| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
CELLULAR |
1 Department of Pharmacology and Physiology, University of Rochester Medical Center, Rochester, NY 14642, USA
2 CNRS UMR 8062, Université Paris Sud, Hôpital Marie Lannelongue, 92350 Le Plessis-Robinson, France
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
(Received 5 October 2006;
accepted after revision 6 December 2006;
first published online 7 December 2006)
Corresponding author T. J. Shuttleworth: Department of Pharmacology and Physiology, Box 711, University of Rochester Medical Center, 601 Elmwood Avenue, Rochester, NY 14642, USA. Email: trevor_shuttleworth{at}urmc.rochester.edu
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
STIM1 was originally identified as an adhesion molecule in bone marrow stromal cells (Oritani & Kincade, 1996), and as being involved in the suppression of cell growth (Parker et al. 1996; Sabbioni et al. 1997). This protein possesses a single transmembrane spanning region, and is found in both the plasma membrane and the endoplasmic reticulum (ER) (Manji et al. 2000; Williams et al. 2002; Liou et al. 2005). Current models of the role of STIM1 in regulating Ca2+ entry focus on the protein residing in the ER membrane. Studies showed that the depletion of intracellular Ca2+ stores induces a marked change in the distribution of STIM1 in the ER, from a generally diffuse distribution to the formation of discrete clusters of the protein at sites either within (Zhang et al. 2005) or, as now seems more likely, immediately adjacent to the plasma membrane (Liou et al. 2005; Wu et al. 2006). More recently, it has been demonstrated that this translocation process seen on store depletion immediately precedes the activation of the CRAC channels (Wu et al. 2006), and that the clusters of STIM1 are spatially associated with regions of CRAC channel activity (Luik et al. 2006). Examination of the domain structure of STIM1 indicates an N-terminal region containing a putative Ca2+-binding EF-hand which, it is predicted, would lie within the lumen of the ER. Expression of a STIM1 construct in which this EF-hand had been mutated in a way designed to reduce its Ca2+ affinity results in a similar redistribution of the protein to clusters close to the plasma membrane in the absence of store depletion, and to a constitutively active entry of Ca2+ and CRAC channel activity (Liou et al. 2005; Zhang et al. 2005; Spassova et al. 2006). In addition, recent studies have reported that the cytosolic C-terminal of STIM1 alone was able to activate the CRAC channels, and can interact with, and activate, an expressed store-operated TRP channel, TRPC1 (Huang et al. 2006). Moreover, deletions of certain domains within this region blocked both the translocation of STIM1 to sites near the plasma membrane on store depletion (Baba et al. 2006), as well as the constitutive activation of store-operated Ca2+ entry induced by expression of the EF-hand mutant of STIM1 (Huang et al. 2006). Current models therefore propose that the luminal EF-hand of STIM1 in the ER acts as the sensor for depletion of these Ca2+ stores, signalling the translocation of STIM1 to sites close to the plasma membrane, where it acts to regulate the activity of the store-operated Ca2+ entry channels (Putney, 2005; Marchant, 2005; Luik et al. 2006).
Whilst the role of STIM1 in the regulation of store-operated Ca2+ entry has rapidly become well-established, the effects of STIM1 on other modes of receptor-activated Ca2+ entry, specifically those whose activation is independent of any depletion of intracellular Ca2+ stores, have not been examined. We therefore explored whether STIM1 might affect the arachidonic-acid-regulated Ca2+-selective (ARC) channels (Mignen & Shuttleworth, 2000; Mignen et al. 2001; Shuttleworth et al. 2004). These channels represent a well-characterized, and apparently widely expressed, mode of agonist-activated Ca2+ entry that has been shown to play a specific role in the modulation of oscillatory Ca2+ signals in various non-excitable cells (Mignen et al. 2001, 2005; Shuttleworth et al. 2004). Critically, the agonist-induced activation of these Ca2+ entry channels is entirely independent of the depletion of intracellular Ca2+ stores.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
HEK 293 cells stably transfected with the human m3 muscarinic receptor (m3-HEK cells) were cultured in Dulbecco's modified Eagle's medium (ATCC) supplemented with 10% newborn calf serum in a 5% CO2 incubator at 37°C. Cells were transfected using a Nucleofector (Amaxa) following the manufacturer's instructions, and were assayed by western blot or used in the various experimental protocols approximately 48 h (range 44–54 h) later.
Western blotting and antibodies
Proteins were resolved on 7% SDS-PAGE gels, transferred onto nitrocellulose, and analysed by standard western blotting techniques using the appropriate primary antibody, and goat antimouse HRP secondary antibodies (1:2000 dilution). Visualization of the labelled bands was by chemiluminescence (Western Lightning; Pierce, Rockford, IL, USA) and exposure to Biomax XAR film. Where appropriate, band densities were quantified from 12-bit images using Scion Image software. GOK/STIM1 mouse primary antibodies targeted to an N-terminal domain (BD Biosciences, Bedford, MA, USA) were used at 1:250 dilution. SERCA2 mouse antibodies (Calbiochem), and calreticulin mouse antibodies (BD Biosciences) were both used at a dilution of 1:2500, and a monoclonal 
-actin antibody (Sigma) was used at a 1:5000 dilution.
Expression constructs and siRNA
siRNA duplexes targeting the AGGTGGAGGTGCAATATTA sequence human STIM1 (suggested by Stefan Feske, Harvard Medical School, USA) were obtained from Dharmacon. An AlexaFluor546-labelled siRNA duplex (target sequence – AATTCTCCGAACGTGTCACGT) was used as a control (Qiagen). Human STIM1 in pCMV6-XL5 and the vector backbone were purchased from Origene (Rockville, MD, USA). To generate a siRNA-resistant version of this construct, the siRNA recognition site was silently mutated (two bases changed from G-A and G-C) using QuikChange II (Stratagene). To generate the glycosylation mutant version of STIM1, the two asparagines at positions 131 and 171 in the siRNA-resistant STIM1 construct were mutated to glutamines using the QuikChange Multi kit (Stratagene) as directed by the protocol. Validity of the constructs was confirmed by sequencing. Human STIM1 bearing the D76A/E87A double mutation in the putative EF-hand in the pIRESneo vector was a gift from D. Gill (University of Maryland). For experimental purposes, unless otherwise indicated, all full-length constructs were transfected at a concentration of 0.5 µg (100 µl)–1, and siRNA was transfected at 225 pmol (100 µl)–1.
Whole-cell patch clamp
Patch-clamp recordings of macroscopic whole-cell currents were performed using an Axopatch-200B patch-clamp amplifier (Axon Instruments) essentially as previously described (Mignen & Shuttleworth, 2000; Mignen et al. 2003b). Whole-cell currents were recorded during alternating 250 ms voltage pulses to –80 mV and +60 mV delivered every 2 s from a holding potential of 0 mV. Current–voltage relationships were recorded using 150 ms voltage ramps from –100 to + 60 mV. Data were sampled at 20 kHz during the voltage steps and at 5.5 kHz during the voltage ramps, filtered online at 2 kHz, and digitally filtered offline at 1 kHz. The membrane capacitance of the cells selected for recording was 16.96 ± 0.03 pF (n = 287 cells). Initial current–voltage relationships obtained before activation of the currents were averaged and used for leak subtraction of subsequent current recordings. In the experiments involving cells expressing the EF-hand mutation of STIM1, the presence of a constitutively active CRAC channel current precluded this approach. In this case, the currents obtained after inhibition by La3+ (100 µM) were used for leak subtraction. The extracellular (bath) solution contained (mM) NaCl 140, MgCl2 1.2, CaCl2 10, CsCl 5, D-glucose 30, Hepes 10 (pH 7.4). Unless otherwise indicated, internal (pipette) solutions contained (mM) caesium acetate 140, NaCl 10, MgCl2 3.72, EGTA 10, CaCl2 3.5, Hepes 10 (pH 7.2). Calculated free [Ca2+] and [Mg2+] in this solution were 100 nM, and 3 mM, respectively. This concentration of free Mg2+ was designed to inhibit the activation of MIC/MagNum currents (Kozak et al. 2002; Prakriya & Lewis, 2002; Hermosura et al. 2002), and did not significantly affect the value of either the CRAC currents or the ARC currents. Monitoring at +60 mV provided an additional, highly sensitive, check for activation of these currents, and experiments were terminated on occasions when changes in the currents at this voltage were observed. Where necessary, the external (bath) solution was changed by perfusion of the patch-clamp chamber (approximately 1.5 ml min–1), and all experiments were carried out at room temperature (20–22°C). In experiments examining the effect of the STIM1 N-terminal and IgG2a antibodies, incubations were performed at room temperature for 30–40 min. Because the antibody preparations contained azide, control cells for these experiments were incubated under identical conditions in saline containing the same final concentration of azide (0.002%).
Intracellular Ca2+ measurements
Cells growing on coverslips were loaded with fura-2 by incubation with 2 µM fura-2/AM in Hepes-buffered physiological saline solution containing (mM) glucose 6, NaCl 132.5, MgSO4 1.2, KCl 4.8, KH2PO4 1.2, Hepes 15 (pH 7.4), CaCl2 1.3, for 20 min at 37°C. The loaded cells were then washed with saline and maintained at room temperature for an additional 20 min prior to use. [Ca2+] imaging was performed on an inverted epifluorescence microscope (Nikon 200) equipped with a 40x oil immersion objective lens (NA, 1.3). Alternate excitation of the cells with light at 340 and 380 nm was by a high-speed monochromator (TILL Polychrome IV), and fluorescence images at an emitted wavelength of 500 ± 45 nm were captured and digitized at 12-bit resolution using an interline progressive scan CCD camera (Sensicam QE). Imaging Workbench software, version 5.2 (Indec) controlled both the monochromator and image acquisition by the camera. Images were typically acquired every second with an exposure of 10 ms and stored immediately to hard disk. Background subtraction and calculation of the resulting 340/380 ratio images were performed offline. All experiments were performed at room temperature.
Biotinylation assay
Cell-surface STIM1 was detected using a biotinylation assay in intact cells (Pierce Pinpoint Kit) according to the manufacturer's instructions. In this assay, cell-surface proteins are labelled with a thio-cleavable sulfo-NHS-SS-biotin reagent, followed by lysis and isolation of the labelled proteins on an immobilized NeutrAvid gel column. Retained proteins are released by adding SDS-PAGE sample buffer containing 50 mM DTT and incubating at room temperature for 60 min. Both the flow-through fraction (non-biotinylated) and the subsequently eluted fraction (biotinylated) were analysed by western blotting using the STIM1 antibody. Following stripping, membranes were reprobed with the SERCA2 antibody, and again with the calreticulin antibody.
Statistical analysis
All data are reported as means ± S.E.M. When appropriate, means were compared by Student's t test. P values less than 0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
To explore the effects of STIM1 on both store-operated Ca2+ entry and ARC channel-dependent Ca2+ entry, siRNA against STIM1 was transfected into HEK 293 cells stably expressing the human muscarinic m3 receptor (m3-HEK cells). These cells have been extensively used to characterize the ARC channels, and have also been shown to possess a store-operated Ca2+ conductance that is similar in both its biophysical and pharmacological properties to the ‘classic’ CRAC conductance of Jurkat and RBL cells (Mignen & Shuttleworth, 2000; Mignen & Shuttleworth, 2001). Transfection of these cells with siRNA targeted to human STIM1 (225 pmol (100 µl)–1 for 44–50 h) reduced STIM1 protein expression, as confirmed by western blot (Fig. 1A), and indicated a population average reduction in STIM1 of 68 ± 2% (n = 6). To study the store-operated CRAC currents in these cells, they were subjected to whole-cell patch clamp with a Ca2+-free pipette solution containing the potent InsP3 receptor agonist adenophostin A (2 µM), a protocol that maximally activates these currents in these cells (Mignen et al. 2001). Under these conditions, macroscopic inward CRAC currents at –80 mV were reduced from a mean value of 0.49 ± 0.02 pA pF–1 (n = 6) in control-transfected cells, to 0.07 ± 0.02 pA pF–1 (n = 13) in the siRNA-transfected cells (Fig. 1B) – a reduction of more than 85% (P < 3.0 x 10–8). This is consistent with the previous studies using fluorescent measurements of Ca2+ entry in HEK 293 cells (Roos et al. 2005), and with direct measurements of macroscopic store-operated CRAC currents in S2 cells, Jurkat cells and RBL cells (Roos et al. 2005; Spassova et al. 2006), thereby confirming the suitability of the m3-HEK cell system. To examine the specificity of this effect, a STIM1 construct was generated in which the siRNA-binding region had been mutated to render it resistant to siRNA knock-down. The ability of this construct to rescue STIM1 protein levels in the siRNA-treated cells was confirmed by western blot (Fig. 1A). Correspondingly, expression of this construct in siRNA-transfected cells resulted in the complete rescue of CRAC channel currents to 0.61 ± 0.10 pA pF–1 (n = 8) at –80 mV, a value statistically indistinguishable from the controls (P = 0.145) (Fig. 1B).
|
We next examined whether the STIM1 siRNA-induced inhibition of ARC channels was also seen following agonist stimulation. In previous studies, we have shown that activation of the m3-HEK cells with low concentrations (<1 µM) of the agonist carbachol specifically, and uniquely, activates the ARC channels (Mignen et al. 2001). Correspondingly, transfection of siRNA to STIM1 reduced the inward currents activated by 0.5 µM carbachol by approximately 70%, from a value of 0.23 ± 0.05 pA pF–1 (n = 9) at –80 mV, to 0.07 ± 0.01 pA pF–1 (n = 12 (P < 4.0 x 10–8) (Fig. 2A). Importantly, subsequent addition of 8 µM arachidonic acid to siRNA-treated cells after previous addition of carbachol failed to increase the observed current (mean increase in inward current at –80 mV, 0.03 ± 0.03 pA pF–1, n = 3) (Fig. 2B), confirming that this carbachol-activated current specifically reflects the activity of the ARC channels.
|
In contrast to the effects of reducing STIM1 protein levels by siRNA, previous studies examining overexpression of STIM proteins have produced somewhat contradictory results ranging from little to no effect on store-operated Ca2+ entry in HEK 293 cells, Jurkat cells and S2 cells (Roos et al. 2005; Zhang et al. 2005), to an approximate doubling of the rate of store-operated Mn2+ quench of cytosolic fura-2 (used as a surrogate measurement for Ca2+ entry) in HeLa cells (Liou et al. 2005), and a three- to sixfold increase in CRAC channel currents in RBL cells and Jurkat cells, respectively (Spassova et al. 2006).
Western blot analysis of m3-HEK cells transfected with a STIM1 construct revealed a robust concentration-dependent increase in STIM1 protein expression (Fig. 3A). For subsequent whole-cell current experiments, cells were transfected with 0.5 µg STIM1 DNA. Parallel western blot analysis indicated that this gave a more than fivefold increase (5.5 ± 0.3, n = 3) in STIM1 protein levels. Measurements of the maximally activated store-operated CRAC currents in these STIM1 overexpressing cells indicated a more than twofold increase (Fig. 3B), from a control value of 0.35 ± 0.02 pA pF–1 (n = 19) at –80 mV, to 0.74 ± 0.05 pA pF–1 (n = 23, P < 2.0 x 10–8). These currents displayed marked inward rectification, reversal potentials of greater than +60 mV (Fig. 3B), and were completely inhibited by La3+ (100 µM). The presence of clear fast-inactivation during brief pulses to –80 mV (Fig. 3B) confirmed that these currents reflected the activity of the CRAC channels, as did their sensitivity to 2-APB (100 µM), which produced a 76 ± 1.8% (n = 9) inhibition of inward currents at –80 mV (data not shown).
|
Expression of an EF-hand mutant STIM1 constitutively activates CRAC channel currents, but not ARC channel currents
As noted, a key feature of current models describing the action of STIM1 on store-operated Ca2+ entry and the activity of the CRAC channels is the translocation of STIM1 to sites close to the plasma membrane. Store depletion induces such a translocation, as does the expression of STIM1 proteins bearing mutations in the N-terminal EF-hand designed to interfere with its proposed ability to bind Ca2+ (Liou et al. 2005; Zhang et al. 2005; Wu et al. 2006). Expression of these mutants has been shown to result in the constitutive activation of Ca2+ entry (Liou et al. 2005; Zhang et al. 2005) and CRAC channel currents (Zhang et al. 2005; Spassova et al. 2006) in the absence of store depletion.
Based on our previous demonstration that activation of ARC channels is entirely independent of depletion of intracellular Ca2+ stores (Shuttleworth & Thompson, 1998; Mignen et al. 2003a, 2005), we predicted that expression of similarly mutated STIM1 would be unlikely to induce any constitutive activity of the ARC channels. To examine this, we used a STIM1 construct in which two sites in the EF-hand domain that are known to be critical for the binding of Ca2+ were mutated (D76A, and E87A) (Liou et al. 2005; Zhang et al. 2005). Expression of this mutant STIM1 in m3-HEK cells resulted in the appearance of a constitutively active, inwardly directed, La3+-sensitive current equal to 0.30 ± 0.05 pA pF–1 (n = 18) at –80 mV (Fig. 4A). This constitutive current displayed marked inward rectification, and reversal potentials greater than +60 mV (Fig. 4B), indicating it represented a specific (likely Ca2+-selective) current and not a non-specific leak. Importantly, these currents also showed clear fast-inactivation during brief pulses to negative potentials, the magnitude of which was dependent on the applied voltage (Fig. 4C) – a key feature of the endogenous store-operated CRAC channels. Moreover, addition of 2-APB (100 µM) resulted in a 76 ± 1.7% (n = 9) inhibition of the constitutive current – a value identical to that seen with the CRAC currents in cells overexpressing the wild-type STIM1 (P = 0.443, see above). Consistent with the published studies described above, these biophysical and pharmacological features confirm that the constitutively active currents observed in cells expressing the EF-hand mutation of STIM1 were exclusively comprised of current through the store-operated CRAC channels. Importantly, as we predicted above, these data demonstrate that there is no corresponding constitutive activation of the ARC channels in the cells expressing the EF-hand mutant of STIM1.
|
|
Despite the current emphasis on the importance of STIM1 in the membranes of the ER for the regulation of store-operated Ca2+ entry, STIM1 was originally characterized as a plasma membrane protein (Oritani & Kincade, 1996; Manji et al. 2000; Williams et al. 2002). We therefore sought to examine the presence of STIM1 in the plasma membrane of the m3-HEK cells. To do this, we used a protocol in which surface proteins were labelled by biotinylation of intact cells, followed by probing of the biotinylated fraction in western blots with STIM1-specific antibodies. Similar probing with antibodies directed against the widely expressed ER proteins SERCA2 and calreticulin served as controls. These experiments revealed that a proportion (approximately 10–15%) of the total endogenous cellular STIM1 could be biotinylated in intact m3-HEK cells under control conditions (Fig. 6), a value similar to that previously reported for the K562 myeloid leukaemia cell line (Manji et al. 2000). The validity of this biotinylation protocol was confirmed by the absence of any significant reaction to antibodies against the ubiquitously expressed ER proteins SERCA2, and calreticulin (Fig. 6). Addition of exogenous arachidonic acid (8 µM) to activate the ARC channels in these cells failed to significantly affect the proportion of STIM1 present in the biotinylated fraction, indicating that arachidonic acid does not appear to induce any increase in the incorporation of STIM1 in the plasma membrane (Fig. 6).
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
How, then, can the shared effect of STIM1 on the store-operated CRAC channels and the store-independent ARC channels be explained? A possible clue may lie in the fact that, although overall changes in STIM1 expression levels (by siRNA or overexpression) influence the magnitude of the currents through both the CRAC channels and the ARC channels, such effects were significantly more apparent with the CRAC channels. In contrast, in experiments designed to examine the specific effect of STIM1 residing in the plasma membrane, effects on the currents through the ARC channels were clear and profound, whilst those on the CRAC channel currents were marginal at best. Moreover, this feature was independently demonstrated using two entirely distinct approaches. The first involved exposure of intact cells to an antibody targeted to an N-terminal epitope that, for STIM1 molecules located in the plasma membrane, would be exposed to the extracellular environment. This resulted in a marked inhibition of ARC channel currents, whilst the same antibody had only a small effect on the CRAC channel currents that was not significantly different from that observed with a control antibody. It should be noted that the same N-terminal antibody was reported to induce a much larger (
70%) inhibition of CRAC currents in Jurkat cells (Spassova et al. 2006). However, comparisons are difficult as different incubation conditions and higher antibody concentrations were used (incubation at 4°C and antibody concentrations of 20 µg ml–1), and only the monovalent currents observed through the CRAC channels in the absence of external divalent cations were reported.
The second approach involved expression of a mutant STIM1 designed to prevent its constitutive delivery to the plasma membrane. Unfortunately, attempts to directly confirm that the transfected glycosylation mutant fails to be expressed in the plasma membrane using the biotinylation protocol described above proved to be impossible. In these experiments, the presence of a significant reaction to the SERCA2 antibody in the biotinylated fraction of the transfected cells (data not shown) indicated the presence of a small proportion of damaged cells in this population, making any subsequent interpretation of the data obtained unreliable. Nevertheless, expression of this mutant STIM1 resulted in the profound inhibition of currents through the ARC channels, without affecting those through the CRAC channels. Thus, despite inevitable limitations in the protocols used, these two independent approaches produced essentially identical, selective effects on the currents through the ARC channels, whilst having negligible effects on the CRAC conductance.
Together, these findings lead us to two important conclusions. First, the fact that protocols designed to disrupt the action, or eliminate the presence, of STIM1 in the plasma membrane had little or no effect on the activity of the CRAC channels is consistent with those reports demonstrating that the regulation of these, and other, store-operated conductances depend exclusively on STIM1 acting within the ER membrane (Liou et al. 2005; Wu et al. 2006; Luik et al. 2006; Mercer et al. 2006; Baba et al. 2006), and argue against any requirement for STIM1 to become actually inserted into the plasma membrane (Zhang et al. 2005; Spassova et al. 2006). Secondly, and in marked contrast to the STIM1-dependent regulation of the store-operated conductances, the regulation of ARC channel activity appears to exclusively involve the fraction of STIM1 that is constitutively resident in the plasma membrane. Based on this, the simplest models for this action of STIM1 would seem to be either that the plasma membrane STIM1 itself is the target for agonist-generated arachidonic acid, or that STIM1 influences the ability of arachidonic acid to activate the ARC channels. Examination of these two alternatives will obviously be the subject of future studies.
Importantly, these data demonstrate that the effects of STIM1 on Ca2+ entry are not limited to CRAC channels or, indeed, to any Ca2+ entry pathway activated by store-depletion. It could be that ARC and CRAC channels, despite their obvious differences, are ancestrally related proteins that have retained the common feature of regulation by STIM1. However, if so, then such regulation clearly involves entirely distinct mechanisms for the two channel types. In the case of ARC channels, such regulation does not involve the depletion of intracellular Ca2+ stores or any consequence of such depletion, and is independent of any translocation of STIM1 to the sites near the plasma membrane. Instead, the regulation of the ARC channel involves an action of the pool of STIM1 constitutively residing in the plasma membrane. Whilst these findings serve to emphasize the role of STIM1 as a key regulator of Ca2+ entry pathways in non-excitable cells, they demonstrate that such a role involves multiple distinct mechanisms that are capable of acting on diverse Ca2+ entry channels.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Berridge MJ (1993). Inositol trisphosphate and calcium signalling. Nature 361, 315–325.[CrossRef][Medline]
Bootman MD, Berridge MJ & Roderick HL (2002). Calcium signalling: more messengers, more channels, more complexity. Curr Biol 12, R563–R565.[CrossRef][Medline]
Hermosura MC, Monteilh-Zoller MK, Scharenberg AM, Penner R & Fleig A (2002). Dissociation of the store-operated calcium current ICRAC and the Mg-nucleotide-regulated metal ion current MagNuM. J Physiol 539, 445–458.
Hoth M & Penner R (1992). Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature 355, 353–356.[CrossRef][Medline]
Hoth M & Penner R (1993). Calcium release-activated calcium current in rat mast cells. J Physiol 465, 359–386.
Huang GN, Zeng W, Kim JY, Yuan JP, Han L, Muallem S & Worley PF (2006). STIM1 carboxyl-terminus activates native SOC, Icrac and TRPC1 channels. Nat Cell Biol 8, 1003–1010.[CrossRef][Medline]
Kozak JA, Kerschbaum HH & Cahalan MD (2002). Distinct properties of CRAC and MIC channels in RBL cells. J Gen Physiol 120, 221–235.
Liou J, Kim ML, Heo WD, Jones JT, Myers JW, Ferrell JE Jr & Meyer T (2005). STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr Biol 15, 1235–1241.[CrossRef][Medline]
Luik RM, Wu MM, Buchanan J & Lewis RS (2006). The elementary unit of store-operated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J Cell Biol 174, 815–825.
Manji SS, Parker NJ, Williams RT, Van Stekelenburg L, Pearson RB, Dziadek M & Smith PJ (2000). STIM1: a novel phosphoprotein located at the cell surface. Biochim Biophys Acta 1481, 147–155.[CrossRef][Medline]
Marchant JS (2005). Cellular signalling: STIMulating calcium entry. Curr Biol 15, R493–R495.[CrossRef][Medline]
Mercer JC, Dehaven WI, Smyth JT, Wedel B, Boyles RR, Bird GS & Putney JW Jr (2006). Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1. J Biol Chem 281, 24979–24990.
Mignen O & Shuttleworth TJ (2000). IARC, a novel arachidonate-regulated, noncapacitative Ca2+ entry channel. J Biol Chem 275, 9114–9119.
Mignen O & Shuttleworth TJ (2001). Permeation of monovalent cations through the non-capacitative arachidonate-regulated Ca2+ channels in HEK293 cells. Comparison with endogenous store-operated channels. J Biol Chem 276, 21365–21374.
Mignen O, Thompson JL & Shuttleworth TJ (2001). Reciprocal regulation of capacitative and arachidonate-regulated noncapacitative Ca2+ entry pathways. J Biol Chem 276, 35676–35683.
Mignen O, Thompson JL & Shuttleworth TJ (2003a). Ca2+ selectivity and fatty acid specificity of the noncapacitative, arachidonate-regulated Ca2+ (ARC) channels. J Biol Chem 278, 10174–10181.
Mignen O, Thompson JL & Shuttleworth TJ (2003b). Calcineurin directs the reciprocal regulation of calcium entry pathways in nonexcitable cells. J Biol Chem 278, 40088–40096.
Mignen O, Thompson JL, Yule DI & Shuttleworth TJ (2005). Agonist activation of arachidonate-regulated Ca2+-selective (ARC) channels in murine parotid and pancreatic acinar cells. J Physiol 564, 791–801.
Oritani K & Kincade PW (1996). Identification of stromal cell products that interact with pre-B cells. J Cell Biol 134, 771–782.
Parekh AB & Putney JW Jr (2005). Store-operated calcium channels. Physiol Rev 85, 757–810.
Parker NJ, Begley CG, Smith PJ & Fox RM (1996). Molecular cloning of a novel human gene (D11S4896E) at chromosomal region 11p15.5. Genomics 37, 253–256.[CrossRef][Medline]
Prakriya M & Lewis RS (2002). Separation and characterization of currents through store-operated CRAC channels and Mg2+-inhibited cation (MIC) channels. J Gen Physiol 119, 487–507.
Putney JW Jr (1986). A model for receptor-regulated calcium entry. Cell Calcium 7, 1–12.[Medline]
Putney JW Jr (1990). Capacitative calcium entry revisited. Cell Calcium 11, 611–624.[CrossRef][Medline]
Putney JW Jr (2005). Capacitative calcium entry: sensing the calcium stores. J Cell Biol 169, 381–382.
Roos J, DiGregorio PJ, Yeromin AV, Ohlsen K, Lioudyno M, Zhang S, Safrina O, Kozak JA, Wagner SL, Cahalan MD, Velicelebi G & Stauderman KA (2005). STIM1, an essential and conserved component of store-operated Ca2+ channel function. J Cell Biol 169, 435–445.
Sabbioni S, Barbanti-Brodano G, Croce CM & Negrini M (1997). GOK: a gene at 11p15 involved in rhabdomyosarcoma and rhabdoid tumor development. Cancer Res 57, 4493–4497.
Shuttleworth TJ & Thompson JL (1998). Muscarinic receptor activation of arachidonate-mediated Ca2+ entry in HEK293 cells is independent of phospholipase C. J Biol Chem 273, 32636–32643.
Shuttleworth TJ, Thompson JL & Mignen O (2004). ARC channels: a novel pathway for receptor-activated calcium entry. Physiology (Bethesda) 19, 355–361.[CrossRef][Medline]
Spassova MA, Soboloff J, He LP, Xu W, Dziadek MA & Gill DL (2006). STIM1 has a plasma membrane role in the activation of store-operated Ca2+ channels. Proc Natl Acad Sci U S A 103, 4040–4045.
Williams RT, Senior PV, Van Stekelenburg L, Layton JE, Smith PJ & Dziadek MA (2002). Stromal interaction molecule 1 (STIM1), a transmembrane protein with growth suppressor activity, contains an extracellular SAM domain modified by N-linked glycosylation. Biochim Biophys Acta 1596, 131–137.[CrossRef][Medline]
Wu MM, Buchanan J, Luik RM & Lewis RS (2006). Ca2+ store depletion causes STIM1 to accumulate in ER regions closely associated with the plasma membrane. J Cell Biol 174, 803–813.
Zhang SLYuY, Roos J, Kozak JA, Deerinck TJ, Ellisman MH, Stauderman KA & Cahalan MD (2005). STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane. Nature 437, 902–905.[CrossRef][Medline]
Zweifach A & Lewis RS (1993). Mitogen-regulated Ca2+ current of T lymphocytes is activated by depletion of intracellular Ca2+ stores. Proc Natl Acad Sci U S A 90, 6295–6299.
|
Acknowledgements |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. W. Putney and G. S. Bird Cytoplasmic calcium oscillations and store-operated calcium influx J. Physiol., July 1, 2008; 586(13): 3055 - 3059. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Spassova, T. Hewavitharana, R. A. Fandino, A. Kaya, J. Tanaka, and D. L. Gill Voltage Gating at the Selectivity Filter of the Ca2+ Release-activated Ca2+ Channel Induced by Mutation of the Orai1 Protein J. Biol. Chem., May 30, 2008; 283(22): 14938 - 14945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Csutora, K. Peter, H. Kilic, K. M. Park, V. Zarayskiy, T. Gwozdz, and V. M. Bolotina Novel Role for STIM1 as a Trigger for Calcium Influx Factor Production J. Biol. Chem., May 23, 2008; 283(21): 14524 - 14531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Mignen, J. L. Thompson, and T. J. Shuttleworth Orai1 subunit stoichiometry of the mammalian CRAC channel pore J. Physiol., January 15, 2008; 586(2): 419 - 425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Mignen, J. L. Thompson, and T. J. Shuttleworth Both Orai1 and Orai3 are essential components of the arachidonate-regulated Ca2+-selective (ARC) channels J. Physiol., January 1, 2008; 586(1): 185 - 195. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. S. Prakash, M. A. Thompson, B. Vaa, I. Matabdin, T. E. Peterson, T. He, and C. M. Pabelick Caveolins and intracellular calcium regulation in human airway smooth muscle Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1118 - L1126. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Varnai, B. Toth, D. J. Toth, L. Hunyady, and T. Balla Visualization and Manipulation of Plasma Membrane-Endoplasmic Reticulum Contact Sites Indicates the Presence of Additional Molecular Components within the STIM1-Orai1 Complex J. Biol. Chem., October 5, 2007; 282(40): 29678 - 29690. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||
), and whole cell lysate (
) in intact control cells (C) and in cells exposed to 8 µM arachidonic acid (AA). Lysate samples were diluted 4.5-fold compared with the biotinylated samples. The gel was stripped and reprobed with antibodies to SERCA2, and again to calreticulin, as controls for contamination with the endoplasmic reticulum.
