|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Skeletal Muscle and Exercise |
1 Section of Neurobiology, Physiology, and Behaviour, College of Biological Sciences, University of California Davis, CA 95616, USA
2 Department of Physiology and Membrane Biology, School of Medicine, University of California Davis, CA 95616, USA
3 Department of Integrative Physiology, University of Colorado, Boulder, CO 80309-0354, USA
| Abstract |
|---|
|
|
|---|
B) luciferase construct into cultured C2C12 myotubes. SOCS-3 overexpression increased NF-
B transcriptional activity by 27-fold. The proximal region of the IL-6 gene promoter contains a NF-
B consensus site, which contributes to increased IL-6 expression in various tissues. SOCS-3 cDNA was cotransfected into cultured C2C12 myotubes with either the IL-6 luciferase construct or a mutated NF-
B IL-6 luciferase construct. SOCS-3 overexpression increased IL-6 transcriptional activity by 15-fold, however, when the NF-
B site was mutated SOCS-3 failed to increase IL-6 transcriptional activity. We subsequently found that IL-6 mRNA expression was elevated in the plantaris and soleus muscles of the trained animals compared to the sedentary animals. Finally, exercise induced a significant reduction in I
B
and increased phosphorylation of I
suggesting that NF-
B activation was elevated after exercise training. These data suggest that training-induced elevations in SOCS-3 expression in skeletal muscle may contribute to the exercise-induced increase in IL-6 expression through alterations in the mechanisms that mediate NF-
B activity.
(Received 22 December 2005;
accepted after revision 15 February 2006;
first published online 16 February 2006)
Corresponding author E. E. Spangenburg: University of California, Section of Neurobiology, Physiology, and Behavior, One Shields Ave, Davis, CA 95616, USA. Email: eespangenburg{at}ucdavis.edu
| Introduction |
|---|
|
|
|---|
In 1982, it was first demonstrated that habitual exercise improved insulin sensitivity of skeletal muscle (Richter et al. 1982). The mechanism that mediates the enhancement of insulin sensitivity in response to exercise has remained elusive. For example, the enhanced insulin sensitivity after exercise is not due to an increase in activation of the insulin-signalling pathway (Treadway et al. 1989; Wojtaszewski et al. 1997, 2000). Thus, it appears that the effect on insulin sensitivity induced by exercise occurs independently of insulin's action on muscle (Holloszy, 2005). Another possibility to consider is that exercise may reduce the expression of genes that modulate the insulin-signalling pathway in muscle.
Recent investigations have suggested that members of the suppressor of cytokine signalling gene family (SOCS) contribute to the development of insulin resistance in peripheral tissue (Rui et al. 2002; Shi et al. 2004; Ueki et al. 2004). The SOCS gene family consists of eight family members (cis and SOCS-17), with each family member having a conserved SOCS-box motif in the C-terminal region of the protein (Alexander & Hilton, 2004). In addition, all of the family members contain a SH2-domain which allows the SOCS proteins to interact with key phosphotyrosine regions of various signalling proteins or membrane-bound receptors (Alexander & Hilton, 2004). SOCS-1 and SOCS-3 also contain a kinase inhibitory region in the N-terminal domain that can reduce or attenuate kinase activity of various signalling proteins. Expression of the SOCS gene family is induced by numerous cytokines (Emanuelli et al. 2001), growth factors (Spangenburg, 2005), and hormones (Emanuelli et al. 2000; Steppan et al. 2005). Recent data have suggested, that the onset of insulin resistance in peripheral tissue is induced by inflammatory cytokines released by macrophages present in adipose tissue (Fain et al. 2004). SOCS-1 and SOCS-3 expression can be induced by a number of cytokines including tumour necrosis factor (TNF)-
(Fasshauer et al. 2004). It is this described function that has made the SOCS family an attractive target for explaining the onset of insulin resistance in various tissues. Indeed, a recent investigation found that overexpression of SOCS-3 induced insulin resistance in liver cells by interacting with the IRS-1 and IRS-2 (Ueki et al. 2004). Similar findings have also been found for SOCS-3 in cultured COS-7 cells (Emanuelli et al. 2001) and adipocytes (Shi et al. 2004). These findings have led to the suggestion that increased SOCS-3 expression can result in insulin resistance and thus potentially lead to the onset of the metabolic syndrome.
The purpose of this investigation was to determine the effect of regular physical activity on the expression of suppressor of cytokine signalling-3 in skeletal muscle and examine a potential molecular mechanism for SOCS-3 expression. We hypothesized that SOCS-3 expression would decrease in skeletal muscle after regular physical activity. This hypothesis was generated based on the fact that regular physical activity improves insulin sensitivity in skeletal muscle (Holloszy, 2005), and overexpression of SOCS-3 results in insulin resistance in various cell culture models (Emanuelli et al. 2001; Shi et al. 2004).
| Methods |
|---|
|
|
|---|
Female Sprague-Dawley rats (age 23 months) were randomly assigned to a chronic exercise training (trained) group (n= 9) or a sedentary group (n= 10). All animals were housed in the same facility with a 12: 12 h lightdark cycle, with food and water provided ad libitum. The first two weeks consisted of a familiarization period where animals ran 20 m min1, with running duration gradually increased from 5 to 30 min over this time (Brown et al. 2003). Treadmill speed and running duration were increased over the next 6 weeks to 20 m min1 (10 min), 28 m min1 (30 min), and 35 m min1 (20 min), and this protocol was maintained until 12 weeks (Brown et al. 2003). Twenty-four hours after the last exercise bout the animals were anaesthetized with sodium pentobarbital (35 mg kg1; I.P. injection). The soleus and plantaris muscles were carefully dissected and frozen in liquid nitrogen. The muscles were then stored at 80°C until needed. The study was conducted under the guidelines accepted by the American Physiological Society and received prior approval from the Institutional Animal Care and Use Committee at the University of Colorado at Boulder.
Citrate synthase activity
Citrate synthase activity was measured according to previously described methods (Srere, 1969) and normalized to the protein content of the sample.
Reverse transcription of total RNA
Total RNA was isolated according to previously described methodology (Spangenburg et al. 2003). One microgram of total RNA was reversed transcribed. Briefly, the RNA was incubated with Super Script II reverse transcriptase (Invitrogen, San Diego, CA, USA), mixed oligo (dT), random decamers (Ambion, Austin, TX, USA) in a 25 µl reaction at 42°C for 50 min. The reaction was inactivated by incubation at 70°C for 15 min. The samples were subsequently stored at 4°C for later use.
PCR
All methods have been previously described (Spangenburg et al. 2003; Spangenburg, 2005). Briefly, a semiquantitative form of PCR was employed using 18S as a standard (Ambion) for each reaction. The following primer sequences were utilized (5'
3'): SOCS-3 sense (
ATGGTCACCCACAGCAAGTTCCCG), SOCS-3 antisense (
TTAAAGTGGAGCATCATACTGATCC). All primers were purchased from Invitrogen. The SOCS-3 primers produced a product size of 550 bp and were designed based on GenBank accession number AFO 75383.
Two microlitres of each reverse transcription reaction were mixed with 12.5 µl of AccuPrime Super Mix II (Invitrogen), 0.5 µM 18S primer/competimer mix, and 0.2 µM target primer mix in final 25 µl volume. SOCS-3 amplifications were performed in an Eppendorf Mastercycler with an initial denaturing step of 94°C for 2 min, followed by 30 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C as previously described (Huang et al. 2003). The final cycle ended with 10 min at 72°C. The signal determined for each target was subsequently normalized to the signal for the 18S target as previously described (Spangenburg et al. 2003; Spangenburg, 2005).
Skeletal muscle protein isolation
The muscle tissue was homogenized on ice in buffer containing 50 mM Hepes (pH 7.4), 0.1% Triton X-100, 4 mM EGTA, 10 mM EDTA, 15 mM Na4P2O7H2O, 100 mMß-glycerophosphate, 25 mM NaF, 50 µg ml1 leupeptin, 50 µg ml1 pepstatin, 40 µg ml1 aprotinin, 5 mM Na3VO4, and 1 mM PMSF. After homogenization, the samples were stored at 80°C. The protein concentration of the samples was determined in triplicate via the Bradford procedure (Bio-Rad Protein Assay, Hercules, CA, USA).
I
B
and I
phosphorylation immunoblotting
Equal amounts of total protein (75 µg for plantaris muscle and 50 µg for the soleus muscle) were resolved on 8% SDS-PAGE gels and transferred to PVDF membranes. All blots were then incubated with Ponceau S (Sigma) to ensure equal loading in all lanes (data not shown). The membranes were then blocked with 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween (TBS-T) and probed with either an antibody specific for total I
B or the phosphorylated form of I
(Ser176/180) (Cell Signalling, Beverley MA (1: 1000)). The membranes were washed in TBS-T and then incubated for 1 h with horseradish peroxidase (HRP)-conjugated rabbit secondary antibody (1: 2000; Cell Signalling, Beverley MA, USA). Finally, the HRP activity was detected using enhanced chemiluminescence reagent (Pierce Rockford, IL, USA.). The membrane was exposed to autoradiographic film (Kodak-XAR5) with the exposure time adjusted to keep the integrated optical densities (IOD) within a linear and non-saturated range.
C2C12 cell culture conditions
All cell culture experiments were performed using C2C12 mouse myoblasts (ATCC; Rockville, MD, USA), which were maintained at a subconfluent density at 37°C in 10% CO2 in Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Rockville, MD, USA) supplemented with 20% fetal bovine serum (Life Technologies) and 1% penicillinstreptomycin antibiotic (Life Technologies). Differentiation was induced by transferring the myoblasts to DMEM media containing 2% horse serum (HS) and 1% penicillinstreptomycin antibiotic.
Transient transfection of myotubes
Transient transfections were performed with Lipofectamine PLUS reagent (Invitrogen, CA, USA) according to manufacture's directions and previously described methods (Spangenburg et al. 2004). The 2.1 Kb IL-6 promoter and the mutated IL-6 promoter (Xiao et al. 2004), pEF-driven SOCS-3 cDNA expression construct (Starr et al. 1997), and the NF-
B sensor construct (Stratagene, La Jolla, CA, USA) were utilized. The NF-
B sensor construct contains four multimerized consensus cis-binding elements for the NF-
B transcription factors and was utilized to quantify NF-
B activity in a similar manner as previously described (Spangenburg et al. 2004). The mutated IL-6 promoter contained a non-functional NF-
B binding site within the context of the 2.1 Kb promoter as previously described (Xiao et al. 2004). Briefly, all transfections were carried out on 80% confluent myoblasts in 24-well tissue culture plates with a total of 1.0 µg of DNA per transfection in serum-free DMEM. All assays were performed using equimolar ratios of DNA, with the total amount of DNA per transfection adjusted using the parent vector of SOCS-3 in order to ensure that each well received 1.0 µg of cDNA as previously described (Vyas et al. 2002; Spangenburg et al. 2004). After completion of the transfection, the culture media was changed to differentiation media for 96 h after completion of the transfection. After 96 h, the experiments were terminated by the lysis of the myotubes. Each experiment was conducted three different times (i.e. different sets on different days) with each set having n= 4 different cultures per experiment. All of the data were then pooled, resulting in 12 different measurements made for each group.
Cell lysis and luciferase measurements
Cell lysis and dual-luciferase measurements were performed utilizing the dual-luciferase assay kit (Promega, Madison, WI, USA), as previously described (Vyas et al. 2002). At the prescribed time point, the cells were gently washed twice with PBS, cell lysis buffer was then added, and the plates were gently rocked for 15 min at 4°C. The homogenates were then transferred to a microcentrifuge tube and centrifuged at 13 000 r.p.m. for 1 min. The supernatant was retained and stored at 80°C. All luciferase measurements were normalized to the thymidine kinase-driven Renilla plasmid as internal control as previously described (Vyas et al. 2002). For all conditions, at least three independent experiments were performed, each consisting of 34 separate measurements.
Statisitics
All data are expressed as mean ±S.E.M. Statistical significance was determined using a one-way analysis of variance for multiple comparisons followed by a Tukey's post hoc test. A P value of <0.05 was considered significant.
| Results |
|---|
|
|
|---|
|
B and SOCS-3 expression (Cai et al. 2005). Thus, SOCS-3 cDNA was cotransfected with a NF-
B sensor plasmid (i.e. contains four consensus-binding elements that drive the luciferase reporter construct) in cultured myotubes. Overexpression of SOCS-3 (pEF-SOCS-3) increased NF-
B transcriptional activity by 27-fold compared to the myotubes that were transfected with the empty plasmid (pEF) (Fig. 2B).
|
B-binding element, which appears to play an important regulatory role in IL-6 gene transcription (Xiao et al. 2004) (Fig. 3A). Thus, we cotransfected the C2C12 myotubes with the SOCS-3 cDNA and the 2.1 Kb IL-6 promoter reporter construct (IL-6-luc). We found that overexpression of SOCS-3 resulted in a significant 15-fold increase in IL-6 promoter activity compared to the myotubes transfected with the empty plasmid (Fig. 3B). Subsequently, we cotransfected the myotubes with the SOCS-3 cDNA and either the IL-6 promoter construct or an IL-6 promoter construct in which the NF-
B-binding element has been mutated (IL-6-mut-luc) rendering it non-functional. Interestingly, we found two effects. First, mutation of the NF-
B-binding element resulted in enhanced basal IL-6 promoter activity over the control IL-6 promoter construct (Fig. 3B). However, when the mutated IL-6 promoters were cotransfected with the SOCS-3 cDNA there was no significant difference in IL-6 promoter activity (Fig. 3B). This suggests that SOCS-3 is increasing IL-6 promoter activity by some mechanism involving NF-
B-driven transcriptional activity.
|
|
B's ability to increase transcription is based on the localization of the transcription factor in either the cytoplasm or the nucleus (Delhalle et al. 2004). More specifically, the location of the transcription factor is determined by the binding of NF-
B to I
(Delhalle et al. 2004). In order to induce translocation of NF-
B, I
B
is ubiquinated and degraded, which results in the release of NF-
B allowing it to translocate to the nucleus (Delhalle et al. 2004). The activation of the sequence that results in the ubiquination of I
B
is preceded by the phosphorylation of I
, which subsequently targets I
for ubiquination (Delhalle et al. 2004). Thus, as previously described (Ji et al. 2004; Ho et al. 2005) we measured the total expression of I
B
and the phosphorylation levels of I
as an index of NF-
B activation. We found that the total expression of I
B
was significantly decreased by 16% and 26% in the plantaris and soleus muscles compared to the sedentary animals, respectively (Fig. 5A and B). The phosphorylation status of I
was significantly increased by 44% in the soleus muscle from the trained group compared to the sedentary group (Fig. 6A and B). However, no differences were detected in the phosphorylation status of I
between the plantaris muscles taken from the sedentary and trained groups.
|
|
| Discussion |
|---|
|
|
|---|
B transcriptional activity. The increase in NF-
B transcriptional activity appears to mediate increases in IL-6 promoter activity. Subsequently, we found that exercise training also resulted in increased basal levels of IL-6 mRNA expression, which was associated with decreased expression of I
B
and enhanced phosphorylation of I
both of which are necessary for NF-
B activation. These data suggest for the first time a potential molecular mechanism mediated by exercise-induced SOCS-3 expression which results in increased NF-
B activation (Fig. 7).
|
Skeletal muscle has been shown to produce and release IL-6, which results in significant increases of IL-6 in the serum (Carey & Febbraio, 2004; Febbraio & Pedersen, 2005). Further, evidence has shown that acute exercise results in increased levels of IL-6 mRNA in skeletal muscle, although the mechanisms for this induction remain undefined (Steensberg et al. 2001). Febbraio & Pedersen, (2005) dubbed IL-6 as a myokine and suggest that IL-6 may act to alter or enhance mobilization of substrates that could be used as energy sources by skeletal muscle. In addition, recent data have suggested that IL-6 can improve insulin sensitivity in skeletal muscle (Weigert et al. 2005). Although, exercise clearly results in the production of IL-6 by skeletal muscle, the mechanism that induces IL-6 mRNA upregulation is unclear at the moment. Here our data suggest that exercise-induced increases in SOCS-3 expression have the ability to enhance activation of NF-
B in skeletal muscle. Interestingly, the IL-6 promoter contains a consensus NF-
B-binding site (Fig. 3A) in the proximal region of the promoter (Xiao et al. 2004), which appears to be critical for the induction of increased IL-6 promoter activity by SOCS-3. This finding is in agreement, with previously published data that overexpression of SOCS-3 in cultured macrophages results in enhanced transcriptional activation of NF-
B (Park et al. 2003). It also should be noted that in cultured myotubes, IL-6 promoter activity is inhibited by NF-
B since the mutation of the NF-
B-binding site resulted in increased activity, however, when SOCS-3 was co-expressed with the mutated IL-6 promoter there was failure to significantly increase activity of the IL-6 promoter. This mechanistic dichotomy of NF-
B may occur due to the fact that the transcription factor usually exists as a dimer, which can be made up of any combination of p50(p105), p52 (p100), p65, Rel-B, and c-Rel (Delhalle et al. 2004). Thus, it is possible that depending upon which complex of proteins is recruited to the promoter, there will be differing activation of the IL-6 promoter. There is precedence for this in muscle, as it has been found that during muscle atrophy NF-
B-driven gene transcription was increased; however, the NF-
B complex did not consist of the prototypical p50/p65 heterodimer, instead they found that Bcl-3-p50 heterodimer was contributing to the activation of the NF-
B-driven transcription (Hunter et al. 2002). This contrasts the other recent data which found that acute exercise induced translocation of p50 to the nucleus in muscle (Ji et al. 2004). Thus, it is possible that activation levels of the promoter for that target gene depend on which NF-
B heterodimer is present on the cis-element. Our culture data were in agreement with our animal data in that basal levels of IL-6 mRNA were in fact elevated in the trained soleus and plantaris muscles. Further, decreased expression of I
B
and enhanced phosphorylation of I
, both of which are necessary for activation of NF-
B were found in the trained muscles versus the muscles taken from the sedentary animals. These data agree with very recent suggestions that NF-
B is activated in skeletal muscle by exercise (Ji et al. 2004; Ho et al. 2005). Thus, our data coupled with previously published data suggest that exercise increases SOCS-3 expression in muscle, and the increase in SOCS-3 potentially contributes to increases in IL-6 transcription through an unknown interaction with the NF-
B signalling pathway (Fig. 7).
These findings are interesting in that SOCS-3, IL-6, and NF-
ß have all been suggested to contribute to peripheral insulin resistance (Perseghin et al. 2003; Ueki et al. 2004) and thus contribute to the onset type 2 diabetes. However, in our hands and in the hands of others all of these gene products (SOCS-3 or IL-6) or activation levels (NF-
B) have been shown to increase in skeletal muscle with exercise (Steensberg et al. 2001; Ji et al. 2004; Ho et al. 2005). The generation of transgenic mice that specifically overexpress IL-6 (Lieskovska et al. 2003) and activated I
(Cai et al. 2004) (leads to hyperactivation of NF-
B) have been shown to develop smaller skeletal muscles. Interestingly, hyperactivation of NF-
B in skeletal muscle did not result in insulin resistance of the muscle, however, NF-
B activation in the liver did result in overall systemic insulin resistance (Cai et al. 2004, 2005). Further, infusion of recombinant IL-6 onto the tibalis anterior muscle resulted in muscle atrophy, which correlated with increase SOCS-3 mRNA expression (Haddad et al. 2005). Finally, increased SOCS-3 expression in skeletal muscle has been implicated in the muscle atrophy process as well (Lieskovska et al. 2003; Haddad et al. 2005). Thus, at this moment it is unclear how three distinct genes appear to have some sort of complex interplay and yet are all found to be active in very contradicting processes (e.g. exercise, insulin resistance, and muscle atrophy). One possible explanation is that NF-
B actually exists as a complex of proteins (Delhalle et al. 2004). More specifically, NF-
B can be a homodimer of p50 or p65 or a hetrodimer of p50 and p65 (Delhalle et al. 2004). It has been suggested that the form of NF-
B that is activated may dictate what ultimate physiological result is achieved in skeletal muscle. It is possible that a similar finding may apply for SOCS-3 and IL-6, in the context that elevation of expression of these genes becomes critical for the determination of the functional outcome in the muscle. What is clear is that these findings indicate that it is necessary to conduct more detailed experiments concerning the role of SOCS-3 in skeletal muscle.
Habitual exercise training induces many phenotypic changes in skeletal muscle. At this time investigators have only begun to recently unravel the molecular and cellular mechanisms that contribute to these training-induced changes. Here, our data indicate that chronic exercise induced increases in SOCS-3 gene expression in both the soleus and plantaris muscles. We have suggested that this increase in SOCS-3 expression may result in increased basal levels of IL-6 mRNA in the muscle due to increased transcriptional activation of the IL-6 gene promoter. All of our measures that were taken from the animal were made 24 h after the last bout of exercise. We expect that this was sufficient time to ensure that any changes measured are due to an effect of the chronic training and not of the last bout of exercise completed by the animal. However, it is possible and should not be ruled out that the increased SOCS-3 and IL-6 mRNA levels could in fact be due to changes induced by the last bout of exercise completed by the animal. This point must be considered since there is precedence for elevations in gene expression to be totally returned to baseline 24 h after the last bout of exercise; however, the same investigation also found that transcriptional activation of other genes had not returned to baseline 24 h after the last bout of exercise (Hildebrandt et al. 2003). Clearly, more studies will need to be conducted to clarify this point.
In conclusion, these data demonstrate for the first time that exercise training increases SOCS-3 expression in both fast and slow fibre-dominated skeletal muscle. In addition, the data suggest that exercise-induced increases in IL-6 production may be mediated by SOCS-3's ability to affect NF-
B-induced transcription of the IL-6 promoter. Clearly, the role of SOCS-3 in skeletal muscle is complex and will require more experiments to elucidate the role it plays in muscle function.
| References |
|---|
|
|
|---|
Booth
FW, Chakravarthy
MV, Gordon
SE
&
Spangenburg
EE (2002). Waging war on physical inactivity: using modern molecular ammunition against an ancient enemy. J Appl Physiol
93, 330.
Brown
DA, Jew
KN, Sparagna
GC, Musch
TI
&
Moore
RL (2003). Exercise training preserves coronary flow and reduces infarct size after ischemia-reperfusion in rat heart. J Appl Physiol
95, 25102518.
Cai D, Frantz JD, Tawa NE Jr, Melendez PA, Oh BC, Lidov HG, Hasselgren PO, Frontera WR, Lee J, Glass DJ & Shoelson SE (2004). IKKbeta/NF-kappaB activation causes severe muscle wasting in mice. Cell 119, 285298.[CrossRef][Medline]
Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J & Shoelson SE (2005). Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat Med 11, 183190.[CrossRef][Medline]
Carey AL & Febbraio MA (2004). Interleukin-6 and insulin sensitivity: friend or foe? Diabetologia 47, 11351142.[Medline]
Delhalle
S, Blasius
R, Dicato
M
&
Diederich
M (2004). A beginner's guide to NF-kappaB signaling pathways. Ann N Y Acad Sci
1030, 113.
Emanuelli
B, Peraldi
P, Filloux
C, Chavey
C, Freidinger
K, Hilton
DJ, Hotamisligil
GS
&
Van Obberghen
E (2001). SOCS-3 inhibits insulin signaling and is up-regulated in response to tumor necrosis factor-alpha in the adipose tissue of obese mice. J Biol Chem
276, 4794447949.
Emanuelli
B, Peraldi
P, Filloux
C, Sawka-Verhelle
D, Hilton
D
&
Van Obberghen
E (2000). SOCS-3 is an insulin-induced negative regulator of insulin signaling. J Biol Chem
275, 1598515991.
Fain JN, Bahouth SW & Madan AK (2004). TNFalpha release by the nonfat cells of human adipose tissue. Int J Obes Relat Metab Disord 28, 616622.[CrossRef][Medline]
Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J & Paschke R (2004). Insulin resistance-inducing cytokines differentially regulate SOCS mRNA expression via growth factor- and Jak/Stat-signaling pathways in 3T3-L1 adipocytes. J Endocrinol 181, 129138.[Abstract]
Febbraio MA & Pedersen BK (2005). Contraction-induced myokine production and release: is skeletal muscle an endocrine organ? Exerc Sport Sci Rev 33, 114119.[CrossRef][Medline]
Heath
GW, Gavin
JR, 3rd
Hinderliter
JM, Hagberg
JM, Bloomfield
SA
&
Holloszy
JO (1983). Effects of exercise and lack of exercise on glucose tolerance and insulin sensitivity. J Appl Physiol
55, 512517.
Haddad
F, Zaldivar
F, Cooper
DM
&
Adams
GR (2005). IL-6-induced skeletal muscle atrophy. J Appl Physiol
98, 911917.
Hildebrandt
AL, Pilegaard
H
&
Neufer
PD (2003). Differential transcriptional activation of select metabolic genes in response to variations in exercise intensity and duration. Am J Physiol Endocrinol Metab
285, E1021E1027.
Ho
RC, Hirshman
MF, Li
Y, Cai
D, Farmer
JR, Aschenbach
WG, Witczak
CA, Shoelson
SE
&
Goodyear
LJ (2005). Regulation of IkappaB kinase and NF-kappaB in contracting adult rat skeletal muscle. Am J Physiol Cell Physiol
289, C794C801.
Holloszy
JO (2005). Exercise-induced increase in muscle insulin sensitivity. J Appl Physiol
99, 338343.
Huang KC, Chen CW, Chen JC & Lin WW (2003). Statins induce suppressor of cytokine signaling-3 in macrophages. FEBS Lett 555, 385389.[CrossRef][Medline]
Hunter
RB, Stevenson
E, Koncarevic
A, Mitchell-Felton
H, Essig
DA
&
Kandarian
SC (2002). Activation of an alternative NF-kappaB pathway in skeletal muscle during disuse atrophy. Faseb J
16, 529538.
Ji
LL, Gomez-Cabrera
MC, Steinhafel
N
&
Vina
J (2004). Acute exercise activates nuclear factor (NF)-kappaB signaling pathway in rat skeletal muscle. Faseb J
18, 14991506.
Li
L, Gronning
LM, Anderson
PO, Li
S, Edvardsen
K, Johnston
J, Kioussis
D, Shepherd
PR
&
Wang
P (2004). Insulin induces SOCS-6 expression and its binding to the p85 monomer of phosphoinositide 3-kinase, resulting in improvement in glucose metabolism. J Biol Chem
279, 3410734114.
Lieskovska J, Guo D & Derman E (2003). Growth impairment in IL-6-overexpressing transgenic mice is associated with induction of SOCS3 mRNA. Growth Horm IGF Res 13, 2635.[CrossRef][Medline]
Park SH, Kim KE, Hwang HY & Kim TY (2003). Regulatory effect of SOCS on NF-kappaB activity in murine monocytes/macrophages. DNA Cell Biol 22, 131139.[CrossRef][Medline]
Perseghin G, Petersen K & Shulman GI (2003). Cellular mechanism of insulin resistance: potential links with inflammation. Int J Obes Relat Metab Disord 27 (Suppl. 3), S6S11.[CrossRef]
Richter EA, Garetto LP, Goodman MN & Ruderman NB (1982). Muscle glucose metabolism following exercise in the rat: increased sensitivity to insulin. J Clin Invest 69, 785793.[Medline]
Rieusset
J, Bouzakri
K, Chevillotte
E, Ricard
N, Jacquet
D, Bastard
JP, Laville
M
&
Vidal
H (2004). Suppressor of cytokine signaling 3 expression and insulin resistance in skeletal muscle of obese and type 2 diabetic patients. Diabetes
53, 22322241.
Rui
L, Yuan
M, Frantz
D, Shoelson
S
&
White
MF (2002). SOCS-1 and SOCS-3 block insulin signaling by ubiquitin-mediated degradation of IRS1 and IRS2. J Biol Chem
277, 4239442398.
Shi
H, Tzameli
I, Bjorbaek
C
&
Flier
JS (2004). Suppressor of cytokine signaling 3 is a physiological regulator of adipocyte insulin signaling. J Biol Chem
279, 3473334740.
Spangenburg
EE (2005). SOCS-3 induces myoblast differentiation. J Biol Chem
280, 1074910758.
Spangenburg
EE, Abraha
T, Childs
TE, Pattison
JS
&
Booth
FW (2003). Skeletal muscle IGF-binding protein-3 and -5 expressions are age, muscle, and load dependent. Am J Physiol Endocrinol Metab
284, E340E350.
Spangenburg EE & Booth FW (2003). Molecular regulation of individual skeletal muscle fibre types. Acta Physiol Scand 178, 413424.[CrossRef][Medline]
Spangenburg
EE, Bowles
DK
&
Booth
FW (2004). Insulin-like growth factor-induced transcriptional activity of the skeletal alpha-actin gene is regulated by signaling mechanisms linked to voltage-gated calcium channels during myoblast differentiation. Endocrinology
145, 20542063.
Srere P (1969). Citrate synthase. Meth Enzymol 13, 35.
Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA & Hilton DJ (1997). A family of cytokine-inducible inhibitors of signalling. Nature 387, 917921.[CrossRef][Medline]
Steensberg
A, Febbraio
MA, Osada
T, Schjerling
P, Van Hall
G, Saltin
B
&
Pedersen
BK (2001). Interleukin-6 production in contracting human skeletal muscle is influenced by pre-exercise muscle glycogen content. J Physiol
537, 633639.
Steensberg
A, Keller
C, Starkie
RL, Osada
T, Febbraio
MA
&
Pedersen
BK (2002). IL-6 and TNF-alpha expression in, and release from, contracting human skeletal muscle. Am J Physiol Endocrinol Metab
283, E1272E1278.
Steppan
CM, Wang
J, Whiteman
EL, Birnbaum
MJ
&
Lazar
MA (2005). Activation of SOCS-3 by resistin. Mol Cell Biol
25, 15691575.
Treadway JL, James DE, Burcel E & Ruderman NB (1989). Effect of exercise on insulin receptor binding and kinase activity in skeletal muscle. Am J Physiol 256, E138E144.[Medline]
Ueki
K, Kondo
T
&
Kahn
CR (2004). Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol
24, 54345446.
Vyas
DR, Spangenburg
EE, Abraha
TW, Childs
TE
&
Booth
FW (2002). GSK-3beta negatively regulates skeletal myotube hypertrophy. Am J Physiol Cell Physiol
283, C545C551.
Weigert
C, Hennige
AM, Brodbeck
K, Haring
HU
&
Schleicher
ED (2005). Interleukin-6 acts as insulin sensitizer on glycogen synthesis in human skeletal muscle cells by phosphorylation of Ser473 of Akt. Am J Physiol Endocrinol Metab
289, E251E257.
Wojtaszewski JF, Hansen BF, Gade Kiens B, Markuns JF, Goodyear LJ & Richter EA (2000). Insulin signaling and insulin sensitivity after exercise in human skeletal muscle. Diabetes 49, 325331.[Abstract]
Wojtaszewski JF, Hansen BF, Kiens B & Richter EA (1997). Insulin signaling in human skeletal muscle: time course and effect of exercise. Diabetes 46, 17751781.[Abstract]
Xiao W, Hodge DR, Wang L, Yang X, Zhang X & Farrar WL (2004). NF-kappaB activates IL-6 expression through cooperation with c-Jun and IL6-AP1 site, but is independent of its IL6-NFkappaB regulatory site in autocrine human multiple myeloma cells. Cancer Biol Ther 3, 10071017.[Medline]
| Acknowledgements |
|---|
This article has been cited by other articles:
![]() |
R. A. Frost and C. H. Lang Regulation of muscle growth by pathogen-associated molecules J Anim Sci, April 1, 2008; 86(14_suppl): E84 - E93. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Spangenburg, D. Le Roith, C. W. Ward, and S. C. Bodine A functional insulin-like growth factor receptor is not necessary for load-induced skeletal muscle hypertrophy J. Physiol., January 1, 2008; 586(1): 283 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. Kramer and L. J. Goodyear Exercise, MAPK, and NF-{kappa}B signaling in skeletal muscle J Appl Physiol, July 1, 2007; 103(1): 388 - 395. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Trenerry, K. A. Carey, A. C. Ward, and D. Cameron-Smith STAT3 signaling is activated in human skeletal muscle following acute resistance exercise J Appl Physiol, April 1, 2007; 102(4): 1483 - 1489. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Spangenburg, S. E. Shoelson, C. Weigert, R. Lehmann, E. D. Schleicher, J.-O. Jansson, V. Wallenius, J.-P. Bastard, C. Lagathu, M. Caron, et al. Interleukin-6 does/does not have a beneficial role in insulin sensitivity and glucose homeostasis J Appl Physiol, February 1, 2007; 102(2): 820 - 823. [Full Text] [PDF] |
||||
![]() |
T. Garma, C. Kobayashi, F. Haddad, G. R. Adams, P. W. Bodell, and K. M. Baldwin Similar acute molecular responses to equivalent volumes of isometric, lengthening, or shortening mode resistance exercise J Appl Physiol, January 1, 2007; 102(1): 135 - 143. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |