HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 567/3/757    most recent jphysiol.2005.093195v1 Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Dalton, S. Articles by Colecraft, H. M Search for Related Content PubMed PubMed Citation Articles by Dalton, S. Articles by Colecraft, H. M

¹ Calcium Signals Laboratory, Department of Biomedical Engineering, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Voltage-dependent calcium-channel ß subunits (Ca_Vß) strongly modulate pore-forming ₁ subunits by trafficking channel complexes to the plasma membrane and enhancing channel open probability (P_o). Despite their central role, it is unclear whether binding of a single Ca_Vß, or multiple Ca_Vßs, to an ₁ subunit governs the two distinct functions. Conventional experiments utilizing coexpression of ₁ and Ca_Vß subunits have been unable to resolve the ambiguity due to difficulties in establishing their stoichiometry in functional channels. Here, we unambiguously establish a 1: 1 stoichiometry by covalently linking Ca_Vß_2b to the carboxyl terminus of _1C (Ca_V1.2), creating _1C·ß_2b. Recombinant L-type channels reconstituted in HEK 293 cells with _1C·ß_2b supported whole-cell currents to the same extent as channels reconstituted via coexpression of the individual subunits. Analysis of gating charge showed _1C·ß_2b fully restored channel trafficking to the plasma membrane. Co-transfecting Ca_Vß_2a with _1C·ß_2b had little further impact on function. To rule out the possibility that fused Ca_Vß_2b was interacting in trans with neighbouring ₁ molecules, _1C·ß_2b was cotransfected with _1B (Ca_V2.2), and pharmacological block with nimodipine showed an absence of _1B trafficking. These results establish that association of a single Ca_Vß with a pore-forming ₁ subunit captures the functional essence of HVA calcium channels, and introduce ₁–Ca_Vß fusion proteins as a powerful new tool to probe structure–function mechanisms.

(Received 21 June 2005; accepted after revision 12 July 2005; first published online 14 July 2005)
Corresponding author H. M. Colecraft: Calcium Signals Laboratory, Department of Biomedical Engineering, Johns Hopkins University School of Medicine, 720 Rutland Avenue, 726 Traylor Building, Baltimore, MD 21205, USA. Email: hcolecra{at}bme.jhu.edu

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
High-voltage-activated (HVA) calcium channels are hetero-multimeric protein complexes comprised minimally of a pore-forming ₁-subunit (Ca_V1.1–1.4; Ca_V2.1–2.3), and auxiliary ß (Ca_Vß₁–Ca_Vß₄), ₂ (₂-1–₂-3), and sometimes subunits (Catterall, 2000). These proteins control Ca²⁺ fluxes that underlie critical biological functions ranging from muscle contraction to hormone and neurotransmitter release. Auxiliary Ca_Vß subunits play a crucial role in the functional maturation of HVA calcium channels: each of the four Ca_Vßs can interact promiscuously with any of the seven known HVA calcium-channel ₁ subunits to promote membrane trafficking of the associated ₁ (Chien et al. 1995; Brice et al. 1997; Yamaguchi et al. 2000; Colecraft et al. 2002; Takahashi et al. 2004), to increase channel P_o (Singer et al. 1991; Costantin et al. 1998; Hullin et al. 2003; Takahashi et al. 2004), and to produce hyperpolarizing shifts in the voltage-dependence of channel activation (Singer et al. 1991; Perez-Reyes et al. 1992; De Waard et al. 1994; Jones et al. 1998).

The powerful impact of Ca_Vßs on HVA calcium-channel operation logically focuses attention on the interaction between ₁ and Ca_Vß subunits as a promising locus to modify calcium-channel behaviour. Indeed, this interaction is the target for physiological down-regulation of calcium currents by the Rem, Rad, Kir/Gem (RGK) family of Ras-like GTPases (Beguin et al. 2001; Finlin et al. 2003), and serves as the basis for high-throughput identification of novel pharmacological inhibitors of HVA calcium-channel activity (Young et al. 1998). A deeper mechanistic understanding of the HVA ₁–Ca_Vß interaction is important for both appreciating its physiological ramifications, as well as potentially hastening the discovery of new calcium-channel therapeutics.

A fundamental ambiguity of HVA calcium-channel structure relates to the functional stoichiometry of ₁ to Ca_Vß (Birnbaumer et al. 1998; Canti et al. 2001; Jones, 2002; Dolphin, 2003). Specifically, it is unclear whether the fully functional channel is comprised of an ₁ subunit associated with single or multiple Ca_Vß subunits. Biochemical studies initially established that ₁ and Ca_Vß subunits copurify in an equimolar ratio (Witcher et al. 1993); the uncertainty arises from studies which indicate that trafficking and gating-modulation are separable functions dependent on distinct Ca_Vß concentrations. In Xenopus oocytes, expression of ₁ without exogenous Ca_Vß leads to recovery of low-amplitude currents that activate at relatively depolarized potentials, compared to channels obtained by coexpressing ₁ and Ca_Vß (Singer et al. 1991; Perez-Reyes et al. 1992; Birnbaumer et al. 1998). However, the presumed ₁-alone currents are abolished by antisense oligonucleotides against a subsequently identified endogenous Xenopus Ca_Vß (Ca_Vß_XO) (Tareilus et al. 1997). These results suggested that there is sufficient endogenous Ca_Vß_XO in the Xenopus expression system to fully traffick ₁ subunits to the plasma membrane, but not to modulate gating (Tareilus et al. 1997; Birnbaumer et al. 1998). In agreement, careful titration of the amount of Ca_Vß₃ coexpressed with Ca_V2.2 in Xenopus oocytes indicated that the concentration of Ca_Vß₃ required to traffick channels to the plasma membrane is nearly an order of magnitude less than that required to modulate channel gating (Canti et al. 2001). Furthermore, acute application of purified Ca_Vß protein was found to modulate the gating of pre-existing calcium channels in the plasma membrane (Yamaguchi et al. 1998; Garcia et al. 2002).

These data are consistent with two mutually exclusive interpretations of the functional stoichiometry of the ₁–Ca_Vß interaction (Birnbaumer et al. 1998; Jones, 2002; Dolphin, 2003). In the ‘single-Ca_Vß-binding’ model, Ca_Vß binds to ₁ at the endoplasmic reticulum (ER) to promote translocation to the plasma membrane. At low Ca_Vß concentrations, reversible unbinding of Ca_Vß from ₁ favours a significant steady-state fraction of low-activity Ca_Vß-less channels in the plasma membrane. At high Ca_Vß concentrations, the equilibrium is shifted towards high-activity (Ca_Vß-bound) channels (Fig. 1A). Thus, a single Ca_Vß is responsible for both trafficking and enhancing the channel P_o. Alternatively, in the ‘multiple-Ca_Vß-binding’ model, trafficking and gating-modulation are mediated by distinct Ca_Vß subunits (Fig. 1B). As before, a Ca_Vß binds to an ₁ to promote channel trafficking. After insertion into the plasma membrane, the high-affinity interaction between ₁ and Ca_Vß persists. By contrast to the single-Ca_Vß model, these ₁ + Ca_Vß channels exhibit low gating activity, and binding of a second Ca_Vß to a distinct lower affinity site is required for high gating activity. Distinguishing between these two models is fundamental to mechanistic understanding of Ca_Vß function, and has important implications for rational manipulation of the ₁–Ca_Vß interaction to regulate calcium-channel activity.

View larger version (33K): [in this window] [in a new window]   Figure 1.  Alternative models proposed for the functional stoichiometry of high-voltage-activated calcium-channel 1–ß subunit interaction A, the single-CaVß-binding model. A single CaVß subunit binds to the 1 subunit at the endoplasmic reticulum (ER) membrane resulting in trafficking of the 1–ß complex to the plasma membrane. At the plasma membrane, a reversible 1: 1 interaction between 1 and CaVß subunits switches the channel between low- and high-Po modes. B, the multiple-CaVß-binding model. A CaVß binding to an 1 subunit at the ER membrane is also responsible for trafficking the 1-ß channel complex to the plasma membrane. However, this CaVß does not dissociate from the channel complex, which gates in a low-Po mode. Binding of an additional CaVß subunit (or subunits) switches the channel complex to a high-activity gating mode.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Molecular biology

A truncation mutant of _1C (_1C[1905]), and _1C–Ca_Vß fusion proteins (_1C[1905]·ß_2b, _1C·ß_2b, _1C·ß_2b[P235R]) were constructed using rabbit _1C/pGW1 (Wei et al. 1991) and human Ca_Vß_2b/pAd CIG (Takahashi et al. 2003) expression vectors as backbones. To generate _1C[1905]/pGW1, we inserted a stop codon after residue E1905 of _1C by polymerase chain reaction (PCR) amplifying _1C/pGW1 using the following upstream and downstream primers, respectively: (primer 1) CACCATCTGGATGAATTTAAAAGAATC and (primer 2) TCTAGACTACTCCTCCGGGGGCGCCAGTTG. The resulting PCR fragment was ligated into _1C/pGW1 using BstEII/XbaI sites, generating _1C[1905]/pGW1.

The _1C[1905]·ß_2b construct was generated by overlap extension PCR as follows. _1C[1905]/pGW1 was used as a template in a PCR reaction with primer 1 and the following downstream primer: (primer 3) CTCCTCCGGGGGCGCCAGTTGTCG. A second PCR using human Ca_Vß_2b/pAd CIG as template was carried out using the following upstream and downstream primers, respectively: (primer 4) CTGGCGCGCCCGGAGGAGGGTGGTGGTGGTATGCTTGACAGACGCCTT and (primer 5) GCGTACAAGGGTACCGCAATACCG. The two PCR fragments were used as templates in an overlap-extension PCR reaction using primers 1 and 5. A BstEII/Xba1 cassette from the overlap extension PCR product was transferred to _1C[1905]/pGW1, generating _1C[1905]·ß_2b/pGW1 in which Ca_Vß_2b is attached to _1C[1905] via a 4-glycine linker.

The _1C·ß_2b construct was generated using a strategy similar to that described above for _1C[1905]·ß_2b. The _1C/pGW1 construct was used as template in a PCR reaction with the following upstream and downstream primers, respectively: (primer 6) GCAGTGGCGGGCCTGAGTCCCCTC, and (primer 7) CAGGCTGCTGACGCCGGCCCTGCG. Human Ca_Vß_2b/pAd CIG was used as template in a second PCR using the following upstream primer: (primer 8) GCCGGCGTCAGCAGCCTGGGTGGTGGTGGTATGCTTGACAGACGCCTTATAG in conjunction with primer 5. The two PCR products were used in an overlap extension reaction with primers 6 and 5. An RsrII/XbaI cassette from the overlap extension PCR product was transferred into _1C/pGW1, generating _1C·ß_2b/pGW1, in which Ca_Vß_2b is attached to the carboxyl terminus of _1C via a 4-glycine linker.

The point mutant fusion protein, _1C·ß_2b[P235R], was generated by overlap extension PCR using _1C·ß_2b as template. The first PCR reaction was performed using primer 8 and the following downstream primer: (primer 9) CTTCAGAGAACGGCCCACTAGGAC (mutated base underlined). The second PCR reaction was performed using the following upstream and downstream primers, respectively: (primer 10) GTCCTAGTGGGCCGTTCTCTGAAG and (primer 11) AGGTCGACTCTAGAGCGGCCGCCA. The two PCR products were used in an overlap extension reaction, and a SfuI/XbaI cassette from the resulting product transferred into _1C·ß_2b/pGW1 to generate _1C·ß_2b[P235R]/pGW1. Pfu polymerase (Strategene, La Jolla, CA, USA) was used to increase fidelity in all PCR reactions. All PCR products were verified by sequencing.

Cell culture and transient channel expression

Low passage number human embryonic kidney (HEK 293) cell cultures (< 20 passages) were maintained as previously described (Brody et al. 1997). Cells were transiently transfected 24 h after passage using the calcium-phosphate precipitation method with 8 µg each of CMV expression plasmids encoding the indicated calcium-channel subunits [rabbit _1C (Wei et al. 1991); _1C[1905]; human Ca_Vß_2b (Takahashi et al. 2003); _1C·ß_2b; and rat ₂ (Tomlinson et al. 1993)] and 3 µg of T antigen.

Electrophysiology

Electrophysiological experiments were performed as previously described (Takahashi et al. 2004). Whole-cell recordings were performed at room temperature, 2–3 days after transfection, using an EPC8 patch-clamp amplifier (HEKA Electronics, Lambrecht/Pfalz, Germany) controlled by PULSE software. Patch pipettes were fashioned from 1.5-mm thin-wall glass with filament (WPI, Waltham, MA). Patch pipettes typically had a series resistance of 2–4 M, compensated 50–70%, when filled with an intracellular solution containing (mM): 135 caesium methanesulphonate (Cs-MeSO₃), 5 CsCl, 5 EGTA, 1 MgCl₂, 4 MgATP (freshly added on the day of patch-clamp experiments), and 10 Hepes (pH 7.3, adjusted with CsOH). Cells were continuously perfused with an external solution containing (mM): 140 tetraethylammonium (TEA) MeSO₃, 10 Hepes, 5 BaCl₂ (pH 7.4, adjusted with TEA-OH). The standard electrophysiological protocol consisted of a family of 20-ms test pulse depolarizations (from –40 to +120 mV) used to evoke currents from a –90-mV holding potential, followed by a repolarization to –50 mV to measure tail currents. Current signals were sampled at 25 kHz and filtered at 10 kHz, with leak and capacitive transients subtracted using a P/8 protocol. Traces were acquired at a repetition interval of 15 s.

Data and statistical analysis

Data were analysed off-line using PULSEFIT (HEKA Electronics). Peak current amplitudes during the test pulse were normalized by cell capacitance to provide the current density (J_peak). Integration of ON gating currents recorded at the reversal potential to provide gating charge (Q_ON) was performed in Origin (OriginLab Corp., Northampton, MA, USA). J–V relationships were fitted to the following equation:

where J is the whole-cell current density (pA pF^–1), G is the specific conductance (pA pF^–1 mV^–1), V_rev is the reversal potential (mV), V_1/2 is the voltage of half-maximal activation (mV), and k is a slope factor (mV). Statistical analyses were performed in Microsoft Excel using built-in functions. Pooled data are represented as means ± S.E.M.; P-values were calculated using Student's two-tailed t test, with P < 0.05 considered statistically significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Robust modulation of truncated Ca_V1.2 (_1C[1905]) by coexpressed Ca_Vß_2b in HEK 293 cells

The traditional experimental approach towards investigating the functional effects of Ca_Vß on HVA calcium channels has been to compare the properties of recombinant channels reconstituted by expressing HVA calcium-channel ₁ subunits, either with or without Ca_Vß in heterologous expression systems. Figure 2 shows the characteristic powerful impact of Ca_Vß on the functional expression of recombinant calcium channels, as reported by the conventional coexpression approach. Transfection of HEK 293 cells with cDNA for a truncated Ca_V1.2 (_1C[1905]) subunit and ₂ resulted in the recovery of small-amplitude recombinant L-type calcium-channel currents in 70% of selected cells (Fig. 2A and B). Co-expression of Ca_Vß_2b with _1C[1905]/₂ dramatically increased the amplitude of recorded calcium-channel currents across the entire range of membrane voltages as indicated by exemplar traces (Fig. 2C and D), and population peak current density vs. voltage (J_peak–V; Fig. 2E) and tail-current vs. voltage (I_tail–V; Fig. 2F) curves. Overall, peak current density obtained with _1C[1905] + Ca_Vß_2b channels were over 10-fold larger than those obtained with Ca_Vß-less _1C[1905] (current density at 0 mV, J_peak,0mV = 4.05 ± 0.39 pA pF^–1, n = 7, for _1C[1905]/₂; J_peak,0mV = 47.9 ± 11.8 pA pF^–1, n = 6, for _1C[1905]/Ca_Vß_2b/₂; P < 0.05).

View larger version (30K): [in this window] [in a new window]   Figure 2.  Robust modulation of recombinant L-type channels by coexpressed CaVß2b subunit A, schematic diagram of the 1C[1905] subunit. B, exemplar whole-cell currents obtained from a HEK 293 cell transfected with 1C[1905] + 2. C, schematic diagram of 1C[1905] + CaVß2b. D, exemplar whole-cell currents obtained from a cell cotransfected with 1C[1905] + CaVß2b + 2. Co-expression with CaVß results in a marked increase in whole-cell current amplitude compared to 1C[1905] + 2 channels. E, plots of peak current density vs. test pulse voltage (Jpeak–V) for cells transfected with 1C[1905] + 2 () or 1C[1905] + CaVß2b + 2 (). F, plots of tail current amplitude vs. voltage (Itail–V) from channels expressed without () or with (•) cotransfected CaVß2b. G, top, exemplar gating currents obtained from recombinant 1C[1905] channels expressed without (left) or with (right) cotransfected CaVß2b. G, bottom, time integral of the gating current obtained at the reversal potential (QON) obtained for channels reconstituted without or with CaVß2b.

Covalently linking _1C[1905] and Ca_Vß_2b recapitulates robust functional expression of recombinant L-type channels

Unfortunately, traditional coexpression experiments as described in Fig. 2 cannot be used to determine the functional stoichiometry of ₁ and Ca_Vß species, since their relative expression levels cannot be tightly controlled. To control the stoichiometry between the subunits, coding sequence for Ca_Vß_2b was fused to the carboxyl terminus of _1C[1905] by subcloning. The resulting plasmid construct, when transfected and expressed in HEK 293 cells would result in a fusion protein (_1C[1905]·ß_2b) in which a 1: 1 ratio of _1C[1905] to Ca_Vß is assured (Fig. 3A). Whole-cell records from these fusion experiments showed that _1C[1905]·ß_2b clearly supports robust currents, as demonstrated by exemplar traces (Fig. 3B) and population J_peak–V (Fig. 3C) and I_tail–V (Fig. 3D) curves. Importantly, these experiments prove that Ca_Vß_2b was still functional in the fused-channel configuration.

View larger version (24K): [in this window] [in a new window]   Figure 3.  Robust modulation of recombinant L-type-channel functional expression by a CaVß2b covalently fused to the carboxyl terminus of 1C[1905] A, schematic diagram of the 1C[1905]·ß2b construct. B, exemplar whole-cell currents obtained at different test potentials for a cell transfected with 1C[1905]·ß2b + 2. C, population Jpeak–V plot obtained for 1C[1905]·ß2b + 2 channels (). Data for 1C[1905] + 2 channels have been reproduced (grey trace) to facilitate visual comparison of differences in peak current density amplitude. D, population Itail–V plot for 1C[1905]·ß2b + 2 channels (•). The corresponding data for 1C[1905] + 2 channels are reproduced (grey trace). E, QON values.

Modulation of full-length Ca_V1.2 by free and covalently linked Ca_Vß_2b

We conducted the initial series of experiments with the truncated Ca_V1.2 subunit, _1C[1905], to maximize the chances of obtaining a positive result. We theorized that the shortened carboxyl terminus of _1C[1905] would facilitate the interaction of the fused Ca_Vß_2b with the primary Ca_Vß interaction site in the cytoplasmic linker between domains I and II of the _1C subunit (I–II linker) (Pragnell et al. 1994). Having established the efficacy of the fused Ca_Vß_2b in the truncated channel configuration (Fig. 3), we sought to determine whether the experimental paradigm yielded equally robust results in the context of full-length _1C.

Similar to observations with the truncated _1C[1905] subunit, coexpression of full-length _1C and Ca_Vß_2b/₂ (Fig. 4D–F) resulted in significantly larger whole-cell currents than obtained with _1C/₂ (Fig. 4A–C). Fits of the J–V relations to a modified Boltzmann relation revealed that Ca_Vß_2b resulted in a four-fold increase in the macroscopic channel conductance (Table 1). Moreover, channels reconstituted with free Ca_Vß_2b displayed another classic hallmark of Ca_Vß modulation compared to _1C/₂: namely a hyperpolarizing shift in the voltage-dependence of channel activation (as gauged by V_1/2-values; Table 1).

View larger version (34K): [in this window] [in a new window]   Figure 4.  Functional modulation by a carboxyl-terminus-fused CaVß2b on full-length 1C is ablated by a CaVß2b P235R mutation A, schematic diagram of full-length 1C. B, exemplar currents obtained from cell transfected with 1C + 2. C, population Jpeak–V plot for 1C + 2 channels. D–F, data for 1C + CaVß2b + 2 channels. Same format as for A–C. Data for 1C + 2 channels in C are reproduced in F, I and L (grey trace) to facilitate direct visual comparisons. G–I, data for 1C·ß2b + 2; format same as above. J–L, data for 1C·ß2b[P235R] + 2; same format as above for A–C.

To discount the possibility that observed channel modulation might be due to nonspecific effects of attaching Ca_Vß_2b to the _1C carboxyl terminus, we tested the effect of a proline to arginine (P235R) mutation in the fused Ca_Vß_2b subunit, _1C·ß_2b[P235R] (Fig. 4J–L). The analogous mutation in other Ca_Vß subunits has been shown to disrupt binding to the ₁ interaction domain (AID), and ablates the capacity of Ca_Vß to modulate ₁ subunits in cotransfection experiments (De Waard et al. 1994; Takahashi et al. 2004), possibly due to derangement of the three-dimensional structure of the Ca_Vß ₁-binding pocket (ABP) (Chen et al. 2004; Opatowsky et al. 2004; Van Petegem et al. 2004). Reassuringly, _1C·ß_2b[P235R] yielded whole-cell currents that were indistinguishable from those obtained with Ca_Vß-less _1C/₂ (Fig. 4J–L and Table 1), clearly ruling out any unanticipated confounding effects generated by the fused Ca_Vß_2b subunit.

Additional Ca_Vßs do not appreciably enhance _1C·ß_2b channel currents

The results thus far indicated that a single Ca_Vß_2b fused to _1C was necessary and sufficient to fully recapitulate Ca_Vß effects on channel trafficking and macroscopic conductance (Figs 3 and 4). Could the presence of additional Ca_Vß subunits further enhance the channel modulation? We directly examined this question by coexpressing _1C·ß_2b/₂ with Ca_Vß_2a and recording whole-cell currents (Fig. 5A–C). Previous studies have established that Ca_Vß_2a targets autonomously to the plasma membrane and robustly modulates recombinant L-type Ca²⁺ channel currents. Therefore, Ca_Vß_2a was used in these coexpression experiments because we reasoned that its high effective local concentration at the membrane would provide the most favourable circumstance to observe a functional effect due to a second Ca_Vß subunit. Exemplar whole-cell current traces for _1C·ß_2b/Ca_Vß_2a/₂ were similar to those obtained for _1C·ß_2b/₂. Population data confirmed that there was no significant difference in macroscopic conductance between _1C·ß_2b currents in the presence or absence of Ca_Vß_2a (Fig. 5C and Table 1). By contrast, coexpressing _1C·ß_2b[P235R] with Ca_Vß_2a (Fig. 5D–F) resulted in significantly enhanced whole-cell current amplitudes compared to _1C·ß_2b[P235R] (Fig. 5F and Table 1). Importantly, the presence of free Ca_Vß_2a did not result in a significant change in the voltage-dependence of activation in _1C·ß_2b/₂ channels (Table 1; V_1/2 = –6.1 ± 2.1 for _1C/₂; V_1/2 = –6.4 ± 1.5 mV for _1C·ß_2b/₂; V_1/2 = –9.9 ± 1.8 mV for _1C·ß_2b/Ca_Vß_2a/₂ channels, P = 0.28 by one-way ANOVA). This suggests that the relatively right-shifted voltage-dependence of activation of _1C·ß_2b/₂ channels reflects an intrinsic property of the fusion protein, and does not signal the requirement for a second Ca_Vß to reconstitute this functional property. Together, these results raised confidence that the fused wild-type Ca_Vß_2b subunits were sufficient to fully modulate channel properties, and did not require the collaboration of additional Ca_Vß subunits.

View larger version (22K): [in this window] [in a new window]   Figure 5.  Co-expressing CaVß2a does not further augment 1C·ß2b currents, but recovers robust currents with 1C·ß2b[P235R] channels A, schematic diagram of 1C·ß2b + CaVß2a. B, exemplar whole-cell currents from a cell transfected with 1C·ß2b + CaVß2a + 2. C, population Jpeak–V relationship for 1C·ß2b + CaVß2a + 2 channels (•). Data for 1C·ß2b + 2 are reproduced to permit direct visual comparison (grey trace). D, schematic diagram of 1C·ß2b [P235R] + CaVß2a. E, exemplar whole-cell currents from 1C·ß2b[P235R] + CaVß2a + 2 channels. F, Jpeak–V relationship for 1C.ß2b + CaVß2a + 2 channels (•). Data for 1C.ß2b[P235R] + 2 are reproduced (grey trace).

Ruling out the presence of confounding trans interactions between distinct _1C·ß_2b fusion-protein molecules

Our interpretation of the data obtained with _1C·ß_2b as indicating that a single Ca_Vß is necessary and sufficient to fully modulate channel trafficking and macroscopic conductance hinges critically on the assumption that the fused Ca_Vßs act solely on the _1C subunits to which they are attached. This assumption might not be true if the fused Ca_Vß could act in trans on a neighbouring _1C molecule. To evaluate the extent to which such intermolecular interactions took place, we coexpressed _1C·ß_2b with _1B (Fig. 6). Our strategy was based on the idea that in the absence of free Ca_Vß the only avenue for appreciable _1B transport to the membrane would be via an intermolecular interaction with the fused Ca_Vß_2b subunit. Pharmacological block with nimodipine could then be used to distinguish relative amounts of _1C (L-type) and _1B (N-type) channels at the plasma membrane.

View larger version (21K): [in this window] [in a new window]   Figure 6.  Pharmacological evidence ruling out confounding intermolecular interactions between neighbouring 1C.ß2b molecules A, exemplar 1C.ß2b + 2 currents in the absence (black trace) and presence (grey trace) of 5 µM nimodipine. B, time course of nimodipine effect on exemplar current. Arrows denote time of nimodipine addition. C, bar graph showing degree of nimodipine inhibition in population of 1C.ß2b + 2 currents. D–F, data for 1B + CaVß2b + 2 channels; same format as panels A–C. G–I, data for 1B + 1C.ß2b + 2 channels; same format as panels A–C. J–L, data for 1B + CaVß2b + 1C.ß2b + 2 channels; same format as panels A–C.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
We investigated the functional stoichiometry of HVA calcium-channel ₁ and ß subunits to address a long-standing debate over whether a fully functional HVA calcium channel is comprised of an ₁ subunit associated with a single, or multiple Ca_Vß subunits. Our results indicate that a 1: 1 ratio of ₁ and Ca_Vß captures the functional essence of mature HVA channels. We discuss the significance of our findings in the context of previous results relevant to the issue of the stoichiometry of the calcium-channel ₁–ß subunit interaction.

Previous studies on the functional stoichiometry of calcium-channel ₁ and ß subunits

Biochemical studies of HVA calcium channels initially established that ₁ and ß subunits copurified in an equimolar ratio, suggesting a 1: 1 stoichiometry of these proteins in native calcium-channel complexes (Witcher et al. 1993). Structure–function studies and recent high-resolution crystal structures show that Ca_Vßs bind to a conserved stretch of amino acids, termed ₁ interaction domain (AID) located in the cytoplasmic region linking the first and second transmembrane domains of HVA ₁ subunits (De Waard et al. 1994; Pragnell et al. 1994; Chen et al. 2004; Opatowsky et al. 2004; Van Petegem et al. 2004). For their part, the core region of Ca_Vßs contains two protein interaction motifs—a src homology 3 (SH3) domain, and a guanylate kinase-like (GK) domain (Chen et al. 2004; Opatowsky et al. 2004; Van Petegem et al. 2004), both of which are necessary for Ca_Vß function (Opatowsky et al. 2003; McGee et al. 2004; Takahashi et al. 2004). The GK domain exhibits a high-affinity interaction with the AID peptide.

However, the assumption of a 1: 1 ₁ to Ca_Vß stoichiometry was challenged by electrophysiological studies of recombinant channels expressed in Xenopus oocytes. Calcium-channel ₁-subunit RNA injected alone into Xenopus oocytes results in low-amplitude whole-cell currents that activate at relatively depolarized potentials compared to those coexpressed with Ca_Vß (Singer et al. 1991; Perez-Reyes et al. 1992; Birnbaumer et al. 1998). Such low-level currents were attributed to Ca_Vß-less ‘₁-alone’ channels. However, Xenopus oocytes were subsequently found to possess an endogenous ß subunit (ß_XO). Antisense inhibition of this protein ablated so-called ₁-alone currents (Tareilus et al. 1997), indicating that the Ca_Vß_XO participated in the trafficking of the non-native ₁ subunits. The question, then, was: why did channels obtained by injecting Xenopus oocytes with ₁ alone exhibit clear-cut deficiencies in their gating properties despite the presence of Ca_Vß_XO? Two mutually exclusive scenarios were proposed that could account for these data, as presented in Fig. 1 (Tareilus et al. 1997; Birnbaumer et al. 1998; Jones, 2002).

Several studies have affirmed the independence of the Ca_Vß trafficking and gating roles without resolving the fundamental issue of whether the two functions are mediated by a single, or multiple Ca_Vß subunits. Dolphin and colleagues (Canti et al. 2001) explicitly demonstrated concentration-dependent effects for Ca_Vß on recombinant N-type channels by carefully titrating the amount of Ca_Vß₃ expression in Xenopus oocytes (Canti et al. 2001). Relatively low Ca_Vß₃ levels (K_d = 17 nM) were sufficient to increase whole-cell conductance, whereas substantially higher concentrations (K_d = 120 nM) were required to elicit gating effects. Gerster et al. used a mutation of a conserved tyrosine in the AID (Y467S in _1C), previously identified to disrupt the high-affinity ₁–Ca_Vß interaction (Pragnell et al. 1994), to examine the separate trafficking and gating effects. They found that Ca_Vßs no longer trafficked _1C(Y467S) to the membrane upon cotransfection in tsA201 cells; but single-channel experiments indicated that Ca_Vßs still increased P_o in _1C(Y467S) channels (Gerster et al. 1999). More recently, truncated splice variants of Ca_Vßs that lack a GK domain have been found to increase single-channel P_o, while being unable to reconstitute the Ca_Vß trafficking function (Hullin et al. 2003; Cohen et al. 2004). These data suggest the existence of secondary ₁–Ca_Vß interaction sites beyond the high-affinity interaction between the -binding pocket (ABP) of the GK domain and the AID. Indeed, lower affinity interactions between some Ca_Vß subunits and the carboxyl termini of _1A and _1E have been identified in biochemical experiments (Qin et al. 1997; Birnbaumer et al. 1998; Walker et al. 1998, 1999; Walker & De Waard, 1998). However, none of these experiments could discriminate whether Ca_Vßs modulate channel trafficking and gating according to a single- or multiple-Ca_Vß-binding model (Jones, 2002).

Acutely applied Ca_Vß subunits have also been shown to affect the gating activity of channels pre-existing in the plasma membrane. In one study, purified Ca_Vß₃ protein was introduced into Xenopus oocytes previously injected with _1C cRNA. It was found that Ca_Vß₃ produced effects on the gating of channels pre-existing at the membrane (leftward shift in the voltage-dependence of channel activation, increased current amplitude presumably due to elevated single-channel P_o) long before increasing trafficking of _1C subunits from intracellular sites to the membrane (Yamaguchi et al. 1998). Similarly, acute introduction (via patch pipette dialysis) of purified Ca_Vß_1a into spherical vesicles derived from skeletal muscle plasma membrane resulted in up-regulation of whole-cell current amplitude without any changes in gating current size (Garcia et al. 2002). These results indicate that under these experimental conditions, acute application of Ca_Vßs can modify the gating properties of channels pre-existing at the membrane. Unfortunately, these results could also be well explained by either the single- or multiple-Ca_Vß-binding models (Jones, 2002).

In light of these previous results, our finding that fusing a ₁ subunit with a single Ca_Vß captures the functional essence of channels permits an unambiguous interpretation of the structure–function relationship of the calcium-channel ₁–Ca_Vß interaction. Although we do not directly measure channel P_o in this study, we infer from the similarities in channel trafficking (as gauged by Q_ON) and macroscopic conductance that channels reconstituted with _1C/Ca_Vß_2b/₂ and _1C·ß_2b have similar P_o-values. Future single-channel studies will provide more direct insights into microscopic gating properties of _1C·ß_2b vs. _1C/Ca_Vß_2b-reconstituted L-type calcium channels. From the current data, we cannot unambiguously rule out the notion that a second Ca_Vß could possibly modulate some gating properties of the channel. Overall, the refined interpretations afforded by our results suggest new physiological dimensions to the ₁–Ca_Vß interaction that we discuss next.

Reversible unbinding of calcium-channel ₁–Ca_Vß subunits?

Our results are consistent with a single-Ca_Vß-binding model, and in conjunction with previously published studies, an important implication of this model is that at low Ca_Vß concentrations reversible unbinding of Ca_Vß ensures an appreciable fraction of Ca_Vß-less ₁ channels in the plasma membrane. The notion that Ca_Vßs can reversibly unbind from ₁ subunits suggests that Ca_Vß modulation of channel gating could be a more dynamic process than previously appreciated. Because Ca_Vß-less channels have a lower P_o than Ca_Vß-bound channels, reversible unbinding could serve to physiologically switch calcium channels between low- and high-activity modes of signalling. Recently, it was reported that in invertebrate Lymnaea stagnalis neurones, Ca_Vßs (LCa_Vß) are associated with LCa_V2 channels in mature neurones (Spafford et al. 2004). However, LCa_Vß was physically uncoupled from LCa_V2 channels located in the leading edge of neuronal growth cones (Spafford et al. 2004). Moreover, such uncoupled LCa_V2 channels were shown to be important for growth cone projections. Reversible unbinding of Ca_Vß from ₁ subunits could feature prominently in the appearance of such Ca_Vß-less channels at the membrane, and could thus serve to significantly enrich the physiologic dimensions of calcium-channel signalling in cells.

Utility of ₁–Ca_Vß fusion-proteins as tools to probe calcium-channel structure–function relationships

Beyond the use of _1C·ß_2b to resolve the functional stoichiometry of HVA calcium channels as demonstrated here, ₁–ß fusion proteins have tremendous potential to elucidate other currently challenging questions relating to the structure–function of HVA calcium channels. A key example relates to the fact that in many excitable cells multiple HVA calcium-channel ₁ and Ca_Vß subunits coexist, and appear to interact in a rather promiscuous manner (Witcher et al. 1995; Scott et al. 1996; Ludwig et al. 1997). What is the physiological significance of the molecularly diverse combinations of calcium-channel ₁–ß subunits in cells? Do distinct ₁–ß combinations transduce unique biological responses? Such questions are difficult to address given the multiplicity of calcium-channel ₁ and Ca_Vß subtypes in cells, and the promiscuity of their interactions. The ₁–ß fusion-protein approach could provide a novel avenue to investigate the physiological significance of unambiguously identified ₁–ß combinations.

	References

Top Abstract Introduction Methods Results Discussion References

 
Beguin P, Nagashima K, Gonoi T, Shibasaki T, Takahashi K, Kashima Y, Ozaki N, Geering K, Iwanaga T & Seino S (2001). Regulation of Ca²⁺ channel expression at the cell surface by the small G-protein kir/Gem. Nature 411, 701–706.[CrossRef][Medline]

Birnbaumer L, Qin N, Olcese R, Tareilus E, Platano D, Costantin J & Stefani E (1998). Structures and functions of calcium channel ß subunits. J Bioenerg Biomembr 30, 357–375.[CrossRef][Medline]

Brice NL, Berrow NS, Campbell V, Page KM, Brickley K, Tedder I & Dolphin AC (1997). Importance of the different ß subunits in the membrane expression of the _1A and ₂ calcium channel subunits: studies using a depolarization-sensitive _1A antibody. Eur J Neurosci 9, 749–759.[CrossRef][Medline]

Brody DL, Patil PG, Mulle JG, Snutch TP & Yue DT (1997). Bursts of action potential waveforms relieve G-protein inhibition of recombinant P/Q-type Ca²⁺ channels in HEK 293 cells. J Physiol 499, 637–644.[CrossRef][Medline]

Canti C, Davies A, Berrow NS, Butcher AJ, Page KM & Dolphin AC (2001). Evidence for two concentration-dependent processes for ß-subunit effects on _1B calcium channels. Biophys J 81, 1439–1451.[Abstract/Free Full Text]

Catterall WA (2000). Structure and regulation of voltage-gated Ca²⁺ channels. Annu Rev Cell Dev Biol 16, 521–555.[CrossRef][Medline]

Chen Y, Li M, Zhang Y, He L, Yamada Y, Fitzmaurice A, Shen Y, Zhang H, Tong L & Yang J (2004). Structural basis of the ₁–ß subunit interaction of voltage-gated Ca²⁺ channels. Nature 429, 675–680.[CrossRef][Medline]

Chien AJ, Zhao X, Shirokov RE, Puri TS, Chang CF, Sun D, Rios E & Hosey MM (1995). Roles of a membrane-localized ß subunit in the formation and targeting of functional L-type Ca²⁺ channels. J Biol Chem 270, 30036–30044.[Abstract/Free Full Text]

Cohen RM, Foell JD, Balijepalli RC, Shah V, Hell JW & Kamp TJ (2004). Unique modulation of L-type Ca²⁺ channels by short auxiliary ß_1d subunit present in cardiac muscle. Am J Physiol Heart Circ Physiol 288, H2363–H2374.[CrossRef][Medline]

Colecraft HM, Alseikhan B, Takahashi SX, Chaudhuri D, Mittman S, Yegnasubramanian V, Alvania RS, Johns DC, Marban E & Yue DT (2002). Novel functional properties of Ca²⁺ channel ß subunits revealed by their expression in adult rat heart cells. J Physiol 541, 435–452.[Abstract/Free Full Text]

Costantin J, Noceti F, Qin N, Wei X, Birnbaumer L & Stefani E (1998). Facilitation by the ß_2a subunit of pore openings in cardiac Ca²⁺ channels. J Physiol 507, 93–103.[Abstract/Free Full Text]

De Waard M, Pragnell M & Campbell KP (1994). Ca²⁺ channel regulation by a conserved ß subunit domain. Neuron 13, 495–503.[CrossRef][Medline]

Dolphin AC (2003). ß subunits of voltage-gated calcium channels. J Bioenerg Biomemb 35, 620.

Finlin BS, Crump SM, Satin J & Andres DA (2003). Regulation of voltage-gated calcium channel activity by the Rem and Rad GTPases. Proc Natl Acad Sci U S A 100, 14469–14474.[Abstract/Free Full Text]

Gao T, Chien AJ & Hosey MM (1999). Complexes of the _1C and ß subunits generate the necessary signal for membrane targeting of class C L-type calcium channels. J Biol Chem 274, 2137–2144.[Abstract/Free Full Text]

Garcia R, Carrillo E, Rebolledo S, Garcia MC & Sanchez JA (2002). The ß_1a subunit regulates the functional properties of frog and mouse L-type Ca²⁺ channels of skeletal muscle. J Physiol 545, 407–419.[Abstract/Free Full Text]

Gerster U, Neuhuber B, Groschner K, Striessnig J & Flucher BE (1999). Current modulation and membrane targeting of the calcium channel _1C subunit are independent functions of the ß subunit. J Physiol 517, 353–368.[Abstract/Free Full Text]

Hullin R, Khan IFY, Wirtz S, Mohacsi P, Varadi G, Schwartz A & Herzig S (2003). Cardiac L-type calcium channel ß subunits expressed in human heart have differential effects on single channel characteristics. J Biol Chem 278, 21623–21630.[Abstract/Free Full Text]

Jones SW (2002). Calcium channels: when is a subunit not a subunit? J Physiol 545, 334.[Abstract/Free Full Text]

Jones LP, Wei SK & Yue DT (1998). Mechanism of auxiliary subunit modulation of neuronal _1E calcium channels. J General Physiol 112, 125–143.[Abstract/Free Full Text]

Ludwig A, Flockerzi V & Hofmann F (1997). Regional expression and cellular localization of the ₁ and ß subunit of high voltage-activated calcium channels in rat brain. J Neurosci 17, 1339–1349.[Abstract/Free Full Tex