HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 567/2/415    most recent jphysiol.2005.086546v1 Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by de la Peña, E. Articles by Viana, F. Search for Related Content PubMed PubMed Citation Articles by de la Peña, E. Articles by Viana, F.

¹ Instituto de Neurociencias de Alicante, Universidad Miguel Hernández-CSIC, Apartado 18, San Juan de Alicante 03550, Spain

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Different classes of ion channels have been implicated in sensing cold temperatures at mammalian thermoreceptor nerve endings. A major candidate is TRPM8, a non-selective cation channel of the transient receptor potential family, activated by menthol and low temperatures. We investigated the role of TRPM8 in cold sensing during transient expression in mouse cultured hippocampal neurones, a tissue that lacks endogenous expression of thermosensitive TRPs. In the absence of synaptic input, control hippocampal neurones were not excited by cooling. In contrast, all TRPM8-transfected hippocampal neurones were excited by cooling and menthol. However, in comparison to cold-sensitive trigeminal sensory neurones, hippocampal neurones exhibited much lower threshold temperatures, requiring temperatures below 27°C to fire action potentials. These results directly demonstrate that expression of TRPM8 in mammalian neurones induces cold sensing, albeit at lower temperatures than native TRPM8-expressing neurones, suggesting the presence of additional modulatory mechanisms in the cold response of sensory neurones.

(Received 14 March 2005; accepted after revision 11 June 2005; first published online 16 June 2005)
Corresponding author E. de la Peña: Instituto de Neurociencias de Alicante, Universidad Miguel Hernández-CSIC, Apartado 18, San Juan de Alicante, 03550 Spain.  Email: elvirap{at}umh.es

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Peripheral endings of thermal sensory neurones innervating the body surface act as cellular sensors for temperature, transducing the changes in thermal energy into an electrical signal (Hensel, 1981; Spray, 1986). Following the landmark demonstration of the role of the capsaicin-sensitive vanilloid receptor (TRPV1) in the detection of noxious heat (Caterina et al. 1997), several other mammalian TRP channels have been implicated in temperature sensing (reviewed by Benham et al. 2003; Jordt et al. 2003). More recent studies have examined the cellular and molecular mechanisms involved in the transduction of cold temperatures by peripheral sensory endings (reviewed by Patapoutian et al. 2003; Jordt et al. 2003; Reid, 2005). An important finding was the cloning of TRPM8, a non-selective, calcium-permeable cation channel of the transient receptor potential family that is activated by cooling and menthol (McKemy et al. 2002; Peier et al. 2002). The role of TRPM8 in cold sensing in primary sensory neurones is supported by several lines of evidence: (i) TRPM8 is expressed selectively in a small population of primary sensory neurones (McKemy et al. 2002; Peier et al. 2002) with specific electrophysiological properties (Viana et al. 2002; Reid et al. 2002); (ii) most cold-sensitive neurones are also excited by menthol (McKemy et al. 2002; Reid et al. 2002; Viana et al. 2002; Nealen et al. 2003; Thut et al. 2003), the specific ligand for this channel; and (iii) the same neurones also express TRPM8-mRNA transcripts (Nealen et al. 2003). Moreover, many cold-sensitive neurones express a non-selective cation current (I_cold) with biophysical and pharmacological properties consistent with the properties of TRPM8-dependent currents in transfected cells (Okazawa et al. 2002; Reid et al. 2002).

Yet, these findings do not establish an essential or unique role for TRPM8 in cold sensing. Several lines of evidence point to the presence of additional cold-sensing mechanisms in primary sensory neurones. Firstly, the remarkable temperature sensitivity and high threshold temperature of isolated cold-sensitive nerve endings (Brock et al. 2001; Carr et al. 2003) and the temperature threshold of the endogenous I_cold current in cultured primary sensory neurones (Reid et al. 2002) do not match with the relatively low threshold temperature of TRPM8-dependent currents in heterologously transfected cells (<26°C). These differences in threshold can be interpreted as evidence for the presence of a cold sensor in nerve terminals operating in a higher temperature range than TRPM8, but could also be due to modulatory actions operating on TRPM8 itself (see Reid, 2005). Secondly, the sole expression of TRPM8 cannot readily explain the broad range of temperature thresholds observed in the population of sensory afferents responding to cold. The fact that many cold-sensitive neurones with a low threshold temperature lack TRPM8 expression (Nealen et al. 2003; Babes et al. 2004), and the presence of cold-sensitive nociceptors excited only by temperatures below 10–15°C, provide strong evidence for the presence of alternative cold sensors. A second member of the TRP family, named TRPA1 (formerly ANKTM1), is activated by much lower temperatures than TRPM8 and has been suggested to be important in the transduction of strong (painful) cooling stimuli (Story et al. 2003). Recently, the involvement of TRPA1 in cold sensitivity of sensory neurones has been questioned (Babes et al. 2004; Jordt et al. 2004).

ENaC, a member of the amiloride-sensitive epithelial sodium channel family, is another molecular candidate for the excitatory actions of cold temperatures (Askwith et al. 2001). Other TRP-independent ionic mechanisms, such as the closure of background potassium channels, may also participate in cold sensing (Maingret et al. 2000; Reid & Flonta, 2001; Viana et al. 2002; Kang et al. 2005). Data from our group also showed that expression of slowly inactivating potassium channels in many sensory neurones acts as a molecular excitability brake, reducing cold sensitivity (Viana et al. 2002; Cabanes et al. 2003). These different cold-sensing mechanisms are not mutually exclusive, and their relative contribution to the high sensitivity to cooling, exhibited by the small subset of primary sensory neurones that mediate innocuous cold detection, is still unknown.

The properties of TRPM8 channels have been characterized in some detail during expression in mammalian cell lines and oocytes (McKemy et al. 2002; Peier et al. 2002; Andersson et al. 2004; Brauchi et al. 2004; Voets et al. 2004; Liu & Qin, 2005). However, these cells lack many of the features of a neurone, like intrinsic excitability, non-linear membrane properties and complex morphology. Many aspects of lipid-mediated signalling are also particular to nervous cells. Since these factors could affect the functional properties of TRPM8 channels (e.g. temperature threshold), studying them in a neuronal environment may provide clues about the differences observed between native cold-sensitive currents and TRPM8 channels. The hippocampus, a tissue lacking native expression of cold-sensitive TRPs, provides a suitable system to explore the contribution of TRPM8 to cold transduction in a neuronal context. We used hippocampal neurones, genetically modified to express TRPM8, and found that all TRPM8(+) hippocampal neurones respond de novo to strong cooling (threshold below 27°C) in contrast with the high threshold temperature (>31°C) characteristic of many cold-sensitive neurones of the trigeminal ganglion.

These results support the prevailing vision that assigns an important role to TRPM8 channels in neuronal cold sensing. Yet, they also reveal important functional differences between native cold-sensitive neurones and TRPM8-dependent cold responses, suggesting that additional mechanisms contribute to establishing the temperature threshold and response characteristics of thermal sensory neurones detecting innocuous cold.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
RNA extraction and RT-PCR

Total RNA was isolated from OF-1 mice hippocampus (embryonic day (E)14.5), trigeminal ganglia (E19) and dorsal root ganglia (2 months postnatal (PN)) with the RNeasy Mini Kit (QIAGEN) as recommended by the supplier. Next, 5 µg of total RNA were random primed and reverse transcribed to cDNA using the 1st Strand cDNA Synthesis Kit for RT-PCR (Roche). Control reactions were performed by omitting the reverse transcriptase. First strand cDNA was PCR amplified with specific primers for mouse TRPM8 (trpm8 sense ATGAGCACAACCTGCCCCGCTTC and trpm8 antisense GTGTCCCATGAGCCTCCACATC, amplified fragments of 563 bp), and TRPA1 (trpa1 sense CCCCATTGCTTTCCTTAATCCAG and trpa1 antisense CCTGTCTTGGAAAGAGCAATGG, amplified fragments of 568 bp). The quality of cDNA synthesis was checked by amplifying the housekeeping gene ß-actin (ß-actin sense GAATGGGTCAGAAGGACTCC and ß-actin antisense GCCTGGGTACATGGTGGTACCACC, amplified fragments of 787 bp). Ten per cent of the PCR amplification was submitted to agarose gel electrophoresis and detected with ethidium bromide.

Cloning of TRPM8 in pCINeo/IRES-GFP

The bicistronic vector pcINeo/IRES-GFP was provided by Jan Eggermont (KU, Leuven) and pcDNA3-TRPM8 was made available by David Julius (University of California, San Francisco). The ORF of TRPM8 was obtained by digestion with KpnI and NotI, polished with Pfu polymerase and cloned into the bicistronic vector pcINeo/IRES-GFP digested with EcoRI and blunt ended with the Klenow fragment of the DNA polymerase. The construct was verified by automatic sequencing.

Culture of HEK293 cells and neurones

HEK293 cells were obtained from the ECACC (Salisbury, UK). Cells were cultured in DMEM containing 10% of fetal bovine serum and plated on 2 cm² wells at 400 000 cells well^–1. Between 20 and 24 h after plating, the cells were transfected with plasmid DNA using Lipofectamine^TM 2000 (Invitrogen); 2 µg DNA and 3 µl lipofectamine per well, respectively. Then, 24–48 h post-transfection, cells were trypsinized and replated on laminin-coated round coverslips (12 mm diameter) at 80 000 cells coverslip^–1; 24–48 h post-transfection, green fluorescent protein (+) (GFP(+)) cells were selected for intracellular calcium measurements and electrophysiological recordings.

Pregnant female mice were anaesthetized with ether and killed by decapitation, following EU and institutional guidelines. The hippocampus was dissected from the cerebrum of the 14.5-day-old embryos. After mechanical dissociation with a fire-polished Pasteur pipette, the cells were plated on ornithine/laminin-coated round coverslips at 500 000 cells coverslip^–1. After 2 days in DMEM supplemented with 10% FBS, 10% horse serum, 0.2% glucose and penicillin/streptomycin 1000 U ml^–1, the culture medium was changed to DMEM supplemented with B-27, 0.2% glucose and penicillin/streptomycin 1000 U ml^–1. Then, 2–7 days after plating, neurones were transfected with plasmid DNA and Lipofectamine^TM 2000 (same quantities as above), and 24–48 h post-transfection, GFP(+) neurones were selected for intracellular calcium measurements and electrophysiological recordings. Trigeminal ganglion neurones from neonatal mice were cultured as previously described (Viana et al. 2001).

Electrophysiology

Cell-attached and whole-cell voltage- or current-clamp recordings were performed simultaneously with temperature recordings. During current-clamp recordings, the membrane potential was manually clamped to an initial value of –60 mV by injection of small DC currents; the same level of polarizing current was kept throughout the experiment. The bath solution contained (mM): 140 NaCl, 3 KCl, 1.3 MgCl₂, 2.4 CaCl₂, 10 Hepes, 10 glucose, and had a pH of 7.4. Standard patch-pipettes (3–6 M) contained (mM): 140 KCl, 10 NaCl, 4 Mg-ATP, 0.4 Li-GTP, 10 Hepes (300 mOsmol kg^–1, pH 7.3 adjusted with KOH). Current and voltage signals were recorded with an EPC-8 patch-clamp amplifier (Heka Elektronik, Lambrecht/Pfalz, Germany). Stimulus delivery and data acquisition were performed using pClamp 8 software (Axon Instruments, Union City).

To block synaptic transmission, hippocampal recordings were performed in the presence of a mixture of blockers for ionotropic glutamate (50 µM APV + 20 µM CNQX) and GABA_A (5 µM bicuculline) receptors.

Temperature stimulation

Coverslip pieces with cultured cells were placed in a microchamber and continuously perfused (2–3 ml min^–1) with solutions warmed at 34 ± 1°C. The temperature was adjusted with a water-cooled Peltier device placed at the inlet of the chamber and controlled by a feedback device. Cold sensitivity was investigated with a 100 s temperature drop to 18 ± 2°C, as shown in Fig. 1A.

View larger version (14K): [in this window] [in a new window]   Figure 1.  Characterization of cold and menthol sensitivity of TRPM8-transfected HEK293 cells using [Ca2+]i imaging A, ratiometric (340 nm/380 nm) [Ca2+]i responses of three individual HEK293 cells during a cooling stimulus in the presence and absence of 100 µM menthol. Only GFP(+) cells (red and green traces) responded with a [Ca2+]i elevation during cooling to 17°C. In the presence of menthol at 35°C, [Ca2+]i increased in 79% of the GFP(+) cells. In the remaining cells, the response to cooling was shifted towards higher temperatures. B, effect of menthol (100 µM) on [Ca2+]i elevation and temperature threshold evoked by a staircase of decreasing temperatures (black trace) in TRM8(+) HEK293 cells. C, temperature–response curve of [Ca2+]i elevation in TRPM8(+) HEK293 cells: data obtained in the same cells in the absence (•, control) and presence () of 100 µM menthol, respectively (n= 14). [Ca2+]i-values have been normalized to the control response at the minimum temperature (18°C). Error bars indicate S.E.M. Both data sets have been fitted to the Boltzmann equation: Ca2+=Ca2+max/(1 + exp((T–T0.5)/dT)), where T= temperature (°C) and T0.5= temperature at 50% response. For control and menthol, the values were: Ca2+max= 1.15 and 1.38; T0.5= 21.7 and 32.9°C; dT= 1.9 and 1.0°C, respectively.

Neurones were incubated with 5 µM fura-2AM dissolved in standard extracellular solution and 0.02% Pluronic (both from Molecular Probes Europe, Leiden, The Netherlands) for 30 min at 37°C. Fluorescence measurements were made with a Zeiss Axioskop FS upright microscope fitted with an OrcaER CCD camera (Hamamatsu). Fura-2 was excited at 340 nm and 380 nm with a Polychrome IV monochromator (Till Photonics, Gräfelfing, Germany) and the emitted fluorescence was filtered with a 510 nm longpass filter. Calibrated ratios were displayed online with Metafluor software (Universal Imaging). The bath temperature was sampled simultaneously (see below), and threshold temperature values for [Ca²⁺]_i elevation were estimated by linearly interpolating the temperature at the midpoint between the last baseline point and the first point at which a rise in [Ca²⁺]_i deviated by at least four times the standard deviation of the baseline.

Reagents

Bicuculline methiodide (BIC) and adenosine-5'-triphosphate (ATP) were purchased from Sigma-Aldrich (Tres Cantos, Spain). DL-2-amino-5-phosphonopentanoic acid (APV) and 6-cyano-7-nitroquinoxaline-2,3-dione disodium (CNQX) were purchased from Tocris Cookson (Bristol, UK), and l-menthol from Scharlau Chemie (Barcelona, Spain).

Data are reported as mean ± standard error of the mean (S.E.M.). Statistical significance (P < 0.05) was assessed by Student's t test.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Cold and menthol sensitivity of TRPM8-transfected HEK293 cells

To investigate the temperature and menthol sensitivity of the TRPM8 protein, we subcloned a full-length cDNA of TRPM8 from rat in a bicistronic vector with GFP as the reporter molecule, and transiently transfected it into HEK293 cells. Because TRPM8 is calcium permeable (McKemy et al. 2002), we used fura-2 calcium imaging to establish the amplitude and temperature threshold of the response of single intact cells to cold and menthol applications. During ramp-like reductions in temperature from a holding temperature of 35°C, only GFP(+), and hence TRPM8(+), HEK293 cells showed an increase in cytoplasmic calcium [Ca²⁺]_i in response to cooling (Fig. 1A). The mean temperature threshold of the response was 24.0 ± 0.3°C (n= 105). At 35°C, 100 µM menthol elevated [Ca²⁺]_i in 79% of TRPM8(+) HEK293 cells. In the remaining 21%, menthol produced a notable shift in the temperature threshold (mean = 31 ± 1°C). The effect of menthol on cold-evoked response was also examined during stepwise reductions in temperature (Fig. 1B). At mid-amplitude, the positive shift in the temperature–response curve produced by 100 µM menthol was 11°C, while the amplitude of the response increased only modestly (Fig. 1C).

Cold and menthol sensitivity of TRPM8-transfected hippocampal neurones

To assess the specific role of TRPM8 in neuronal temperature transduction we performed experiments on mouse hippocampal cultures transiently expressing TRPM8. First, we used RT-PCR to verify that the genes of the cold-sensitive TRPs, TRPM8 and TRPA1, were not expressed in embryonic (E14.5) hippocampal tissue (see Methods). Neither TRPM8 nor TRPA1 mRNAs were detected in significant amounts in hippocampus (Fig. 2). In contrast, embryonic (E19) trigeminal ganglia and adult dorsal root ganglia expressed both transcripts using the same RT-PCR conditions.

View larger version (41K): [in this window] [in a new window]   Figure 2.  TRPM8 and TRPA1 mRNAs are not expressed in mouse hippocampus RNA from hippocampus, trigeminal and dorsal root ganglia was reverse transcribed (+RT) and PCR amplified with specific primers (see Methods). An amplicon for both TRP channels was obtained from trigeminal ganglia and dorsal root ganglia, but not from hippocampus. The adequate synthesis of the cDNA was checked by amplifying the housekeeping gene ß-actin. The absence of amplification when the reverse transcriptase is omitted (–RT), rules out the possibility of genomic DNA contamination.

View larger version (26K): [in this window] [in a new window]   Figure 3.  Characterization of cold and menthol sensitivity of TRPM8-transfected hippocampal neurones using [Ca2+]i imaging A, simultaneous recording of [Ca2+]i (upper trace) and bath temperature (lower trace) in two hippocampal neurones, stimulated with 30 mM KCl, cooling and 100 µM menthol. B, optical field showing the fura-2 fluorescence excited at 380 nm (upper image) and the GFP fluorescence excited at 470 nm (lower image). The [Ca2+]i responses of neurones labelled 1 and 2 are shown in A. Note that only the GFP(+) neurone responds to cooling and menthol. Calibration bar equals 20 µm. C, summary of [Ca2+]i responses in TRPM8(+) HEK293 cells and TRPM8(+) hippocampal neurones to 30 mM KCl (K+), cooling to 20°C, 100 µM menthol at 33°C, and the simultaneous application of cooling and menthol. Responses in hippocampal neurones were determined in control solution and in the presence of a mixture of synaptic transmission blockers (50 µM APV, 20 µM CNQX and 5 µM bicuculline). The amplitudes of responses in the presence of blockers were significantly smaller (P < 0.01, unpaired t test). Error bars indicate S.E.M.

Next, we used whole-cell patch-clamp recordings to characterize membrane responses induced by temperature changes and menthol application in control (i.e. untransfected) and TRPM8(+) hippocampal neurones. Recorded cells were characterized electrophysiologically to establish their firing phenotype during injection of current pulses. All of the cells were able to fire action potentials in response to depolarizing pulses (Fig. 4C).

View larger version (28K): [in this window] [in a new window]   Figure 4.  Control hippocampal neurones are not excited by cooling A, simultaneous recording of membrane potential (upper trace) and bath temperature (lower trace) during a cooling ramp to 15°C in an untransfected hippocampal neurone. The entire recording was obtained in the presence of a mixture of synaptic transmission blockers (5 µM bicuculine, 50 µM APV and 20 µM CNQX). Membrane input resistance was monitored with repetitive injection of a 240 ms–25 pA current pulse every 5 s. Note that coapplication of 100 µM menthol had no further depolarizing effect on the membrane potential. B, superimposed voltage responses to the –25 pA pulse at 35°C and at 20°C. C, firing properties of the same neurone at 35°C.

The results of cooling on membrane potential were markedly different in untransfected versus TRPM8(+) neurones. In untransfected cells, half of the cells hyperpolarized (mean =–6.3 ± 1.9 mV) and half depolarized (mean = 6.5 ± 2.5 mV) during cooling (n= 8). However, depolarizations were modest and in no case did they reach firing threshold. All effects on membrane potential were reversible upon re-warming (Figs 4A and 5A).

View larger version (33K): [in this window] [in a new window]   Figure 5.  TRPM8 expression induces novel cold and menthol sensitivity in hippocampus A, simultaneous recording of membrane potential (upper trace) and bath temperature (lower trace) during cooling ramps in a TRPM8-GFP (+) hippocampal neurone. The GFP fluorescence image is shown in the inset (calibration bar = 10 µm). The application of menthol (100 µM) is marked by the horizontal solid bars. Membrane input resistance was monitored with repetitive injection of a 240 ms –25 pA current pulse every 5 s. The entire recording was obtained in a mixture of GABAA and ionotropic glutamate receptor blockers (see Methods). Vertical arrows mark the temperature-threshold for firing. B, simultaneous recording of membrane current (upper trace) (Vhold=–60 mV) and bath temperature (lower trace) during a cooling step in the same hippocampal neurone. Note the small inward current induced by cold, and the large reversible inward current induced by 100 µM menthol. C, average cold-evoked current (Icold) in TRPM8(+) hippocampal neurones and cold-sensitive trigeminal neurones recorded at 20°C. D, average menthol-evoked current (Imenthol) in TRPM8(+) hippocampal neurones and cold-sensitive trigeminal neurones recorded at 20°C. Error bars indicate S.E.M.; *P < 0.05 (Student's t test); **P < 0.01 (Student's t test).

The excitatory actions of artificial TRPM8 expression were corroborated during whole-cell voltage-clamp recordings. In TRPM8(+) hippocampal neurones, voltage clamped at a holding potential of –60 mV, cooling produced a detectable inward current in 6 out of 11 cells studied (mean amplitude –51 ± 21 pA; current density –4.0 ± 1.3 pA pF^–1) (Fig. 5B and C). In all cases, currents were slowly rising, approaching saturation values as the final temperature neared. In the remaining five neurones, a small outward current was recorded (mean amplitude 11 ± 3 pA; 0.6 ± 0.2 pA pF^–1). In all TRPM8(+) neurones investigated (n= 11), menthol, applied at 20°C, produced a large-amplitude inward current (mean –478 ± 52 pA; current density –32.1 ± 4.1 pA pF^–1) (Fig. 5B and D). For comparison, we also measured cold- and menthol-activated currents in cold-sensitive neonatal trigeminal neurones under identical recording conditions. In 16 of 22 cold-sensitive neonatal trigeminal neurones, a net inward current was detected during cooling (mean amplitude =–81 ± 16 pA; density –8.7 ± 2 pA pF^–1), significantly larger than what was observed in the hippocampal neurones (P < 0.005; Fig. 5C). In the remaining six neurones, a small outward current (mean = 11 ± 2 pA; current density 1.2 ± 0.2 pA pF^–1) was recorded. Application of menthol was tested at 20°C and produced a significant inward current in all trigeminal neurones investigated. However, the amplitude (and density) of the menthol-sensitive current was significantly smaller in trigeminal neurones (mean amplitude = 152 ± 64 pA; current density = 13.8 ± 5.1 pA pF^–1) compared with TRPM8(+) hippocampal neurones (P < 0.01) (Fig. 5D). These results show that trigeminal neurones have larger I_cold currents at 20°C than transfected hippocampal neurones, despite an apparently higher level of expression of functional TRPM8 channels in the latter class of neurones.

Trigeminal ganglion neurones have markedly higher sensitivity to cooling

Most cold-sensitive trigeminal neurones are also excited by menthol, suggesting there is endogenous expression of TRPM8 in these cells (McKemy et al. 2002; Viana et al. 2002). However, many are also excited by minimal reductions in temperature, 7–8°C above the temperature activation threshold reported for TRPM8 channels expressed heterologously (McKemy et al. 2002; Peier et al. 2002; Andersson et al. 2004) (see above). Thus, we decided to compare temperature thresholds between mouse trigeminal sensory neurones and TRPM8(+) hippocampal neurones recorded in the cell-attached configuration under identical conditions. This recording configuration should minimize alterations in the intracellular milieu produced by whole-cell dialysis that could alter the temperature threshold and the robustness of the neuronal response to cooling. Cold-sensitive neurones in the trigeminal ganglion were identified with fluorimetric [Ca²⁺]_i-imaging techniques (Fig. 6D) as reported previously (Viana et al. 2002).

View larger version (30K): [in this window] [in a new window]   Figure 6.  Trigeminal ganglion neurones exhibit significantly higher threshold temperatures than TRPM8(+) hippocampal neurones TRPM8(+) hippocampal neurones (A) and cold-sensitive trigeminal ganglion neurones (B) were recorded in the cell-attached mode of the patch-clamp technique (upper trace) during cooling ramps (lower trace), in the presence of synaptic transmission blockers. The arrows mark the temperature threshold for firing of action potentials. C, cumulative distribution of active neurones as a function of bath temperature. TRPM8(+) hippocampal neurones are plotted as blue circles and the cold-sensitive trigeminal ganglion neurones as red triangles. D, cold-sensitive trigeminal neurones were identified by their reversible [Ca2+]i elevations during cooling. The [Ca2+]i trace corresponds to the same neurone as in B, before electrophysiological recordings. The insets show pseudocolor images of the same trigeminal neurone (arrowhead) at 35°C and 28°C, and after rewarming to 35°C. The calibration bar equals 10 µm.

The differences in temperature threshold between hippocampal and trigeminal neurones observed in cell-attached mode were confirmed during whole-cell recordings. The mean threshold of the cold-evoked current (I_cold) in TRPM8(+) hippocampal neurones was 26.3 ± 1.4°C (n= 6). In trigeminal neurones with phenotypical properties characteristic of low-threshold thermoreceptors, and presumably TRPM8(+) (e.g. menthol sensitivity and or sharp calcium elevations upon cooling), the mean threshold of I_cold was 31.7 ± 0.9°C (n= 7). These mean values were statistically different (P < 0.05).

Modest effect of 4-AP on thermosensitivity of TRPM8(+) hippocampal neurones

Recently, we demonstrated that expression of a highly 4-aminopyridine (4-AP)-sensitive voltage-gated K⁺ current (I_KD) in many sensory neurones modulates their temperature threshold to cooling (Viana et al. 2002). In six hippocampal neurones we employed the same protocol used previously to uncover I_KD in trigeminal ganglion (see Viana et al. 2002). None of the cells tested showed a current with the kinetic or pharmacological features characteristic of I_KD: three cells had a fast, transient K⁺ current (I_A) that was not blocked by 100 µM 4-AP, and the other three cells lacked transient K⁺ currents in the subthreshold voltage range. Consistent with this result, 100 µM 4-AP had only minor effects on the temperature threshold of TRPM8(+) hippocampal neurones. Thus, the mean temperature threshold increased in the presence of 4-AP, but the shift was modest, averaging 1.4 ± 0.4°C (P < 0.05; n= 7) (not shown).

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
Temperature sensing and regulation is critical for animal survival and adaptation to variable habitats. In this study, using lipid-driven delivery of TRPM8 cDNA, we were able to achieve the artificial activation of hippocampal neurones by cooling stimuli and menthol. However, in marked contrast with the sensitivity to moderate cooling characteristic of cutaneous cold thermoreceptors, TRPM8(+) hippocampal neurones were only excited by strong cooling stimuli (temperatures below 27°C), although they were readily excited by menthol, a specific chemical agonist of TRPM8 channels.

Effects of TRPM8(+) transfection on cold and menthol sensitivity in the hippocampus

All TRPM8-transfected hippocampal neurones were excited by cooling and menthol. These results confirmed the sensitivity of the channels to both agonists reported previously. Results from several groups, characterizing mammalian TRPM8 channels in oocytes and transfected cell lines, coincide in a temperature activation threshold of approximately 26°C (McKemy et al. 2002; Peier et al. 2002; Story et al. 2003; Andersson et al. 2004). This relatively low temperature for activation is entirely consistent with the cold-evoked firing threshold measured in TRPM8(+) hippocampal neurones in this study: all were excited by temperatures below 27°C. These results suggest that the temperature-dependent gating of transfected, homomeric TRPM8 channels is very similar in the diverse expression systems used. Thus, one has to look elsewhere to explain the fine sensitivity of mammalian cold thermoreceptors to temperature, characterized by spontaneous activity at normal skin temperature (34°C) and temperature-dependent modulation in their discharge rate in response to minimal reductions in temperature (Hensel, 1981; Carr et al. 2003).

In TRPM8-transfected hippocampal cultures, responses to menthol were clearly enhanced in the absence of synaptic transmission blockers. In addition to gating effects on TRPM8 channels, menthol has been shown to act directly on presynaptic Ca²⁺ stores, increasing the frequency of miniature EPSCs (mEPSCs) (Tsuzuki et al. 2004). Because hippocampal neurones branch extensively in the culture, even forming synapses on their own somas (autapsis), neurones excited by menthol could reinforce their activity via recurrent synaptic interactions.

Differences in cold sensitivity between sensory neurones and TRPM8-transfected cells

As is the case for cold thermoreceptors in vivo, many cold sensory neurones in culture have temperature firing thresholds that are well above the temperature activation threshold of TRPM8 currents measured in transfected cells (Viana et al. 2002; Reid et al. 2002; Thut et al. 2003). Yet, many of the same sensory neurones express TRPM8 channels. What causes this marked difference in temperature threshold between native I_cold currents and heterologously expressed TRPM8 channels? Is it due to changes in the gating behaviour of TRPM8 or to expression of other thermosensitive channels in sensory neurones? We excluded a lower density of TRPM8 channels in transfected hippocampal neurones versus sensory neurones as a plausible explanation to account for this difference, because all hippocampal cells showed very robust responses to menthol, the specific chemical agonist of TRPM8 channels.

Two recent studies (Voets et al. 2004; Brauchi et al. 2004) elucidated the issue of TRPM8 gating by cold temperatures. Both studies showed that activation of TRPM8 is not governed by a single temperature threshold, but strongly depends on transmembrane voltage: at depolarized potentials, TRPM8 channels are activated at higher temperatures than at more negative potentials. Furthermore, the cooling agent menthol mimics cold responses by shifting the voltage dependence of TRPM8 activation (Voets et al. 2004). Thus, a large difference in resting membrane potential could change the apparent threshold of TRPM8 activation. This is relevant for cold thermoreceptors in vivo since they fire spontaneously (Hensel, 1981): the cyclical depolarizations during the action potential could act as a positive feedback mechanism for TRPM8 activation. In this way, TRPM8 channels could play a role in the pacemaking of cold thermoreceptors. In this study, however, cold-sensitive sensory neurones and hippocampal neurones were quiescent, and temperature thresholds were determined from the same initial membrane potential.

Endogenous lipids have been shown to be potent modulators of various TRP channels, including TRPV1 (Zygmunt et al. 1999; Chuang et al. 2001), the first thermosensitive TRP discovered, and TRPV4 (Watanabe et al. 2003). In heterologous systems, TRPM8 activity is strongly regulated by phosphatidylinositol 4,5-biphosphate (PIP₂) (Liu & Qin, 2005). Another recent study showed that TRPM8 activation is inhibited by blockers of phospholipase C (Bandell et al. 2004). Thus, lipid signalling may influence TRPM8 activation, something yet to be proven in a physiological context. By analogy to other TRPs, the gating properties of TRPM8 channels could be influenced by phosphorylation (Premkumar & Ahern, 2000; Vellani et al. 2001; Numazaki et al. 2002). Such modulatory mechanisms may explain the temperature threshold discrepancy between the endogenous cold-induced currents in sensory neurones (I_cold), and the current activated by cold in recombinant systems expressing TRPM8 (both neuronal and non-neuronal). These hypothetical modulators would have to be expressed selectively in sensory neurones in order to explain their higher sensitivity to mild cooling stimuli.

Additional putative modulatory mechanisms of TRPM8 include the interaction with other cellular proteins. Given that TRPV1 and TRPV3 can associate when coexpressed in HEK293 cells (Smith et al. 2002), it is possible that native TRPM8 may form hetero-oligomers with other TRP channels. Alternatively, in sensory neurones, TRPM8 may interact with scaffolding proteins that are not expressed in hippocampal neurones. In many sensory transduction systems, cooperation between proteins assembled in a complex is essential for proper function. A clear example is the Drosophila phototransduction cascade (Montell, 1998).

Yet another possibility, based on genomic structure, is that TRPM8 may be expressed in several alternative spliced forms. Therefore, the strong temperature sensitivity of trigeminal neurones might be due to expression of a particular splice variant. However, the form we used for the hippocampal neurone transfection was the same that was isolated during an expression cloning strategy using a trigeminal ganglion cDNA library (McKemy et al. 2002), suggesting that this is likely to be the principal isoform in trigeminal ganglion.

Finally, cold sensitivity in sensory neurones may depend on the expression of particular sets of ion channels with variable temperature dependence, whose combination confers to the neurones a particular temperature threshold for discharge. A similar view has been put forward to explain the differential sensory responsiveness of individual neurones in C. elegans to nociceptive stimuli (Tobin et al. 2002). We showed previously that cold-sensitive trigeminal neurones are highly excitable, requiring less inward current to reach firing threshold compared to other trigeminal neurones, and express reduced levels of low-threshold voltage-gated K⁺ channels (Viana et al. 2002) that normally act as cellular brakes to excitability. The recent description of marked thermosensitivity of TREK-2 and TRAAK potassium channels (Kang et al. 2005), both present in sensory neurones, offers another potential mechanisms for cold sensing by thermoreceptors.

Studies of mutated TRP proteins (Greka et al. 2003; Prescott & Julius, 2003) and phenotypic analyses of knockout animals (Caterina et al. 2000; Freichel et al. 2001; Hoenderop et al. 2003; Tracey et al. 2003; Moqrich et al. 2005) have contributed greatly to our understanding of the functional roles of various TRP channels. Similar data for mammalian TRPM8 channels are eagerly awaited. Using a complementary approach, our results directly demonstrate that expression of TRPM8 in temperature-insensitive neurones confers cold sensitivity to them. However, which additional mechanisms, other than already known cold-sensitive TRP channels, govern temperature-dependent modulation of neuronal excitability, still remain to be determined.

	References

Top Abstract Introduction Methods Results Discussion References

 
Andersson DA, Chase HW & Bevan S (2004). TRPM8 activation by menthol, icilin, and cold is differentially modulated by intracellular pH. J Neurosci 24, 5364–5369.[Abstract/Free Full Text]

Askwith CC, Benson CJ, Welsh MJ & Snyder PM (2001). DEG/ENaC ion channels involved in sensory transduction are modulated by cold temperature. Proc Natl Acad Sci U S A 98, 6459–6463.[Abstract/Free Full Text]

Babes A, Zorzon D & Reid G (2004). Two populations of cold-sensitive neurons in rat dorsal root ganglia and their modulation by nerve growth factor. Eur J Neurosci 20, 2276–2282.[CrossRef][Medline]

Bandell M, Story GM, Hwang SW, Viswanath V, Eid SR, Petrus MJ, Earley TJ & Patapoutian A (2004). Noxious cold ion channel TRPA1 is activated by pungent compounds and bradykinin. Neuron 41, 849–857.[CrossRef][Medline]

Benham CD, Gunthorpe MJ & Davis JB (2003). TRPV channels as temperature sensors. Cell Calcium 33, 479–487.[CrossRef][Medline]

Brauchi S, Orio P & Latorre R (2004). Clues to understanding cold sensation: thermodynamics and electrophysiological analysis of the cold receptor TRPM8. Proc Natl Acad Sci U S A 101, 15494–15499.[Abstract/Free Full Text]

Brock J, Pianova S & Belmonte C (2001). Differences between nerve terminal impulses of polymodal nociceptors and cold sensory receptors of the guinea-pig cornea. J Physiol 533, 493–501.[Abstract/Free Full Text]

Cabanes C, Viana F & Belmonte C (2003). Differential thermosensitivity of sensory neurons in the guinea pig trigeminal ganglion. J Neurophysiol 90, 2219–2231.[Abstract/Free Full Text]

Carr RW, Pianova S, Fernandez J, Fallon JB, Belmonte C & Brock JA (2003). Effects of heating and cooling on nerve terminal impulses recorded from cold-sensitive receptors in the guinea-pig cornea. J Gen Physiol 121, 427–439.[Abstract/Free Full Text]

Caterina MJ, Leffler A, Malmberg AB, Martin WJ, Trafton J, Petersen-Zeitz KR, Koltzenburg M, Basbaum AI & Julius D (2000). Impaired nociception and pain sensation in mice lacking the capsaicin receptor. Science 288, 306–313.[Abstract/Free Full Text]

Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD & Julius D (1997). The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389, 816–824.[CrossRef][Medline]

Chuang HH, Prescott ED, Kong H, Shields S, Jordt SE, Basbaum AI, Chao MV & Julius D (2001). Bradykinin and nerve growth factor release the capsaicin receptor from PtdIns (4,5),P₂-mediated inhibition. Nature 411, 957–962.[CrossRef][Medline]

Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, Weissgerber P, Biel M, Philipp S, Freise D, Droogmans G, Hofmann F, Flockerzi V & Nilius B (2001). Lack of an endothelial store-operated Ca²⁺ current impairs agonist-dependent vasorelaxation in TRP4–/– mice. Nat Cell Biol 3, 121–127.[CrossRef][Medline]

Greka A, Navarro B, Oancea E, Duggan A & Clapham DE (2003). TRPC5 is a regulator of hippocampal neurite length and growth cone morphology. Nat Neurosci 6, 837–845.[CrossRef][Medline]

Hensel H (1981). Cutaneous thermoreceptors. In Thermoreception and Temperature Regulation, ed. Hensel H, pp. 33–61. Academic Press, London.

Hoenderop JG, van Leeuwen JP, van der Eerden BC, Kersten FF, van der Kemp AW, Merillat AM, Waarsing JH, Rossier BC, Vallon V, Hummler E & Bindels RJ (2003). Renal Ca²⁺ wasting, hyperabsorption, and reduced bone thickness in mice lacking TRPV5. J Clin Invest 112, 1906–1914.[CrossRef][Medline]

Jordt SE, Bautista DM, Chuang HH, McKemy DD, Zygmunt PM, Hogestatt ED, Meng ID & Julius D (2004). Mustard oils and cannabinoids excite sensory nerve fibres through the TRP channel ANKTM1. Nature 427, 260–265.[CrossRef][Medline]

Jordt SE, McKemy DD & Julius D (2003). Lessons from peppers and peppermint: the molecular logic of thermosensation. Curr Opin Neurobiol 13, 487–492.[CrossRef][Medline]

Kang D, Choe C & Kim D (2005). Thermosensitivity of the two-pore domain K⁺ channels TREK-2 and TRAAK. J Physiol 564, 103–116.[Abstract/Free Full Text]

Liu BY & Qin F (2005). Functional control of cold- and menthol-sensitive TRPM8 ion channels by phosphatidylinositol 4,5-bisphosphate. J Neurosci 25, 1674–1681.[Abstract/Free Full Text]

Maingret F, Lauritzen I, Patel AJ, Heurteaux C, Reyes R, Lesage F, Lazdunski M & Honore E (2000). TREK-1 is a heat-activated background K⁺ channel. EMBO J 19, 2483–2491.[CrossRef][Medline]

McKemy DD, Neuhausser WM & Julius D (2002). Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 416, 52–58.[CrossRef][Medline]

Montell C (1998). TRP trapped in fly signaling web. Curr Opin Neurobiol 8, 389–397.[CrossRef][Medline]

Moqrich A, Hwang SW, Earley TJ, Petrus MJ, Murray AN, Spencer KS, Andahazy M, Story GM & Patapoutian A (2005). Impaired thermosensation in mice lacking TRPV3, a heat and camphor sensor in the skin. Science 307, 1468–1472.[Abstract/Free Full Text]

Nealen ML, Gold MS, Thut PD & Caterina MJ (2003). TRPM8 mRNA is expressed in a subset of cold-responsive trigeminal neurons from rat. J Neurophysiol 90, 515–520.[Abstract/Free Full Text]

Numazaki M, Tominaga T, Toyooka H & Tominaga M (2002). Direct phosphorylation of capsaicin receptor VR1 by protein kinase Cepsilon and identification of two target serine residues. J Biol Chem 277, 13375–13378.[Abstract/Free Full Text]

Okazawa M, Takao K, Hori A, Shiraki T, Matsumura K & Kobayashi S (2002). Ionic basis of cold receptors acting as thermostats. J Neurosci 22, 3994–4001.[Abstract/Free Full Text]

Patapoutian A, Peier AM, Story GM & Viswanath V (2003). ThermoTRP channels and beyond: mechanisms of temperature sensation. Nat Rev Neurosci 4, 529–539.[CrossRef][Medline]

Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA, Story GM, Earley TJ, Dragoni I, McIntyre P, Bevan S & Patapoutian A (2002). A TRP channel that senses cold stimuli and menthol. Cell 108, 705–715.[CrossRef][Medline]

Premkumar LS & Ahern GP (2000). Induction of vanilloid receptor channel activity by protein kinase C. Nature 408, 985–990.[CrossRef][Medline]

Prescott ED & Julius D (2003). A modular PIP2 binding site as a determinant of capsaicin receptor sensitivity. Science 300, 1284–1288.[Abstract/Free Full Text]

Reid G (2005). ThermoTRP channels and cold sensing: what are they really up to?Pflugers Arch DOI: 10.1007/s00424-005-1437-2.

Reid G, Babes A & Pluteanu F (2002). A cold- and menthol-activated current in rat dorsal root ganglion neurones: properties and role in cold transduction. J Physiol 545, 595–614.[Abstract/Free Full Text]

Reid G & Flonta M (2001). Cold transduction by inhibition of a background potassium conductance in rat primary sensory neurones. Neurosci Lett 297, 171–174.[CrossRef][Medline]

Smith GD, Gunthorpe MJ, Kelsell RE, Hayes PD, Reilly P, Facer P, Wright JE, Jerman JC, Walhin JP, Ooi L, Egerton J, Charles KJ, Smart D, Randall AD, Anand P & Davis JB (2002). TRPV3 is a temperature-sensitive vanilloid receptor-like protein. Nature 418, 186–190.[CrossRef][Medline]

Spray DC (1986). Cutaneous temperature receptors. Annu Rev Physiol 48, 625–638.[CrossRef][Medline]

Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, Hricik TR, Earley TJ, Hergarden AC, Andersson DA, Hwang SW, McIntyre P, Jegla T, Bevan S & Patapoutian A (2003). ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell 112, 819–829.[CrossRef][Medline]

Thut PD, Wrigley D & Gold MS (2003). Cold transduction in rat trigeminal ganglia neurons in vitro. Neuroscience 119, 1071–1083.[CrossRef][Medline]

Tobin D, Madsen D, Kahn-Kirby A, Peckol E, Moulder G, Barstead R, Maricq A & Bargmann C (2002). Combinatorial expression of TRPV channel proteins defines their sensory functions and subcellular localization in C. elegans neurons. Neuron 35, 307–318.[CrossRef][Medline]

Tracey WD Jr, Wilson RI, Laurent G & Benzer S (2003). painless, a Drosophila gene essential for nociception. Cell 113, 261–273.[CrossRef][Medline]

Tsuzuki K, Xing H, Ling J & Gu JG (2004). Menthol-induced Ca²⁺ release from presynaptic Ca²⁺ stores potentiates sensory synaptic transmission. J Neurosci 24, 762–771.[Abstract/Free Full Text]

Vellani V, Mapplebeck S, Moriondo A, Davis JB & McNaughton PA (2001). Protein kinase C activation potentiates gating of the vanilloid receptor VR1 by capsaicin, protons, heat and anandamide. J Physiol 534, 813–825.[Abstract/Free Full Text]

Viana F, de la Pena E & Belmonte C (2002). Specificity of cold thermotransduction is determined by differential ionic channel expression. Nat Neurosci 5, 254–260.[CrossRef][Medline]

Viana F, de la Pena E, Pecson B, Schmidt RF & Belmonte C (2001). Swelling-activated calcium signalling in cultured mouse primary sensory neurons. Eur J Neurosci 13, 722–734.[CrossRef][Medline]

Voets T, Droogmans G, Wissenbach U, Janssens A, Flockerzi V & Nilius B (2004). The principle of temperature-dependent gating in cold- and heat-sensitive TRP channels. Nature 430, 748–754.[CrossRef][Medline]

Watanabe H, Vriens J, Prenen J, Droogmans G, Voets T & Nilius B (2003). Anandamide and arachidonic acid use epoxyeicosatrienoic acids to activate TRPV4 channels. Nature 424, 434–438.[CrossRef][Medline]

Zygmunt PM, Petersson J & Andersson D (1999). A., Chuang, H., Sorgard, M., Di, M., V, Julius, D. & Hogestatt, E. D. Vanilloid receptors on sensory nerves mediate the vasodilator action of anandamide. Nature 400, 452–457.[CrossRef][Medline]

	Acknowledgements

 
We thank R. Velasco, E. Quintero and A. Perez for technical assistance and S. Ingham for illustrations. We also acknowledge M. Dominguez, R. Gallego, P. Gómez, E. Nasi and M. Valdeolmillos for critical comments. D. Julius provided the rat TRPM8 cDNA in pcDNA3 and J. Eggermont the pcINeo/IRES-GFP bicistronic vector. This work was supported by funds from the Spanish Ministry of Science and Education, SAF2001-1641 and SAF2004-01011 to F.V, BFI2002-03788 to C.B., project GV04A-652 from the Generaliltat Valenciana to E.P and a fellowship from the Spanish Ministry of Foreign Affairs (MAE-AECI) to A.M.

This article has been cited by other articles:

				A. Malkia, R. Madrid, V. Meseguer, E. de la Pena, M. Valero, C. Belmonte, and F. Viana Bidirectional shifts of TRPM8 channel gating by temperature and chemical agents modulate the cold sensitivity of mammalian thermoreceptors J. Physiol., May 15, 2007; 581(1): 155 - 174. [Abstract] [Full Text] [PDF]

				K. Shibasaki, M. Suzuki, A. Mizuno, and M. Tominaga Effects of Body Temperature on Neural Activity in the Hippocampus: Regulation of Resting Membrane Potentials by Transient Receptor Potential Vanilloid 4 J. Neurosci., February 14, 2007; 27(7): 1566 - 1575. [Abstract] [Full Text] [PDF]

				K. L. Zanotto, A. W. Merrill, M. I. Carstens, and E. Carstens Neurons in Superficial Trigeminal Subnucleus Caudalis Responsive to Oral Cooling, Menthol, and Other Irritant Stimuli J Neurophysiol, February 1, 2007; 97(2): 966 - 978. [Abstract] [Full Text] [PDF]

				R. Madrid, T. Donovan-Rodriguez, V. Meseguer, M. C. Acosta, C. Belmonte, and F. Viana Contribution of TRPM8 Channels to Cold Transduction in Primary Sensory Neurons and Peripheral Nerve Terminals J. Neurosci., November 29, 2006; 26(48): 12512 - 12525. [Abstract] [Full Text] [PDF]

				D. Roosterman, T. Goerge, S. W. Schneider, N. W. Bunnett, and M. Steinhoff Neuronal control of skin function: the skin as a neuroimmunoendocrine organ. Physiol Rev, October 1, 2006; 86(4): 1309 - 1379. [Abstract] [Full Text] [PDF]

				J. Brock, M. C. Acosta, A. Al Abed, S. Pianova, and C. Belmonte Barium ions inhibit the dynamic response of guinea-pig corneal cold receptors to heating but not to cooling J. Physiol., September 1, 2006; 575(2): 573 - 581. [Abstract] [Full Text] [PDF]

				L. Zhang and G. J Barritt TRPM8 in prostate cancer cells: a potential diagnostic and prognostic marker with a secretory function? Endocr. Relat. Cancer, March 1, 2006; 13(1): 27 - 38. [Abstract] [Full Text] [PDF]

				H. Xing, J. Ling, M. Chen, and J. G. Gu Chemical and Cold Sensitivity of Two Distinct Populations of TRPM8-Expressing Somatosensory Neurons J Neurophysiol, February 1, 2006; 95(2): 1221 - 1230. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 567/2/415    most recent jphysiol.2005.086546v1 Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager