAGATGAGGATATGGGA (F) and
AAGCAGGCTGACTTGGTTGC (R). All samples were run in duplicate and the relative quantities of different mRNA transcripts were calculated after normalization of the data against acidic ribosomal phosphoprotein PO, an endogenous control, using the standard curve method.
Statistical analysis
Data are reported as mean ±S.E.M. Differences between two groups were determined by Student's t test. Significance was accepted at P < 0.05.
| Results |
|---|
|
|
|---|
Glucose transport in skeletal muscle can be activated by insulin-dependent and insulin-independent mechanisms. Here we confirm our earlier results (Ryder et al. 2003) showing that skeletal muscle remodelling by activation of calcineurin in transgenic mice improves insulin-stimulated glucose transport in skeletal muscle (Fig. 1A). Insulin-stimulated 2-deoxyglucose uptake was increased 52% in EDL muscle from MCK-CnA*versus wild-type mice (P < 0.005). To determine whether the calcineurin-induced adaptations in the skeletal muscle phenotype impinge on putative AMPK-dependent glucose transport pathways, EDL muscles from wild-type and MCK-CnA* mice were treated with AICAR or forced to contract via electrical stimulation. AICAR increased glucose uptake 2.6-fold and 1.4-fold in EDL muscle from wild-type and MCK-CnA*, respectively (Fig. 1B). The AICAR effect on glucose transport in MCK-CnA* mice was 27% lower than observed in wild-type mice (P < 0.05). In contrast, in vitro muscle contraction-stimulated 2-deoxyglucose uptake was similar in wild-type and MCK-CnA* mice (Fig. 1C). Nonetheless, basal 2-deoxyglucose uptake was elevated in EDL muscle from MCK-CnA* mice, and this effect was significant in muscle subjected to a resting tension of 0.5 g (Fig. 1C). Due to this significant increase in basal glucose transport activity in MCK-CnA* mice, the incremental increase in contraction-mediated glucose transport was significantly reduced in MCK-CnA* mice (4.59 ± 0.37 versus 2.93 ± 0.54 nmol (mg protein)1 (20 min)1 for wild-type and MCK-CnA* mice, respectively, P < 0.05).
|
Phosphorylation of the AMPK
1/2 subunits was determined in EDL muscle from wild-type and MCK-CnA* mice following either AICAR treatment or in vitro muscle contraction. AICAR exposure increased AMPK phosphorylation in EDL muscle from wild-type mice 2.3-fold (Fig. 2A). The AICAR effect on AMPK phosphorylation was similar between wild-type and MCK-CnA* mice. Muscle contraction increased AMPK phosphorylation in EDL muscle from wild-type muscle 8.6-fold (Fig. 2B); however, the response was 62% lower in MCK-CnA* mice (P < 0.005). AICAR also increased ACC phosphorylation 2.3-fold in EDL muscle from wild-type mice, with comparable responses observed between genotypes under basal and AICAR-stimulated conditions (Fig. 3).
|
|
Isoform-specific expression of the catalytic AMPK
and regulatory AMPK
subunits was determined in EDL skeletal muscle from wild-type and MCK-CnA* mice. AMPK
1 protein content was increased 62% in MCK-CnA* compared to wild-type mice (P < 0.005), whereas the protein content of AMPK
2 was similar between the genotypes (Fig. 4). The AMPK
3 subunit is preferentially expressed in fast-twitch skeletal muscle (Mahlapuu et al. 2004) and is required for AICAR-stimulated glucose uptake (Barnes et al. 2004). Thus, we determined whether skeletal muscle fibre-type transformation from a fast- to slow-twitch phenotype via activation of calcineurin would alter the protein expression of AMPK
subunit isoforms (Fig. 5A). AMPK
1 protein expression was increased 36% and AMPK
3 protein expression was reduced 39% in MCK-CnA*versus wild-type mice (P < 0.05). In contrast, AMPK
2 protein expression was similar between the genotypes.
|
|
subunits
Quantitative real-time PCR was used to determine mRNA levels of AMPK
1, 2 and 3 isoforms in EDL skeletal muscle from wild-type and MCK-CnA* mice (Fig. 5B). AMPK
1 mRNA abundance was similar between the genotypes. In contrast, the mRNA level of AMPK
2 and AMPK
3 was decreased 33% (P < 0.05) and 40% (P < 0.005), respectively, in EDL muscle from MCK-CnA* compared to wild-type mice.
| Discussion |
|---|
|
|
|---|
MCK-CnA* mice have increased myosin ATPase activity and expression of myoglobin, TnI slow, and sarcomeric mitochondrial creatine kinase (Naya et al. 2000). While skeletal muscle remodelling from a fast-twitch glycolytic to a slow-twitch oxidative phenotype in MCK-CnA* mice is associated with enhanced insulin action on glucose uptake, the effect of AICAR on glucose uptake is reduced. This impairment in AICAR-stimulated glucose uptake in EDL muscles from MCK-CnA* mice provides evidence that induction of the slow-twitch muscle programme via activation of calcineurin leads to a down-regulation in AICAR-mediated glucose transport. This finding is consistent with studies that revealed a fibre-type-specific effect of AICAR on glucose transport. AICAR increases glucose transport in fast-twitch epitrochlearis muscle from fasted rats, but is without effect on glucose transport in slow-twitch rat soleus muscle (Kaushik et al. 2001; Ai et al. 2002). Since MCK-CnA* mice are also AICAR-resistant for glucose uptake, the fibre-type-specific response to AICAR appears to be partly controlled via calcineurin.
We next determined if reduced AICAR-mediated effects on glucose transport in MCK-CnA* mice occurred in concert with altered AMPK signal transduction. AICAR treatment increased AMPK phosphorylation to a similar extent in wild-type and MCK-CnA* mice. Therefore, changes in the level of AMPK phosphorylation fail to explain differences in AICAR-mediated glucose transport in MCK-CnA* mice. However, differential isoform-specific expression of AMPK subunits may determine fibre-type-specific effects of AICAR on glucose transport activity in skeletal muscle. For instance, expression of the AMPK
3 subunit is abundant in AICAR-responsive fast-twitch rat epitrochlearis muscle, but undetectable in AICAR-resistant slow-twitch soleus muscle (Mahlapuu et al. 2004; Yu et al. 2004). Furthermore, ablation of the AMPK
3 subunit in mouse skeletal muscle revealed that the expression of this subunit is required for AICAR-stimulated glucose uptake in fast-twitch EDL muscle (Barnes et al. 2004). Taken together, the AMPK
3 subunit is the predominant
isoform in fast-twitch muscle and appears to be essential for AICAR-mediated glucose uptake. We therefore hypothesized that induction of the slow-twitch muscle programme via the activation of calcineurin would decrease AMPK
3 expression, and render the muscle AICAR resistant for glucose transport. Examination of both the transcript and protein levels revealed significant reductions in the level of AMPK
3 expression. These data indicate that AMPK
3 plays a critical role in the AICAR response, as a partial reduction in AMPK
3 leads to reduced AICAR-mediated glucose transport. Furthermore, the results demonstrated that induction of the slow-twitch muscle programme through the activation of calcineurin is associated with a decrease in AMPK
3 expression. Our data provide evidence that the AMPK
3 subunit is regulated at transcriptional level by activated calcineurin, whereas other regulatory mechanisms, including post-transcriptional mechanisms and rates of protein degradation, could influence the protein expression of the AMPK
1 and
2 isoforms. Nevertheless, residual levels of AMPK
3 remain in MCK-CnA* EDL muscle, and this observation is consistent with a significant, although comparatively blunted, response to AICAR on glucose uptake.
While AMPK has been highlighted as a potential target regulating exercise/contraction-induced glucose transport, emerging evidence challenges this hypothesis (Mu et al. 2001; Barnes et al. 2004; Jorgensen et al. 2004). Overexpression of kinase-dead AMPK
2 in skeletal muscle, as well as genetic knockout of AMPK
2, results in a complete ablation of AICAR-mediated glucose transport, demonstrating that AMPK is essential for AICAR-mediated glucose uptake (Mu et al. 2001; Jorgensen et al. 2004). However, when the muscles of these two mouse models are forced to contract via electrical stimulation, the rate of glucose uptake is significantly increased (Mu et al. 2001; Jorgensen et al. 2004). Only a modest reduction in contraction-induced glucose transport is observed in AMPK kinase-dead transgenic compared to wild-type mice (Mu et al. 2001). More recently, evidence from AMPK
3 knockout mice challenged the role of AMPK as the mediator of contraction-induced glucose uptake. AMPK
3 knockout mice are completely AICAR resistant for glucose transport; however, the effect of in vitro muscle contraction on glucose transport is preserved (Barnes et al. 2004). Since genetic approaches offer the possibility of elucidating AMPK-dependent and -independent pathways in the regulation of glucose uptake, we further extended our analysis to determine the effects of skeletal muscle remodelling via calcineurin on contraction-mediated glucose transport. In contrast to AICAR stimulation, contraction-mediated glucose transport was similar between wild-type and MCK-CnA* mice, despite reduced AMPK phosphorylation. Taken together with AMPK
2 kinase-dead, AMPK
2 knockout and AMPK
3 knockout mice, our results in MCK-CnA* mice highlight important differences between AICAR- and contraction-mediated glucose transport in skeletal muscle. Thus an AMPK-independent signalling mechanism(s), such as calciumCaMK II, appears to be required for exercise/contraction-induced glucose transport (Wright et al. 2004). Importantly, improving skeletal muscle remodelling through activation of calcineurin is unlikely to have a negative impact on exercise-induced glucose transport, an important non-pharmacological intervention strategy to improve glucose disposal in insulin-resistant individuals.
In conclusion, calcineurin-induced skeletal muscle remodelling to a slow-twitch oxidative phenotype yields differential effects on insulin-, AICAR- and contraction-mediated responses on glucose transport in skeletal muscle. While insulin-stimulated glucose transport is enhanced in MCK-CnA* mice, skeletal muscle reprogramming via the activation of calcineurin reduces the expression of AMPK
3 and AICAR-mediated glucose uptake in skeletal muscle. In contrast, while the fold increase of contraction-mediated increase in glucose transport was reduced in MCK-CnA*, the absolute magnitude was similar, despite a reduction of AMPK phosphorylation. Our results provide further evidence for AMPK-independent effects of contraction on glucose transport in skeletal muscle. Furthermore, improvements in glucose transport via strategies to target the calcineurin pathway are limited to insulin action.
| References |
|---|
|
|
|---|
Barnes BR, Marklund S, Steiler TL, Walter M, Hjalm G, Amarger V, Mahlapuu M, Leng Y, Johansson C, Galuska D, Lindgren K, Abrink M, Stapleton D, Zierath JR & Andersson L (2004). The AMPK-gamma 3 isoform has a key role for carbohydrate and lipid metabolism in glycolytic skeletal muscle. J Biol Chem 279, 3844138447.
Barnes BR, Ryder JW, Steiler TL, Fryer LGD, Carling D & Zierath JR (2002). Isoform-specific regulation of 5'-AMP-activated protein kinase in skeletal muscle from obese Zucker (fa/fa) rats in response to contraction. Diabetes 51, 27032708.
Cheung PC, Salt IP, Davies SP, Hardie DG & Carling D (2000). Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP binding. Biochem J 346, 659669.[CrossRef][Medline]
Daugaard JR, Nielsen JN, Kristiansen S, Andersen JL, Hargreaves M & Richter EA (2000). Fiber type-specific expression of GLUT4 in human skeletal muscle: influence of exercise training. Diabetes 49, 10921095.[Abstract]
Hardie DG & Carling D (1997). The AMP-activated protein kinase fuel gauge of the mammalian cell?Eur J Biochem 246, 259273.[Medline]
Hayashi T, Hirshman MF, Kurth EJ, Winder WW & Goodyear LJ (1998). Evidence for 5'-AMP-activated protein kinase mediation of the effect of muscle contraction on glucose transport. Diabetes 47, 13691373.[Abstract]
Henriksen EJ, Bourey RE, Rodnick KJ, Koranyi L, Permutt MA & Holloszy JO (1990). Glucose transporter protein content and glucose transport capacity in rat skeletal muscles. Am J Physiol 259, E593E598.[Medline]
Hutber CA, Hardie DG & Winder WW (1997). Electrical stimulation inactivates muscle acetyl-CoA carboxylase and increases AMP-activated protein kinase. Am J Physiol 272, E262E266.[Medline]
Jorgensen SB, Viollet B, Andreelli F, Frosig C, Birk JB, Schjerling P, Vaulont S, Richter EA & Wojtaszewski JF (2004). Knockout of the alpha2 but not alpha1 5'-AMP-activated protein kinase isoform abolishes 5-aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside but not contraction-induced glucose uptake in skeletal muscle. J Biol Chem 279, 10701079.
Kaushik VK, Young ME, Dean DJ, Kurowski TG, Saha AK & Ruderman NB (2001). Regulation of fatty acid oxidation and glucose metabolism in rat soleus muscle: effects of AICAR. Am J Physiol Endocrinol Metab 281, E335E340.
Koistinen HA, Galuska D, Chibalin AV, Yang J, Zierath JR, Holman GD & Wallberg-Henriksson H (2003). 5-Amino-imidazole carboxamide riboside increases glucose transport and cell-surface GLUT4 content in skeletal muscle from subjects with Type 2 diabetes. Diabetes 52, 10661072.
Lee AD, Hansen PA & Holloszy JO (1995). Wortmannin inhibits insulin-stimulated but not contraction-stimulated glucose transport activity in skeletal muscle. FEBS Lett 361, 5154.[CrossRef][Medline]
Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R & Spiegelman BM (2002). Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature 418, 797801.[CrossRef][Medline]
Mahlapuu M, Johansson C, Lindgren K, Hjalm G, Barnes BR, Krook A, Zierath JR, Andersson L & Marklund S (2004). Expression profiling of the gamma-subunit isoforms of AMP-activated protein kinase suggests a major role for gamma3 in white skeletal muscle. Am J Physiol Endocrinol Metab 286, E194E200.
Merrill GF, Kurth EJ, Hardie DG & Winder WW (1997). AICA riboside increases AMP-activated protein kinase, fatty acid oxidation, and glucose uptake in rat muscle. Am J Physiol Endocrinol Metab 273, E1107E1112.
Mu J, Brozinick JT Jr, Valladares O, Bucan M & Birnbaum MJ (2001). A role for AMP-activated protein kinase in contraction- and hypoxia-regulated glucose transport in skeletal muscle. Mol Cell 7, 10851094.[CrossRef][Medline]
Naya FJ, Mercer B, Shelton J, Richardson JA, Williams RS & Olson EN (2000). Stimulation of slow skeletal muscle fiber gene expression by calcineurin in vivo. J Biol Chem 275, 45454548.
O'Keefe SJ, Tamura J, Kincaid RL, Tocci MJ & O'Neill EA (1992). FK-506- and CsA-sensitive activation of the interleukin-2 promoter by calcineurin. Nature 357, 692694.[CrossRef][Medline]
Pette D (2001). Plasticity in skeletal, cardiac, and smooth muscle: historical perspectives: plasticity of mammalian skeletal muscle. J Appl Physiol 90, 11191124.
Ryder JW, Bassel-Duby R, Olson EN & Zierath JR (2003). Skeletal muscle reprogramming by activation of calcineurin improves insulin action on metabolic pathways. J Biol Chem 278, 4429844304.
Ryder JW, Fahlman R, Wallberg-Henriksson H, Alessi DR, Krook A & Zierath JR (2000). Effect of contraction on mitogen-activated protein kinase signal transduction in skeletal muscle. Involvement of the mitogen- and stress-activated protein kinase 1. J Biol Chem 275, 14571462.
Song XM, Ryder JW, Kawano Y, Chibalin AV, Krook A & Zierath JR (1999). Muscle fiber type specificity in insulin signal transduction. Am J Physiol 277, R1690R1696.[Medline]
Thornton C, Snowden MA & Carling D (1998). Identification of a novel AMP-activated protein kinase beta subunit isoform that is highly expressed in skeletal muscle. J Biol Chem 273, 1244312450.
Tomas E, Tsao T-S, Saha AK, Murrey HE, Zhang CC, Itani SI, Lodish HF & Ruderman NB (2002). Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: Acetyl-CoA carboxylase inhibition and AMP-activated protein kinase activation. Proc Natl Acad Sci U S A 99, 1630916313.
Verhoeven AJ, Woods A, Brennan CH, Hawley SA, Hardie DG, Scott J, Beri RK & Carling D (1995). The AMP-activated protein kinase gene is highly expressed in rat skeletal muscle. Alternative splicing and tissue distribution of the mRNA. Eur J Biochem 228, 236243.[Medline]
Winder WW & Hardie DG (1996). Inactivation of acetyl-CoA carboxylase and activation of AMP-activated protein kinase in muscle during exercise. Am J Physiol 270, E299E304.[Medline]
Winder WW & Hardie DG (1999). AMP-activated protein kinase, a metabolic master switch: possible roles in Type 2 diabetes. Am J Physiol Endocrinol Metab 277, E1E10.
Wright DC, Hucker KA, Holloszy JO & Han DH (2004). Ca2+ and AMPK both mediate stimulation of glucose transport by muscle contractions. Diabetes 53, 330335.
Wu H, Kanatous SB, Thurmond FA, Gallardo T, Isotani E, Bassel-Duby R & Williams RS (2002). Regulation of mitochondrial biogenesis in skeletal muscle by CaMK. Science 296, 349352.
Yu H, Fujii N, Hirshman MF, Pomerleau JM & Goodyear LJ (2004). Cloning and characterization of mouse 5'-AMP-activated protein kinase gamma3 subunit. Am J Physiol Cell Physiol 286, C283C292.
| Acknowledgements |
|---|
This article has been cited by other articles:
![]() |
Y. C. Long and J. R. Zierath Influence of AMP-activated protein kinase and calcineurin on metabolic networks in skeletal muscle Am J Physiol Endocrinol Metab, September 1, 2008; 295(3): E545 - E552. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Rogoff, J. W. Ryder, K. Black, Z. Yan, S. C. Burgess, D. R. McMillan, and P. C. White Abnormalities of Glucose Homeostasis and the Hypothalamic-Pituitary-Adrenal Axis in Mice Lacking Hexose-6-Phosphate Dehydrogenase Endocrinology, October 1, 2007; 148(10): 5072 - 5080. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guha, S. Srinivasan, G. Biswas, and N. G. Avadhani Activation of a Novel Calcineurin-mediated Insulin-like Growth Factor-1 Receptor Pathway, Altered Metabolism, and Tumor Cell Invasion in Cells Subjected to Mitochondrial Respiratory Stress J. Biol. Chem., May 11, 2007; 282(19): 14536 - 14546. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Fujii, N. Jessen, and L. J. Goodyear AMP-activated protein kinase and the regulation of glucose transport Am J Physiol Endocrinol Metab, November 1, 2006; 291(5): E867 - E877. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Wijesekara, A. Tung, F. Thong, and A. Klip Muscle cell depolarization induces a gain in surface GLUT4 via reduced endocytosis independently of AMPK Am J Physiol Endocrinol Metab, June 1, 2006; 290(6): E1276 - E1286. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |