J Physiol Society Membership
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 571, Number 2, 391-401, March 1, 2006 DOI: 10.1113/jphysiol.2005.100891
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
571/2/391    most recent
jphysiol.2005.100891v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balse, E.
Right arrow Articles by Picaud, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balse, E.
Right arrow Articles by Picaud, S.
Related Collections
Right arrow Neuroscience

Neuroscience

Glycine receptors in a population of adult mammalian cones

E. Balse1, L.-H. Tessier1, V. Forster1, M. J. Roux1, J. A. Sahel1,2,3 and S. Picaud1,2,4

1 INSERM U-592, Laboratoire de Physiopathologie Cellulaire et Moléculaire de la Rétine, UPMC, Paris, France
2 Fondation Ophtalmologique Adolphe de Rothschild, Paris, France
3 Centre Hospitalier National d'Ophtalmologie des Quinze-Vingts, Paris, France
4 Assistance Publique-Hopitaux de Paris, Paris, France


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Glycinergic interplexiform cells provide a feedback signal from the inner retina to the outer retina. To determine if cones receive such a signal, glycine was applied on cultured porcine cone photoreceptors recorded with the patch clamp technique. A minor population of cone photoreceptors was found to generate large currents in response to puff application of glycine. These currents reversed close to the calculated equilibrium potential for chloride ions. These glycine-elicited currents were sensitive to strychnine but not to picrotoxin consistent with the expression of {alpha}–ß-heteromeric glycine receptors. Glycine receptors were also activated by taurine and ß-alanine. The glycine receptor antibody mAb4a labelled a minority of the cone photoreceptors identified by an antibody specific for cone arrestin. Finally, expression of the ß subunit of the glycine receptor was demonstrated by single cell RT-PCR in a similar proportion (~13%) of cone photoreceptors freshly isolated by lectin-panning. The identity of cone photoreceptors was assessed by their specific expression of the cone arrestin mRNA. The population of cone photoreceptors expressing the glycine receptor was not correlated to a specific colour-sensitive subtype as demonstrated by single cell RT-PCR experiments using primers for S opsin, cone arrestin and glycine receptor ß subunit. This glycine receptor expression in a minority of cones defines a new cone population suggesting an unexpected role for glycine in the visual information processing in the outer retina.

(Received 9 November 2005; accepted after revision 21 December 2005; first published online 5 January 2006)
Corresponding author S. Picaud: Laboratoire de Physiopathologie Cellulaire et Moléculaire de la Rétine, INSERM U592, Hôpital Saint-Antoine, Bâtiment Kourilsky, 184, rue du Faubourg Saint-Antoine, 75 571 Paris cedex 12, France. Email: picaud{at}st-antoine.inserm.fr


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
GABA and glycine are the main inhibitory neurotransmitters in the mammalian retina (Yazulla, 1986; Kalloniatis & Tomisich, 1999). Both transmitters bind to receptors belonging to the ligand-gated ion-channel superfamily and activate chloride conductances (Ortells & Lunt, 1995). Despite their high degree of amino-acid sequence similarity in the ligand binding domain and the pore channel, GABAA, GABAC and glycine receptors show different anionic permeabilities, kinetic properties and pharmacological profiles that allow them to contribute differentially to the dampening of neuronal excitability. GABA and glycine not only have receptors with high sequence homologies, they also share the vesicular transporter VIAAT (vesicular inhibitory amino acid transporter) that loads them into the same synaptic vesicles (McIntire et al. 1997; Sagnéet al. 1997; Gasnier, 2000). Moreover, co-release of the two transmitters was even reported at single synapses in different structures of the central nervous system (Jonas et al. 1998; O'Brien & Berger, 1999; Dumoulin et al. 2001; Keller et al. 2001).

In the outer retina of non-mammalian vertebrates, the feedback signal from horizontal cells to cone photoreceptors has been widely attributed to GABA although this question is much debated (for review see Piccolino, 1995; Kamermans & Spekreijse, 1999). In mammals, the release of inhibitory transmitters is indicated by the presence of VIAAT in horizontal cell tips contacting photoreceptor terminals (Haverkamp et al. 2000; Cueva et al. 2002; Jellali et al. 2002). The presence of GABA itself was occasionally reported in horizontal cells (Marc et al. 1995) and in interplexiform cells (Kolb et al. 1991). The release of GABA in the outer retina is further supported by electrophysiological evidence for the presence of GABA receptors in bipolar cell dendrites, horizontal cells and cone photoreceptors (Picaud et al. 1998a; Vardi et al. 1998; Wässle et al. 1998; Pattnaik et al. 2000). Glycine release in the outer plexiform layer was also suggested by the presence of interplexiform cells expressing the glycine transporter, GlyT1 (Pow & Hendrickson, 1999). Glycine receptor expression was first reported at the cone photoreceptor terminals in the Xenopus retina (Smiley & Yazulla, 1990). Glycine-elicited responses were then recorded in human horizontal cells (Picaud et al. 1998a) and in the dendrites of murine bipolar cells (Karschin & Wässle, 1990; Suzuki et al. 1990). As a consequence, the sparse punctuate immunostaining for glycine receptors observed in the mammalian outer plexiform layer (OPL) was attributed to these postsynaptic neurones (Marc & Liu, 1985; Smiley & Yazulla, 1990; Grünert & Wässle, 1993; Pinto et al. 1994; Sassoe-Pognetto et al. 1994; Koulen et al. 1996).

Following our previous demonstration of GABA receptors in mammalian cone photoreceptors, we applied glycine on cultured cone photoreceptors and examined glycine receptor expression by single cell RT-PCR and immunostaining. Only a minor population of cones responded to glycine and expressed glycine receptors. These results suggest that glycine receptors could contribute to the physiology of this cone photoreceptor population.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals

Pig eyes were obtained from a local slaughterhouse. They were isolated immediately after the animal kill and transported on ice to the laboratory.

Photoreceptor cell culture: Vibratome

Cultures were prepared as previously described from pig retina (Picaud et al. 1998b). Briefly, the outer nuclear layer was isolated by horizontal sectioning with a vibratome of a square piece of flat mounted retina. Photoreceptors were then dissociated following an enzymatic treatment (10 min papain, 1 U µl–1, Worthington Biochemical Corp., Lakewood, NJ, USA) and seeded on a previously purified Müller glial cell culture (Guidry, 1996). The cocultured cells could be kept for a week in Dulbecco's modified Eagle's medium–Ham's nutrient mixture F12 (DMEM/F12; Gibco) supplemented with 2% fetal calf serum (FCS; Gibco).

Cone photoreceptor cell culture: lectin-panning

A cell suspension was prepared from the entire retina by enzymatic treatment and mechanical dissociation, as previously described (Gaudin et al. 1996; Picaud et al. 1998a). Briefly, the retinal tissue was chopped into small fragments and submitted to an enzymatic digestion (20 min papain, 1 U µl–1). Cell suspensions were then collected until complete dissociation of the retinal tissue obtained by trituration with a fire-polished Pasteur pipette. The cell suspensions were centrifuged at 115 g for 5 min and cells resuspended in a Neurobasal A (NBA) medium (Invitrogen) supplemented with B27 (1 : 50; Invitrogen) and glutamine (1 : 100; Invitrogen) (NBA+).

Cone photoreceptor purification was achieved as previously described (Balse et al. 2005). Briefly, glass coverslips were incubated for 2 h in Tris-HCl buffer (50 mm; pH 9.5) containing first a rabbit IgG directed against the peanut agglutinin (PNA) lectin (1 : 100; Sigma) and thereafter the PNA lectin (1 : 40; Sigma). Unspecific adhesion of retinal cells was prevented by incubating the coverslips in Dulbecco's phosphate-buffered saline (D-PBS; Gibco) supplemented with 0.2% BSA. The retinal suspension previously obtained was seeded at a 4 x 105 cells cm–2 density and incubated for 15 min while gently swirling the plates every 5 min. After removing non adherent cells, lectin-panned cells were allowed to grow in NBA+ medium.

Patch clamp recordings

All recordings were performed in the whole-cell configuration of the patch clamp technique on photoreceptors cultured on the glial feeder layer between days 3 and 7 in vitro. Recording pipettes were pulled from thin-walled borosilicate glass (TW150F, World Precision Instruments, Sarasota, FL, USA) using a Brown and Flaming-type puller (P-87, Sutter Instrument Co., Novato, CA, USA). After rupture of the cell membrane by gentle suction, cells were voltage clamped using an RK400 amplifier (Bio-Logic Science Instruments, Claix, France). Data were acquired and analysed using Patchit and Tack software, respectively (Grant & Werblin, 1994).

Drugs and solutions

The standard perfusing Ringer solution contained (mM) 135 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 glucose and 5 Hepes, pH adjusted to 7.7 with NaOH, and was delivered by a general gravity-driven perfusion system (~2 ml min–1) at room temperature. All drugs were prepared as stock solutions in distillated water and diluted before experiments in the perfusing solution. Glycine and the glycine analogues ß-alanine and taurine were locally applied to the cells using a pressure puffer system (Picospritzer II, General Valve Corporation, Fairfield, NJ, USA) or delivered in some experiments by the general perfusion system. The pipette solution routinely used for recordings contained (mM): 140 KCl, 1 MgCl2, 0.5 EGTA, 5 ATP and 4 Hepes (pH adjusted to 7.4 with KOH). To obtain a Cl equilibrium potential at –30 mV, potassium gluconate (98 mM) was substituted for the same concentration of KCl. Junction potentials were compensated prior to recording by setting the potential corresponding to zero current on the amplifier to 4.3 and 12.5 mV for ECl= 0 and ECl=–30 mV, respectively. All drugs were obtained from Sigma.

Cloning of Sus scrofa (pig) genes and oligonucleotides design

Partial Sus scrofa mRNAs for the cone arrestin and the ß subunit of the glycine receptor were first cloned using oligonucleotides designed following comparison of various mammal sequences. The complete coding sequences for both the Sus scrofa Arrestin-C gene (ARR3 gene) and the glycine receptor ß gene (GLRB gene) were therefore obtained using the Invitrogen 5' and 3' Race strategy and are available on the EMBL Nucleotide Sequence Database under accession numbers AJ564496 and AJ715855, respectively. The sequence AY091587 corresponding to the Sus scrofa mRNA for the blue-sensitive opsin was also used. Locations of the primers used for the single-cell RT-PCR experiments are given with respect to these sequences and were as follow:

Cone arrestin

First RT-PCR: 389 bp fragment

+205[ GGGAAACGGGACTTCGTG]+222

+593[ GCACAGAAACTCTTCACTTC]+574

Second PCR: 291 bp fragment

+219[ CGTGGACCATGTGGACATG]+237

+509[ GGTTGACAACCATCTGCAG]+490

Blue-sensitive opsin

First RT-PCR: 582 bp fragment

+412[ ATCATCTGTAAGCCCTTCGG]+431

+993[ GTCAGACTCATCTGTCATGG]+974

Second PCR: 336 bp fragment

+651[ CCTCATCTGCTTCTCCTACTC]+671

+986[ TCATCTGTCATGGGCTTTCCG]+966

Glycine receptor ß subunit

First RT-PCR: 370 bp fragment

+512[ GACGGAGATGTCCTTGTCAG]+531

+881[ TGATCCAGAAAGAAAGCCAG]+862

Second PCR: 283 bp fragment

+519[ ATGTCCTTGTCAGCATGAGG]+538

+801[ CTCCTCAGGGTGAAGATGAC]+782

Single-cell RT-PCR

Cone photoreceptors were purified with the lectin panning method (see above), and collected individually from the coverslip using a patch clamp recording pipette filled with 8 µl of buffer solution (mM): 140 KCl, 1 MgCl2, 0.5 EGTA, 5 ATP and 4 Hepes (pH 7.4). The glass pipette tip was then broken off into a thin-walled PCR reaction tube containing 40 µl of the reaction mix SuperScriptIII One-Step RT-PCR system (Invitrogen) and the first set of primers. This first set included couples of primers for both cone arrestin and the ß subunit of the glycine receptor or for cone arrestin, the ß subunit and the blue-sensitive opsin. Two microlitres of SuperScriptIII RT/Platinum Taq mix were added to each sample and cDNAs were synthesized by incubation at 50°C for 30 min and The first PCR consisted of an initial denaturation at 94°C for 2 min followed by 37 cycles (94°C for 30 s, 52°C for 45 s, 68°C for 45 s) and a final extension at 68°C for 5 min. The resulting product was diluted 1 : 100 and re-amplified by Taq PCR (Invitrogen) using a single couple of nested primers for each specific gene studied. The second amplification consisted of an initial denaturation step at 94°C for 2 min followed by 35 cycles (94°C for 30 s, 55°C for 45 s, 72°C for 45 s) and a final extension at 72°C for 5 min. One-fifth of the PCR product was run on an agarose gel and stained with ethidium bromide.

Immunocytochemistry

Square pieces of central pig retina were fixed for 8 min at +4°C in 4% paraformaldehyde (PFA) prepared in 0.1 M PBS (pH 7) and cryoprotected by immersion in sucrose gradients. Cultured cells were similarly immersion fixed with 4% PFA for 15 min. Retinal sections (12 µm) obtained on a cryostat were preincubated for 1 h in PBS containing 10% normal goat serum (NGS), 1% bovine serum albumin (BSA) and 0.5% Triton X-100. Cultured cells were permeabilized for 5 min with 0.1% Triton X-100 and saturated for 1 h in PBS containing 0.1% BSA and 1% Tween-20. Cultured cells or retinal sections were incubated overnight with the primary antibodies, followed by 1 h incubation with the nuclear dye DAPI (1 : 200, Sigma) and the secondary antibodies conjugated either to Alexa Fluor 594 (red emission) or Alexa Fluor 488 (green emission) (1 : 400, Molecular Probes). All antibodies were diluted in PBS, pH 7.4, containing 3% NGS, 1% BSA and 0.5% Triton X-100 and all incubations were performed at room temperature.

Stainings were achieved with a rabbit polyclonal antibody directed against a human sequence of the cone arrestin (hCAR, 1 : 40 000, QKAVEAEGDEGS, Li et al. 2003) and a monoclonal antibody recognizing an epitope between positions 96 and 105 of the glycine receptor {alpha}1 subunit (mAb4a, 1 : 100, Schröder et al. 1991), a sequence highly conserved in all {alpha} subunits and the ß subunit (Grenningloh et al. 1987, 1990; Kuhse et al. 1990; Harvey et al. 2000). Fluorescent labelling was observed using a Nikon Optiphot 2 microscope under epifluorescence illumination and images were acquired with a colour Cool-Snap FX CCD camera (Roper Scientific Inc., Evry, France).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Glycine elicited chloride currents in cone photoreceptors

Responses to voltage steps from cultured photoreceptors can be separated into two representative types corresponding to the two groups of retinal photoreceptors, namely rods and cones (Fig. 1A and B). Figure 1E illustrates that glycine (1 mM) applied in the bath perfusion elicited a large inward current in 8 out of 33 cone photoreceptors (24%) maintained at a holding potential of –70 mV with symmetrical Cl concentrations. The current decreased slowly during the continuous perfusion of glycine. However, bath application of glycine did not induce any current in any of the recorded rods (n= 20) (Fig. 1C and D). To assess whether glycine receptor expression was not induced as a result of the culture conditions, cones were recorded immediately after the dissection procedure and glycine-elicited currents were recorded in four cone photoreceptors (Fig. 1F and G). However, due to the frequent loss of synaptic endings during the preparation, cultured cells which regrow processes after a few days in vitro (Balse et al. 2005) were preferred for the following pharmacological characterization.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
 
Figure 1.  Glycine responses in cultured and freshly dissociated photoreceptors of the adult pig retina
A–B, current–voltage relationships of cultured rod (A) and cone (B) photoreceptors when stepping the membrane potential from –120 mV to +50 mV in 10 mV increments. C–E, effect of bath-perfusion of glycine (1 mM) in a representative cultured rod (C) and in two cultured cones (D and E) voltage-clamped at –70 mV. Note that some cultured cones responded to glycine whereas rod never generated a current (n= 20). F and G, response of a freshly isolated cone photoreceptor submitted to a puff-application of 1 mM glycine (CP: cone pedicle; Ax: axon; CB: cell body; IS: inner segment; OS: outer segment).

 
To determine whether the glycine-induced current in cones was carried by a chloride channel, its reversal potential was measured in the presence of different chloride concentrations in the recording pipette (Fig. 2). Glycine puffs (1 mM) were delivered while cells were voltage clamped at varying potentials ranging from –70 to +40 mV (10 mV increment steps). The current–voltage (I–V) relationships of glycine-elicited responses were linear in the voltage range examined. The reversal potential for glycine shifted from 2.2 mV (±1.1, n= 3) when Cl concentrations were symmetrical to –28.8 mV (±1.8, n= 7) when the calculated Cl equilibrium potential was brought to –30 mV by substituting gluconate for Cl in the recording pipette solution. This shift in the reversal potential indicates that glycine selectively activates a Cl conductance in cultured cone photoreceptors.


Figure 2
View larger version (12K):
[in this window]
[in a new window]
 
Figure 2.  Cl dependence of glycine-elicited responses in cultured cones
A, glycine-elicited currents in two cones with different calculated equilibrium potentials for Cl (left: 0 mV; right: –30 mV). Cells were voltage clamped at potentials ranging from –70 mV to 40 mV in 10 mV increments and glycine (1 mM) was puff-applied for 50 ms. B, current–voltage relation of the averaged glycine-elicited responses in cone photoreceptors with different calculated equilibrium potentials for Cl ({blacksquare}, ECl= 0 mV, n= 3; •, ECl=–30 mV; n= 7).

 
Pharmacological characterization of glycine receptors

All glycine receptors coupled to Cl channels are sensitive to strychnine. To further confirm the presence of glycine receptors in cone photoreceptors, strychnine was bath-applied during puff application of glycine (50 ms puff, 1 mM). Figure 3A illustrates that strychnine (1 µM) completely suppressed the glycine response (96.7 ± 0.8%, n= 10). After washing strychnine, the glycine response recovered to its original amplitude. At lower concentrations (1 nM to 100 nM), strychnine suppressed the glycine-induced current in a concentration-dependent manner (data not shown).


Figure 3
View larger version (24K):
[in this window]
[in a new window]
 
Figure 3.  Pharmacology of glycine receptors in cultured cone photoreceptors
A and B, strychnine (1 µM) completely suppressed the glycine-elicited current (A) whereas picrotoxin (100 µM) did not affect the response (B). C and D, ß-alanine- and taurine-elicited currents were partly suppressed by bath application of the GABAA and GABAC receptor antagonists, SR95531 (100 µM) and TPMPA (50 µM), the remaining currents being totally inhibited by strychnine. E, both ß-alanine (6 mM) and taurine (5 mM) completely suppressed the glycine-elicited response while inducing a steady state current. In this experiment, SR95531 (100 µM) and TPMPA (50 µM) were continuously bath-applied. F, measurements of glycine-elicited responses and the holding current following during ß-alanine and taurine bath applications. Note that the holding current increased during agonist applications and reflecting the steady state current generated by these amino acids. Amino acids were puff-applied on cultured cones voltage clamped at –70 mV (glycine in A and B: 1 mM, 50 ms; ß-alanine in C: 6 mM, 3 s; taurine in D: 5 mM, 3 s). In E, glycine (1 mM, 3 s) was puff-applied while ß-alanine (6 mM) and taurine (5 mM) were bath-perfused.

 
The glycine response was also measured in the presence of picrotoxin, a GABAA and GABAC receptor antagonist as previously shown on cultured pig cone photoreceptors (Picaud et al. 1998b); picrotoxin is also known to suppress glycine responses generated by {alpha}-homomeric glycine receptors while having a poor action on {alpha}–ß heteromeric glycine receptors (Rajendra et al. 1997; Zhorov & Bregestovski, 2000; Legendre, 2001). When picrotoxin (100 µM) was bath applied, the glycine response remained unaffected (Fig. 3B) with an insignificant decrease (3.7 ± 5.8%, n= 7). This result indicated that the glycine response was not generated by cone GABA receptors but instead by the activation of glycine receptors with a heteromeric subunit composition.

Glycine receptors were reported to be activated by other amino acids like taurine and ß-alanine (Rajendra et al. 1997). Since these molecules, and especially taurine, are found at high levels in the retina, we tested whether these amino acids could activate glycine receptors expressed by cone photoreceptors. When saturating concentrations of either ß-alanine (6 mM) or taurine (5 mM) were puff-applied on cone photoreceptors, they generated larger currents than glycine application (glycine: –784 ± 293 pA pF–1, n= 11; ß-alanine: –1652 ± 762 pA pF–1, n= 5; taurine: –672 ± 251 pA pF–1, n= 5). To suppress cone GABAA and GABAC receptor activation by these amino acids, the respective GABAA and GABAC receptor antagonists SR95531 (100 µM) and TPMPA (50 µM) were bath-applied during taurine and ß-alanine puff applications. These GABA antagonists reduced the ß-alanine- and the taurine-elicited response by 22.4 ± 8.2% (n= 5) and 43.7 ± 8.7% (n= 5), respectively (Fig. 3CD). These observations were consistent with the GABA receptor activation by ß-alanine and taurine (Rajendra et al. 1997). The remaining currents were completely suppressed by addition of 1 µM strychnine in the bath perfusion (ß-alanine: 95.3 ± 1.2%, n= 5; taurine: 98.4 ± 0.6%, n= 5) (Fig. 3CD). This pharmacology suggested that, in glycine-sensitive cone photoreceptors, ß-alanine and taurine can elicit currents by both GABA and glycine receptor activation.

To further demonstrate that ß-alanine and taurine can act as agonists of glycine receptors in cone photoreceptors, saturating concentrations of these amino acids were applied in the bath perfusion during glycine puff application. These measurements were performed in the presence of the selective GABAA and GABAC receptor antagonists, SR95531 (100 µM) and TPMPA (50 µM), to prevent GABA receptor activation by the amino acids. Bath-perfusion of ß-alanine (6 mM) induced a steady state current, increasing thereby the holding current from –16 ± 6 pA to –122 ± 24 pA (n= 6, 7.6-fold increase) at a holding potential of –70 mV (Fig. 3E). Under these conditions, the glycine-elicited response was completely suppressed (99.2 ± 0.2%, n= 6) with respect to the control glycine response (Fig. 3E). The glycine response recovered, however, after washing ß-alanine from the recording chamber. Similarly, bath-perfusion of taurine (5 mM) generated a steady-state inward current shifting the holding current of cones from –28 ± 8 pA to –85 ± 7 pA (n= 5, 3-fold increase) (Fig. 3E). Again, the glycine-elicited response was almost completely suppressed (93.2 ± 2.8%, n= 5) (Fig. 3E). Finally, the glycine response was recovered upon washing taurine from the recording chamber (Fig. 3E). Figure 3F illustrates the respective evolution of the steady-state current and the glycine-elicited current during the ß-alanine and taurine perfusions. These results indicated that ß-alanine and taurine can act as agonists of the glycine receptors in cone photoreceptors.

Glycine receptor expression in freshly dissociated cones

To determine whether cone photoreceptors expressed the glycine receptor in situ, expression of the ß subunit of the glycine receptor (GLRB gene) was assessed by single cell RT-PCR on cone photoreceptors purified following a new lectin-panning method (Balse et al. 2005). Cells were randomly collected under microscopic observation with a patch-clamp recording pipette. Expression of the ß subunit was thus examined in three independent experiments, on either freshly dissociated cells (12 cells, 17 cells, 17 cells: n= 46) or cells cultured for 2–5 days (12 cells, 15 cells, 17 cells: n= 44). The identity of the cells as cone photoreceptors was determined by the expression of the cone arrestin mRNA (ARR3 gene). In each experiment, potential sources of contamination such as RT-PCR buffers, pipette recording solution and perfusing solution were verified (Fig. 4, line 1). Similarly, a potential genomic contamination was excluded by omitting the Super-Script reverse transcriptase replaced by Taq Platinum alone (Fig. 4, line 2). No signal was present in these different controls whereas the expected 291 bp product corresponding to the cone arrestin fragment was observed in all freshly dissociated cone photoreceptors (n= 46) and in 90% of cultured cells (10/12, 13/15, 17/17). As illustrated in Fig. 4 (lanes 3–7), some cells coexpressed the mRNAs of the glycine receptor ß subunit and of cone arrestin. Indeed quantitative analysis revealed that 12% of the freshly purified cone photoreceptors (1/12, 3/17, 2/17) and 13% of the cultured cone photoreceptors (1/12, 1/15, 4/17) expressed the glycine receptor ß subunit. Together with electrophysiological evidence of glycine responses in freshly isolated cones photoreceptors, these results suggest that the culture conditions are not responsible for a neosynthesis of the glycine receptor and that a minor population of cone photoreceptors express glycine receptors in situ.


Figure 4
View larger version (99K):
[in this window]
[in a new window]
 
Figure 4.  Single-cell RT-PCR analysis of the glycine receptor ß subunit expression in different subpopulations of freshly purified cones photoreceptors
A 100 bp DNA standard marker ladder is shown on lanes M. Lanes 1 and 2 were negative controls: RT-PCR on PCR buffer and patch clamp buffers (intrapipette buffer + perfusing solution) and samples without reverse transcriptase, respectively. Lanes 3–7 illustrate amplified DNA products corresponding to cone arrestin mRNA (top), S-opsin mRNA (middle) and ß-subunit mRNA (bottom) from 5 independent freshly isolated cells. DNA products were resolved in a 1.2% agarose gel and visualized with ethidium bromide.

 
The glycine receptor expression is not correlated to the colour sensitivity of the cone

To determine whether the population of cone photoreceptors expressing the glycine receptor had specific colour sensitivity, expression of the blue-sensitive opsin was compared to that of the glycine receptor ß subunit. Freshly purified cells obtained from two independent experiments (17 cells and 17 cells) were randomly collected using a patch clamp pipette and submitted to RT-PCR with three couples of primers designed from the coding sequences of the pig cone arrestin, the blue-sensitive opsin and the glycine receptor ß subunit. Figure 4 illustrates the distribution of the glycine receptor ß subunit among different populations of freshly dissociated cone photoreceptors. While cone photoreceptors expressing the blue-sensitive opsin mRNA can express the glycine receptor ß subunit (Fig. 4, lane 5), some cones that are not expressing the blue opsin are also positives for the ß subunit mRNA (Fig. 4, lanes 3 and 6). Quantitative analysis demonstrated that among freshly dissociated cone photoreceptors identified by detection of the cone arrestin mRNA, 4 out of 34 cells (1/17, 3/17) expressed the blue-sensitive opsin and 5 out of 34 cells (3/17, 2/17) expressed the ß subunit of the glycine receptor. Among the blue-sensitive cone population, only one coexpressed the ß subunit of the glycine receptor (1/4) while among the population of cones negative for the blue-sensitive opsin, 4 out of 30 expressed the glycine receptor ß subunit. These results demonstrate that the glycine receptor expression was not related to a cone subtype with specific colour sensitivity.

Immunohistochemical staining of the glycine receptor in pig retinal slices and in cultured cells

Figure 5A and B illustrates the immunolabelling on a vertical section through the adult pig retina with the cone arrestin antibody (green) and the mAb4a antibody (red), which recognizes all {alpha} subunits and the ß subunit of glycine receptors. The retinal layers of the vertical section are indicated in the overlapped Nomarski image of Fig. 5A while the pattern of the labelling with the mAb4a antibody is selectively shown in Fig. 5B. As in other species, the inner plexiform layer (IPL) exhibits a prominent staining where three horizontal bands can be distinguished. However, some cell bodies located in the lower part of the inner nuclear layer (INL) also appeared immunopositive for the mAb4a antibody and a weak staining in the outer plexiform layer (OPL), located close to the cone terminals, can also be distinguished (arrows). At higher magnification, distinct puncta become apparent in the OPL (Fig. 5C, arrows) that superposed with the arrestin-positive cone photoreceptor terminals (Fig. 5E). In cultures, rare cone photoreceptors that were identified by the cone arrestin antibody were also immunopositive with the mAb4a glycine receptor antibody (Fig. 5FH). As in pig retinal sections, the mAb4a staining appeared punctuate in vitro, suggesting a clustered organization of glycine receptors in cone photoreceptors.


Figure 5
View larger version (80K):
[in this window]
[in a new window]
 
Figure 5.  Glycine receptor immunolabelling in pig retinal sections and cultured photoreceptors on a glial cell feeder layer
A and B, fluorescence images showing the mAb4a immunoreactivity (red) in a vertical section of the pig retina also labelled for the cone arrestin (green). Retinal layers are visible on the superimposed Nomarski image (A). Arrows in B indicate an OPL location of glycine receptors in the pig retina. C–E, epifluorescence images focused on the OPL showing mAb4a-immunoreactive puncta (red) in some cone photoreceptor synaptic endings as revealed with the cone arrestin antibody (green). Arrows in C and E point out puncta of glycine receptors on a cone terminal. F–H, glycine receptor immunolabelling in cultured photoreceptors on a glial feeder cell layer. Very few cone photoreceptors that were identified with the cone arrestin antibody (green) were double-labelled with the mAb4a antibody (red) in vitro. Scale bars represent 10 µm in (A and B), 5 µm (C–H).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Our results indicate that a minority of cone photoreceptors (24%) in culture showed glycine-elicited responses. These receptors have a heteromeric {alpha}–ß subunit composition, are sensitive to strychnine and can be activated also by both ß-alanine and taurine. Single cell RT-PCR analyses indicate that a similar proportion of freshly dissociated cone photoreceptors expressed the ß subunit of the glycine receptor (13%). The cone population expressing glycine receptors did not correlate with any population of colour specific cone photoreceptors. This minority of glycine-sensitive cone photoreceptors thus constitutes a new cone population and suggests an unexpected role for glycine in the visual information processing at the level of the outer retina.

Glycine receptor expression in cone photoreceptors

Pig cell cultures were previously used to demonstrate the presence of GABAA and GABAC receptors in all cone photoreceptors (Picaud et al. 1998b). GABA receptors were also found in cone photoreceptors recorded from isolated rd mouse retina (Pattnaik et al. 2000) and from C57BL/6J mouse retinal slices (Roux et al. 2005). By contrast, most primate cones had no responses to GABA puff or occasionally the size of a small puff artefact (Verweij et al. 2003). Our present study is consistent with GABA receptor expression in all cultured pig cones (Picaud et al. 1998b) and indicates further that a minor population of cultured pig cone photoreceptors express functional heteromeric glycine receptors. Single cell RT-PCR experiments demonstrated further that a fraction of the freshly isolated cone photoreceptors expressed the ß subunit of the glycine receptor. With this technique, there were fewer cones that expressed the glycine receptor than there were cultured cones that were sensitive to glycine, suggesting thereby either that glycine-sensitive cones survived better in culture or more likely that the single cell RT-PCR technique was less sensitive than patch clamp recording. As reported previously (Rajendra et al. 1997), these glycine receptors were sensitive to ß-alanine or taurine. In our experimental conditions, the absences of a glycine response in the presence of bath-applied ß-alanine or taurine confirmed that the concentrations used in these experiments were saturating the receptors (Rajendra et al. 1997).

The sparse glycine receptor distribution in the outer retina of cat, monkey, rat, rabbit (Grünert & Wässle, 1993) and mouse (Pinto et al. 1994) that was attributed to bipolar cells may actually correspond to our minor cone population. This labelling was observed with antibodies localizing only the {alpha}1 subunit or both {alpha}/ß subunits (Grünert & Wässle, 1993). This labelling was originally attributed to bipolar cells because they respond to glycine applied to their dendrites (Karschin & Wässle, 1990; Suzuki et al. 1990). However, several reasons suggest that this sparse receptor immunolabelling could also be located in the terminals of a minor cone population rather than in the dendrites of the numerous bipolar cells. The available antibodies may indeed not recognize the glycine receptor expressed in bipolar cells by contrast to that expressed in cone photoreceptors (Fig. 5FH). Indeed, although all rod bipolar cells generated a glycine response at both their dendrites and their axons, no consistent immunolabelling of their axons was observed (Grünert & Wässle, 1993; Sassoe-Pognetto et al. 1994). Furthermore, considering the high number of rod bipolar cells, one should expect a very dense immnolabelling of the outer plexiform layer if all their dendrites were decorated with the glycine antibody as expected from the cell recording. For these different reasons, we believe that previous studies showing a sparse glycine receptor immunolabelling in the OPL could be consistent with the glycine receptor expression in the terminals of a minor population of cone photoreceptors.

Physiological role of the glycine receptor in cone photoreceptors

The physiological role of the glycine receptors in cone photoreceptors is highly reliant on the origin of their agonist. Glycine was located in cone photoreceptors during development only at P1 in the rat retina (Pow & Hendrickson, 2000). Although in the early stage of development photoreceptors may release glycine or taurine since glycine receptor activation appears crucial for rod photoreceptor development (Young & Cepko, 2004), a high concentration of glycine was not detected in photoreceptors at later stages. In fact, taurine is the only agonist of glycine receptors known to be released by adult photoreceptors, where it plays a role in maintaining photoreceptor osmolarity (Lombardini, 1991). Glycine receptors are unlikely to contribute to this osmoregulation of cone photoreceptors because all cone photoreceptors should then express glycine receptors.

At P5–P10, some horizontal cells contained glycine and expressed its transporter GlyT1 (Pow & Hendrickson, 2000). Adult horizontal cells contain the vesicular transporter for GABA and glycine in their dendritic tips at cone and rod photoreceptor terminals (Haverkamp et al. 2000; Cueva et al. 2002; Jellali et al. 2002). Due to the small proportion of cone photoreceptors responding to glycine, it cannot be excluded that the presence of glycine was missed in the very few corresponding presynaptic dendritic tips of horizontal cells. In this context, it is interesting to note that horizontal cell differentiation is controlled by the Barhl2 homeobox gene, which also regulates the specification of glycinergic amacrine cells and not that of GABAergic amacrine cells (Mo et al. 2004). However, the lack of colour specificity in their cone expression suggest that glycine receptors are unlikely to contribute to the horizontal cell inhibitory feedback to cones.

In the OPL of adult monkeys, cats and rats, glycine and the glycine transporter GlyT1 were localized in the very few processes of interplexiform cells (Pow & Hendrickson, 1999). In the monkey OPL, the sparse glycine receptor immunostaining was even described by Grünert & Wässle (1993) as ‘pearls on a string’, which suggested to the authors that they might be associated with a single interplexiform cell process. If as discussed above, this sparse glycine immunolabelling corresponds to the staining of cone photoreceptor terminals, it would be consistent with the population of glycine-sensitive cones. Glycine receptors in cone photoreceptor terminals are therefore most likely activated by glycine released from interplexiform cells. However, the functional significance of the interplexiform cell feedback to the OPL and more specifically to cone photoreceptors remains to be elucidated.

Conclusions

This study indicates, through electrophysiological and molecular evidence, that a population of cone photoreceptors expresses glycine receptors, suggesting a potential role for glycine in the outer retina. However, the functional relevance of these glycine receptors in the visual information processing is still unclear. Future studies will have to clarify the role of the glycinergic feedback from interplexiform cells to cone photoreceptors.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Balse E, Tessier LH, Fuchs C, Forster V, Sahel JA & Picaud S (2005). Purification of mammalian cone photoreceptors by lectin-panning and the enhancement of their survival in glia-conditioned medium. Invest Ophthalmol Vis Sci 46, 367–374.[Abstract/Free Full Text]

Cueva JG, Haverkamp S, Reimer RJ, Edwards R, Wässle H & Brecha NC (2002). Vesicular gamma-aminobutyric acid transporter expression in amacrine and horizontal cells. J Comp Neurol 445, 227–237.[CrossRef][Medline]

Dumoulin A, Triller A & Dieudonne S (2001). IPSC kinetics at identified GABAergic and mixed GABAergic and glycinergic synapses onto cerebellar Golgi cells. J Neurosci 21, 6045–6057.[Abstract/Free Full Text]

Gasnier B (2000). The loading of neurotransmitters into synaptic vesicles. Biochimie 82, 327–337.[Medline]

Gaudin C, Forster V, Sahel J, Dreyfus H & Hicks D (1996). Survival and regeneration of adult human and other mammalian photoreceptors in culture. Invest Ophthalmol Vis Sci 37, 2258–2268.[Abstract/Free Full Text]

Grant GB & Werblin FS (1994). Low-cost data acquisition and analysis programs for electrophysiology. J Neurosci Meth 55, 89–98.[CrossRef][Medline]

Grenningloh G, Pribilla I, Prior P, Multhaup G, Beyreuther K, Taleb O & Betz H (1990). Cloning and expression of the 58 kd beta subunit of the inhibitory glycine receptor. Neuron 4, 963–970.[CrossRef][Medline]

Grenningloh G, Rienitz A, Schmitt B, Methfessel C, Zensen M, Beyreuther K, Gundelfinger ED & Betz H (1987). The strychnine-binding subunit of the glycine receptor shows homology with nicotinic acetylcholine receptors. Nature 328, 215–220.[CrossRef][Medline]

Grünert U & Wässle H (1993). Immunocytochemical localization of glycine receptors in the mammalian retina. J Comp Neurol 335, 523–537.[CrossRef][Medline]

Guidry C (1996). Isolation and characterization of porcine Muller cells. Myofibroblastic dedifferentiation in culture. Invest Ophthalmol Vis Sci 37, 740–752.[Abstract]

Harvey RJ, Schmieden V, Von Holst A, Laube B, Rohrer H & Betz H (2000). Glycine receptors containing the alpha4 subunit in the embryonic sympathetic nervous system, spinal cord and male genital ridge. Eur J Neurosci 12, 994–1001.[CrossRef][Medline]

Haverkamp S, Grunert U & Wässle H (2000). The cone pedicle, a complex synapse in the retina. Neuron 27, 85–95.[CrossRef][Medline]

Jellali A, Stussi-Garaud C, Gasnier B, Rendon A, Sahel JA, Dreyfus H & Picaud S (2002). Cellular localization of the vesicular inhibitory amino acid transporter in the mouse and human retina. J Comp Neurol 449, 76–87.[CrossRef][Medline]

Jonas P, Bischofberger J & Sandkuhler J (1998). Corelease of two fast neurotransmitters at a central synapse. Science 281, 419–424.[Abstract/Free Full Text]

Kalloniatis M & Tomisich G (1999). Amino acid neurochemistry of the vertebrate retina. Prog Retin Eye Res. 18, 811–866.[CrossRef][Medline]

Kamermans M & Spekreijse H (1999). The feedback pathway from horizontal cells to cones. A mini review with a look ahead. Vision Res 39, 2449–2468.[CrossRef][Medline]

Karschin A & Wässle H (1990). Voltage- and transmitter-gated currents in isolated rod bipolar cells of rat retina. J Neurophysiol 63, 860–876.[Abstract/Free Full Text]

Keller AF, Coull JA, Chery N, Poisbeau P & De Koninck Y (2001). Region-specific developmental specialization of GABA-glycine cosynapses in laminas I–II of the rat spinal dorsal horn. J Neurosci 21, 7871–7880.[Abstract/Free Full Text]

Kolb H, Cuenca N & Dekorver L (1991). Postembedding immunocytochemistry for GABA and glycine reveals the synaptic relationships of the dopaminergic amacrine cell of the cat retina. J Comp Neurol 310, 267–284.[CrossRef][Medline]

Koulen P, Sassoe-Pognetto M, Grunert U & Wässle H (1996). Selective clustering of GABAA and glycine receptors in the mammalian retina. J Neurosci 16, 2127–2140.[Abstract/Free Full Text]

Kuhse J, Schmieden V & Betz H (1990). Identification and functional expression of a novel ligand binding subunit of the inhibitory glycine receptor. J Biol Chem 265, 22317–22320.[Abstract/Free Full Text]

Legendre P (2001). The glycinergic inhibitory synapse. Cell Mol Life Sci 58, 760–793.[CrossRef][Medline]

Li A, Zhu X, Brown B & Craft CM (2003). Melatonin enhances retinoic acid induction of cone arrestin gene expression in retinoblastoma cells. Adv Exp Med Biol 533, 361–368.[Medline]

Lombardini JB (1991). Taurine: retinal function. Brain Res Brain Res Rev 16, 151–169.[CrossRef][Medline]

Marc RE & Liu WL (1985). (3H) glycine-accumulating neurons of the human retina. J Comp Neurol 232, 241–260.[CrossRef][Medline]

Marc RE, Murry RF & Basinger SF (1995). Pattern recognition of amino acid signatures in retinal neurons. J Neurosci 15, 5106–5129.[Abstract]

McIntire SL, Reimer RJ, Schuske K, Edwards RH & Jorgensen EM (1997). Identification and characterization of the vesicular GABA transporter. Nature 389, 870–876.[CrossRef][Medline]

Mo Z, Li S, Yang X & Xiang M (2004). Role of the Barhl2 homeobox gene in the specification of glycinergic amacrine cells. Development 131, 1607–1618.[Abstract/Free Full Text]

O'Brien JA & Berger AJ (1999). Cotransmission of GABA and glycine to brain stem motoneurons. J Neurophysiol 82, 1638–1641.[Abstract/Free Full Text]

Ortells MO & Lunt GG (1995). Evolutionary history of the ligand-gated ion-channel superfamily of receptors. Trends Neurosci. 18, 121–127.[CrossRef][Medline]

Pattnaik B, Jellali A, Sahel J, Dreyfus H & Picaud S (2000). GABAC receptors are localized with microtubule-associated protein 1B in mammalian cone photoreceptors. J Neurosci 20, 6789–6796.[Abstract/Free Full Text]

Picaud S, Hicks D, Forster V, Sahel J & Dreyfus H (1998a). Adult human retinal neurons in culture: Physiology of horizontal cells. Invest Ophthalmol Vis Sci 39, 2637–2648.[Abstract/Free Full Text]

Picaud S, Pattnaik B, Hicks D, Forster V, Fontaine V, Sahel J & Dreyfus H (1998b). GABAA and GABAC receptors in adult porcine cones: evidence from a photoreceptor-glia co-culture model. J Physiol 513, 33–42.[Abstract/Free Full Text]

Piccolino M (1995). The feedback synapse from horizontal cells to cone photoreceptors in the vertebrate retina. Prog Ret Eye Res 14, 141–196.[CrossRef]

Pinto LH, Grunert U, Studholme K, Yazulla S, Kirsch J & Becker CM (1994). Glycine receptors in the retinas of normal and spastic mutant mice. Invest Ophthalmol Vis Sci 35, 3633–3639.[Abstract/Free Full Text]

Pow DV & Hendrickson AE (1999). Distribution of the glycine transporter glyt-1 in mammalian and nonmammalian retinae. Vis Neurosci 16, 231–239.[CrossRef][Medline]

Pow DV & Hendrickson AE (2000). Expression of glycine and the glycine transporter glyt-1 in the developing rat retina. Vis Neurosci 17, 1–9.[CrossRef][Medline]

Rajendra S, Lynch JW & Schofield PR (1997). The glycine receptor. Pharmacol Ther 73, 121–146.[CrossRef][Medline]

Roux M, Picaud S, Sahel JA & Schwab Y (2005). GABA transmission in the mice outer retina: receptors but no ligand. invest ophthalmol. Vis Sci 45, ARVO E-Abstract 3450.

Sagné C, El Mestikawy S, Isambert MF, Hamon M, Henry JP, Giros B & Gasnier B (1997). Cloning of a functional vesicular GABA and glycine transporter by screening of genome databases. FEBS Lett 417, 177–183.[CrossRef][Medline]

Sassoe-Pognetto M, Wässle H & Grunert U (1994). Glycinergic synapses in the rod pathway of the rat retina: cone bipolar cells express the alpha 1 subunit of the glycine receptor. J Neurosci 14, 5131–5146.[Abstract]

Schröder S, Hoch W, Becker CM, Grenningloh G & Betz H (1991). Mapping of antigenic epitopes on the alpha 1 subunit of the inhibitory glycine receptor. Biochemistry 30, 42–47.[CrossRef][Medline]

Smiley JF & Yazulla S (1990). Glycinergic contacts in the outer plexiform layer of the Xenopus laevis retina characterized by antibodies to glycine, GABA and glycine receptors. J Comp Neurol 299, 375–388.[CrossRef][Medline]

Suzuki S, Tachibana M & Kaneko A (1990). Effects of glycine and GABA on isolated bipolar cells of the mouse retina. J Physiol 421, 645–662.[Abstract/Free Full Text]

Vardi N, Morigiwa K, Wang TL, Shi YJ & Sterling P (1998). Neurochemistry of the mammalian cone ‘synaptic complex’. Vision Res 38, 1359–1369.[CrossRef][Medline]

Verweij J, Hornstein EP & Schnapf JL (2003). Surround antagonism in macaque cone photoreceptors. J Neurosci 23, 10249–10257.[Abstract/Free Full Text]

Wässle H, Koulen P, Brandstatter JH, Fletcher EL & Becker CM (1998). Glycine and GABA receptors in the mammalian retina. Vision Res 38, 1411–1430.[CrossRef][Medline]

Yazulla S (1986). Neurochemistry. Is GABA the neurotransmitter for some photoreceptors? Nature 320, 685–686.[Medline]

Young TL & Cepko CL (2004). A role for ligand-gated ion channels in rod photoreceptor development. Neuron 41, 867–879.[CrossRef][Medline]

Zhorov BS & Bregestovski PD (2000). Chloride channels of glycine and GABA receptors with blockers: Monte Carlo minimization and structure-activity relationships. Biophys J 78, 1786–1803.[Abstract/Free Full Text]


    Acknowledgements
 
We thank Dr Xuemei Zhu, Dr Bruce Brown and Professor Cheryl Craft for kindly providing the anti-arrestin antibody, Dr Olivier Goureau and Dr Xavier Guillonneau for helpful discussions. This work was supported by INSERM, the University Louis Pasteur (Strasbourg), the University Pierre and Marie Curie (Paris VI), the Fondation Ophtalmologique Adolphe de Rothschild (Paris), the Assistance Publique-Hopitaux de Paris (AP-HP), the Fédération des Aveugles de France, the Association Française des Myopathies, RETINA-France and the European Economic Community (EVI-GENORET: LSHG-CT-2005-5120, PRO-AGE-RET: QLK6-2001-00385). E.B. received fellowships from the Fédération des Aveugles de France and from Information Recherche Retinites Pigmentaires.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
571/2/391    most recent
jphysiol.2005.100891v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balse, E.
Right arrow Articles by Picaud, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balse, E.
Right arrow Articles by Picaud, S.
Related Collections
Right arrow Neuroscience


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS