J Physiol Wellcome Trust-funded researchers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


J Physiol Volume 581, Number 1, 91-97, May 15, 2007 DOI: 10.1113/jphysiol.2007.129726
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
581/1/91    most recent
jphysiol.2007.129726v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minosyan, T. Y.
Right arrow Articles by Stefani, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minosyan, T. Y.
Right arrow Articles by Stefani, E.
Related Collections
Right arrow Cellular

RAPID REPORT

Increased 5-HT contractile response in late pregnant rat myometrium is associated with a higher density of 5-HT2A receptors

Tamara Y. Minosyan1, Rong Lu1, Mansoureh Eghbali1, Ligia Toro1,2,4 and Enrico Stefani1,3,4

1 Department of Anaesthesiology, Division of Molecular Medicine
2 Department of Molecular & Medical Pharmacology
3 Department of Physiology
4 Brain Research Institute, David Geffen School of Medicine at University of California Los Angeles, Los Angeles, CA 90095-1778, USA


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The 5-hydroxytryptamine (5-HT) type 2 receptor family is involved in multiple physiological functions in smooth muscle including proliferation, differentiation and contraction. In myometrium, 5-HT2 receptors not only play a role in contraction but also regulate the activity of hypertrophic genes during pregnancy. Here we investigated whether 5-HT2A receptors were up-regulated during gestation and whether changes in expression could be correlated with changes in 5-HT-induced contractions in late pregnant myometrium. 5-HT tension dose–response curves showed that 5-HT-induced myometrial contractility is drastically increased in late pregnancy when compared to non-pregnant conditions. The 5-HT maximum tension (% of 80 mM KCl contracture) increased from 17 ± 2% in non-pregnant to 54 ± 7% in late pregnant myometrium. This tension increase took place without significant changes in the 5-HT sensitivity as EC50 values were similar in non-pregnant and late pregnant myometrium (0.11 ± 0.03 µM and 0.17 ± 0.02 µM, respectively). The increased 5-HT-induced contraction at the end of pregnancy was associated with up-regulation of 5-HT2A transcript (~5-fold) and protein (~6-fold) levels. These functional and biochemical studies provide evidence that myometrium remodelling during pregnancy is in part associated with up-regulation of 5-HT2A transcript and protein levels resulting in higher 5-HT-induced contractile responses. We conclude that the higher 5-HT-induced contractile response results from a higher density of 5-HT2A receptors having the same properties as in non-pregnant myometrium.

(Received 1 February 2007; accepted after revision 21 March 2007; first published online 29 March 2007)
Corresponding author E. Stefani: David Geffen School of Medicine at UCLA, Department of Anaesthesiology, BH-520A CHS Box 957115, Los Angeles, CA 90095-7115, USA. Email: estefani{at}ucla.edu


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Serotonin (5-HT) is a potent neurotransmitter that can regulate functional activity in virtually every major physiological system, including the central nervous and the cardiovascular system (Watts, 2005). In both vascular and non-vascular smooth muscles 5-HT binds to 5-HT receptors leading to increased contractility. Seven classes of serotonin receptors have been recognized and most of them (except 5-HT3 receptors) are coupled to the production of second messengers via interactions with G-proteins. The 5-HT2 receptor family comprises three members: 5-HT2A, 5-HT2B and 5-HT2C. The pharmacology of 5-HT and their prime targets are very well studied in the vascular system, 5-HT2A receptors being the primary receptors mediating 5-HT-induced contractions (Martin, 1994; Watts et al. 2001).

Early studies have documented the role of serotonin and serotonin receptors in the regulation of uterine contractility and function and have suggested the presence of the 5-HT2 receptors in rat uterus (Ichida et al. 1983; Wrigglesworth, 1983; Cohen et al. 1985, 1986) which were later confirmed by the detection of 5-HT2 receptor mRNA in cultured cells (Rydelek-Fitzgerald et al. 1993). Recent studies have pharmacologically identified 5-HT2A receptors in myometrium (Shum et al. 2002). However, direct biochemical evidence for the presence of 5-HT2A receptors in myometrium remains to be investigated together with potential changes in their expression and functional role in myometrial contractility during gestation.

During pregnancy myometrium undergoes significant changes in its contractile activity due to mechanical and hormonal stimuli, in preparation for the parturition process. Furthermore, the contractile response of rat uterus to 5-HT was increased either during oestrus or by administration of oestrogen (Ichida et al. 1984). As in vascular smooth muscle, 5-HT2A receptors are probably the primary 5-HT target in myometrium (Martin, 1994; Watts et al. 2001). We hypothesized that 5-HT2A receptor activity may play a significant role in determining the contractile state of the myometrium at the end of pregnancy. We examined (i) the effect of pregnancy on 5-HT-induced contractions, and (ii) whether any potential change in 5-HT-induced contractions during gestation correlates with changes in 5-HT2A receptor mRNA and/or protein expression. Functional studies were performed in conjunction with transcript and protein measurement in myometrium of non-pregnant dioestrus (NP) and late pregnant (LP) rats. We found that 5-HT-induced contractions were higher in late pregnancy with the same 5-HT sensitivity and that this higher 5-HT-induced contractility correlated with the up-regulation of 5-HT2A receptor transcript and protein levels. We propose that the 5-HT-induced higher contractility at the end of pregnancy is due, at least in part, to an increased density of 5-HT2A receptors.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals

Female Sprague–Dawley rats, 2–3 months old, non-pregnant at dioestrus stage (NP) and late pregnant (LP) were used. The stage of the NP rats was determined by examination of vaginal smears, and only animals in the dioestrus stage were used. Pregnant rats were at 22–23 days of gestation. All animals were purchased from Charles River Laboratories (St Louis, MO, USA). The method of killing received institutional (office for protection of research subjects (OPRS) of UCCA) review committee approval. Non-pregnant and late pregnant rats were killed with a saturating dose of isoflurane and fetuses were immediately killed by decapitation with sharp scissors.

Isometric contractions

Female Sprague–Dawley NP and LP rats were used in these studies. Animals were anaesthetized by inhalation of isoflurane and the uteri were quickly removed and opened. After removing the endometrium, the myometrium from the fundus was excised, cut into strips in the longitudinal direction (~1.5 mm width and 3 mm length), mounted in modified Krebs solution (mM): NaCl 119, KCl 4.7, CaCl2 1.6, MgSO4 1.2, KH2PO4 1.2, NaHCO3 22, Hepes 8, creatine 5, taurine 20, pyruvate 5 and glucose 5 (pH 7.4); bubbled with 95% O2–5% CO2 at 37°C, and connected to an isometric force transducer (World Precision Instruments). Tension was recorded with WINDAQ/200 (DATAQ Instruments). The myometrial strips were allowed to equilibrate for 30–60 min in Krebs solution prior to starting each experiment. The myometrial strips were contracted with 80 mM KCl for 10 min and then KCl was removed from the bath by 4 washes of Krebs solution in 10 min intervals. Different concentrations of 5-HT (0.01–10 µM) were then applied to the strips, which were washed out of the bath at the end of experiment. Tension was measured as the time integral of the tension normalized by the integration time after subtraction of the basal tension. To obtain 5-HT dose–response curves, the tension prior to 5-HT application was subtracted from each 5-HT-induced tension value. All values were expressed as a percentage of 80 mM KCl contractions. Means of dose–response curves were fitted to a Hill function: %contraction = Emax/(1 + (EC50/[5-HT])N), where Emax is maximum contraction, EC50 is the concentration needed for 50% contraction, [5-HT] is the concentration of 5-HT, and N is the Hill coefficient.

Real-time PCR

Total RNA was isolated from myometrium of NP and LP rats using Trizol (Invitrogen). Total RNA (2 µg) was reverse transcribed to single-stranded cDNA with gene-specific primers using the Omniscript RT kit (Qiagen). The quality of RNA was confirmed by running a RNA gel and looking for ribosomal RNA at the expected sizes. Gene-specific primers were as follows. 5-HT2A (GeneBank no. NM017254): forward primer TCGAAGGTCTTTAAGGAGGGGA, reverse primer CTGTGGATGGACCGTTGGAAG. Ribosomal protein L32 (RPL-32) (GeneBank no. NM013226): forward primer ACAACAGGGTGCGGAGAAGATT, reverse primer GTGACTCTGATGGCCAGCTGT. Real-time PCR (iCycler iQ Real-Time PCR, Bio-Rad) was used for quantification of 5-HT2A and RPL-32 (RPL-32) cDNA using iQ SYBRgreen SuperMix (Bio-Rad). The reaction conditions were as follows: 5 min at 95°C followed by 40 cycles at 95°C for 45 s, 61°C for 45 s and 72°C for 45 s. Single products were detected from the melting curve (first derivative of fluorescence (dF/dT) versus temperature plots) as clear single peaks at their melting temperature. At the end of the reaction, single bands of the expected size were also detected in agarose gel electrophoresis. Measurements were performed in triplicates. Controls included the reaction mixture without cDNA and transcript levels of RPL-32 as an internal control.

Crude membrane preparation and Western blots

After scraping off the endometrium, the myometrium was homogenized in 20 mM Hepes-KOH, 1 mM EDTA, 250 mM sucrose, pH 7.4, supplemented with protease inhibitors (Roche). The homogenate was centrifuged at 1000 g for 10 min. The remaining supernatant was filtered through cheesecloth and was later centrifuged at 45 000 g for 1 h to obtain crude membranes. The supernatants were decanted and the pellets resuspended in 250 mM sucrose, 10 mM Hepes-KOH, pH 7.4. The protein concentration of the samples was measured using the Lowry method. The samples were mixed with equal volumes of SDS loading buffer and dithiothreitol to a final concentration of 62.5 mM Tris-HCl, 2% SDS, 10% glycerol, 0.01% bromophenol blue and 42 mM dithiothreitol and boiled for 5 min. Prestained molecular weight standards were obtained from LI-COR. Myometrial membrane proteins (5, 10, 20 and 40 µg per lane) were separated using 10% SDS-polyacrylamide gel electrophoresis under reducing conditions and electro-transferred to nitrocellulose paper. Blots were blocked with Tris-buffered saline (TBS; 50 mM Tris-HCl, 150 mM NaCl, 0.5% Triton X-100 and 0.1% Tween, pH 7.4) containing 5% non-fat dry milk for 1 h at room temperature. Thereafter, they were incubated with the following primary antibodies: anti-5-HT2A (BD Pharmingen, 2 µg ml–1) and anti-GAPDH serum (Novus Biologicals, 1: 4000) in 1% non-fat milk–TBS for 12 h at 4°C, washed with TBS three times for 10 min each, and then incubated with Alexa Fluor 680 goat anti-rabbit IgG (0.133 µg ml–1) (Molecular Probes), or IRDyeTM 800 goat anti-mouse (0.066 µg ml–1) (Rockland, Inc.) for 1 h at room temperature. After washing, blots were visualized using infrared fluorescence (Odyssey Imaging System, LI-COR). Direct infrared detection makes it possible to detect strong and weak bands on the same blot and to perform dual labelling. Bands corresponding to the immunoreactive protein of interest were quantified with MetaMorph (Universal Imaging Corp.). Results are expressed as average pixel intensity.

Statistics

Student's t test was used. P values < 0.05 were considered statistically significant. Values are mean ± S.E.M.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
5-HT-induced contractions are drastically increased at the end of pregnancy

We compared rat uterine activity of the longitudinal muscles in response to 5-HT in NP and LP rats using isometric contractions. Uterine strips from both NP and LP rats exhibited spontaneous rhythmic contraction (Fig. 1A and B). Strips were initially stimulated with 80 mM KCl and following its washout, they were exposed to different concentrations of 5-HT. Increasing concentrations of 5-HT (0.01–10 µM) enhanced the activity of the uterine muscles in both NP and LP strips in a dose-dependent manner, the 5-HT-induced contraction being much higher in LP (both frequency and amplitude) than in NP rats. The higher 5-HT contractile response in late pregnancy is quantified in the dose–response curve shown in Fig. 1C where the 5-HT maximum tension (% of 80 mM KCl contracture) increased from 17 ± 2% in non-pregnant to 54 ± 7% (P < 0.002, n = 10 and n = 11, respectively) in late pregnant rats. This effect takes place without significant changes in 5-HT sensitivity as EC50 values (0.11 ± 0.03 µM for NP and 0.17 ± 0.02 µM for LP), and the Hill coefficient (1.1 ± 0.07 for NP and 0.95 ± 0.04 for LP) were similar suggesting that the receptor affinity for 5-HT remained unmodified at the end of gestation. These data support the view that the increased 5-HT-induced contractility in myometrium during late pregnancy may result from a higher density of 5-HT receptors having the same properties as in non-pregnant myometrium.


Figure 1
View larger version (44K):
[in this window]
[in a new window]

 
Figure 1.  5-HT-induced contraction in rat myometrium is higher in late pregnant (LP) than in non-pregnant (NP) rats
A and B, representative recordings of uterine tension of longitudinal muscle as a function of time in response to either KCl or to increasing concentrations of 5-HT in NP and LP rat myometrium. KCl and 5-HT were applied at points indicated by the arrowheads and they were washed at points indicated by arrows. C, mean dose–response curve of 5-HT-induced contraction expressed as percentage of contraction as a function of 5-HT concentration in NP ({square}) and LP ({blacksquare}). Individual curves were fitted to the Hill function. Mean fitted values were for NP: EC50 = 0.11 ± 0.03 µM, N = 1.1 ± 0.07, Emax = 17 ± 2% (n = 3 rats; 10 strips), and for LP: EC50 = 0.17 ± 0.02 µM, N = 0.95 ± 0.04, Emax = 54 ± 7% (n = 5 rats, 11 strips). Values are mean ± S.E.M.

 
Myometrium 5-HT2A receptor transcript levels are up-regulated at the end of pregnancy

To assess whether the increased contractile response to 5-HT of the LP myometrium correlates with changes in the number of 5-HT receptors, we compared transcript levels of 5-HT2A receptor in both NP and LP myometrium. 5-HT2A mRNAs were quantified by real-time PCR in NP and LP myometrium. The fluorescence versus cycle number curves for NP and LP rats are shown in (Fig. 2A). The LP curve (open circles) was left-shifted (2 cycles) at the end of pregnancy indicating that 5-HT2A receptor transcripts became more abundant at this gestational stage. RPL-32 used as a house-keeping gene showed transcript levels slightly higher in LP compared with NP (1 cycle) (Fig. 2C). The melting curves (dF/dT versus T) for both RPL-32 and 5-HT2A show a single peak for all samples indicating the presence of a single PCR product. Relative transcript expression was quantified by measuring fluorescence intensities in the linear region of the fluorescence versus cycle number curve and was normalized to NP. 5-HT2A receptor transcript levels were up-regulated at the end of pregnancy (~5-fold) while the RPL-32 transcript levels were slightly increased (~2-fold) (Fig. 2B and D). The experimental procedures minimized systematic errors by independently measuring the samples in triplicate. Therefore, these measurements suggest that the slight increase of RPL-32 transcript levels in late pregnancy is real. Nevertheless, the fact that the increase in transcript levels of 5-HT2A is higher than for RPL-32 further supports the conclusion that 5-HT2A mRNAs increase during late pregnancy. The higher 5-HT2A transcript levels at the end of pregnancy suggests that increased 5-HT contractile activity could be due to up-regulation of 5-HT2A receptors.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
Figure 2.  5-HT2A receptor transcript levels are up-regulated at the end of pregnancy
A, plot of real-time PCR fluorescence intensity versus cycle number for 5-HT2A in NP (bullet) and LP ({circ}). The threshold cycle number was lower in LP rats as compared to NP, demonstrating up-regulation of 5-HT2A transcripts. B, bar graph showing mean relative expression of 5-HT2A receptor transcripts normalized to NP. Mean values were 1 ± 0.21 for NP and 5 ± 0.29 for LP. C, plot of real-time PCR fluorescence intensity versus cycle number for RPL-32 (ribosomal protein) in NP (bullet) and LP ({circ}). Bar graph showing mean relative expression of RPL-32 normalized to NP. Mean values were 1 ± 0.08 for NP and 1.9 ± 0.04 for LP (n = 3).

 
Myometrium 5-HT2A receptor protein expression is up-regulated at the end of pregnancy

To quantify 5-HT2A receptor protein levels in NP and LP, Western blot analysis was performed from dose–response curves performed by loading different amounts of protein from crude membrane fractions (Fig. 3A). 5-HT2A antibody recognizes a band at approximately the expected molecular size of 5-HT2A protein (~55 kDa, Fig. 3A). This signal is specific since the protein–antibody interaction was fully blocked when the antibody was pre-adsorbed with the corresponding antigen (2 µg ml–1 data not shown). 5-HT2A receptor protein levels were significantly higher in LP than NP myometrium; with lower protein loading (5 µg and 10 µg) the 5-HT2A signal was only detected in late pregnancy (Fig. 3A). Similar results were obtained in another three independent preparations of NP and LP crude membranes. The average pixel intensity values (20 and 40 µg loading) were normalized in each experiment to the pixel intensity of NP at 40 µg (Fig. 3B). Data points were fitted to a straight line and relative changes of protein expression were calculated from the NP/LP slope ratio. These measurements showed a significant up-regulation (~6-fold) of 5-HT2A during pregnancy, which is consistent with the increase in transcript levels (Fig. 3E versus Fig. 2B). Similar experiments and analysis were performed for GAPDH for which the protein levels were similar in NP and LP myometrium as is evident from superimposed fitted lines having a quasi identical slope (Fig. 3D and E).


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
Figure 3.  5-HT2A receptor protein levels are up-regulated at the end of pregnancy
A, Western blot of crude membrane fractions (5, 10, 20 and 40 µg) from NP and LP samples labelling 5-HT2A receptor protein. B, pixel intensity versus protein concentration plot for 5-HT2A shows linear relationship both in NP (bullet) and LP ({circ}). Note the higher slope in LP with a LP/NP slope ratio indicating ~6-fold 5-HT2A protein increase. The pixel intensity in each experiment was normalized to the pixel intensity of NP at 40 µg. C, Western blots of crude membrane fractions (5, 10, 20 and 40 µg) from NP and LP labelling GAPDH protein. D, pixel intensity versus protein concentration plot for GAPDH shows linear relationship for both NP (bullet) and LP ({circ}), which have a similar slope. The LP/NP slope ratio was ~1. The pixel intensity in each experiment was normalized to pixel intensity of NP at 40 µg. E, bar graph showing LP/NP slope ratio for GAPDH and 5-HT2A (n = 3).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The uterus undergoes dramatic growth during late pregnancy, primarily due to myometrial hypertrophy under the influence of oestrogen and progesterone. Early studies have shown that rat uterus from LP animals and NP animals have a similar response to serotonin (Robson et al. 1954). In these studies the whole uterus including the endometrium was used and a similar single concentration of serotonin could elicit a motor effect in uterus from LP than in NP animals. These studies may not have detected changes in 5-HT sensitivity and maximal contraction. To investigate potential changes in myometrium serotonin sensitivity during gestation we performed dose–response curves in longitudinal fundus myometrium strips. We found that the contractile response to 5-HT in LP rat uterus was drastically increased compared to NP and this effect took place without changes in 5-HT sensitivity as similar values of EC50 were obtained. These can be interpreted by the induction of a higher density of 5-HT receptors during gestation having similar properties to those of NP animals.

The higher contractile response to serotonin in LP myometrium may be explained by the up-regulation of 5-HT receptors by hormone-related changes. In fact, studies in ovariectomized rats have shown that the number of 5-HT receptors was significantly increased by oestrogen treatment without changes in the apparent affinity of 5-HT to 5-HT receptors (Ichida et al. 1983). Based on the functional and biochemical experiments it could be postulated that the gene activity of 5-HT receptors could be regulated by the hormonal changes during pregnancy, possibly by the steady rise of oestrogen (LaPolt et al. 1986). In fact, the analysis of the promoter region of the rat 5-HT2A receptor showed sequences that might be regulated by oestrogen (Gene no. 29595, Genomic AC_000083) (Du et al. 1994). This is consistent with our findings that 5-HT2A receptor transcript and protein levels were increased in LP rat myometrium as compared to NP. These data support the view that the higher contractile response to 5-HT in late pregnancy is most likely due to an increase in the number of 5-HT2A receptors. However, we cannot rule out that other isoforms of 5-HT2 receptors are also present in rat myometrium and may play a role in contractions.

Although it is known that 5-HT is involved in smooth muscle contractions the exact mechanism of how serotonin triggers contraction in myometrium is still unknown. Recent work in vascular smooth muscle has shown that stimulation of 5-HT receptors with 5-HT-induced contraction was blocked by PP2, a Src tyrosine kinase inhibitor and that c-Src and 5-HT2A receptors can associate in a macromolecular complex. These data strongly suggest that c-Src activation is an early mechanism in the 5-HT2A receptor signalling cascade. As 5-HT-induced contraction in myometrium and vascular smooth muscle is similarly blocked by PP2 (TY Minosyan, R Lu, L Toro & E Stefani, unpublished data) it is conceivable that 5-HT2A receptor downstream signalling cascade is similar in both tissues.

In conclusion, our study combining functional and biochemical measurements provides the first demonstration that the increased response to 5-HT in LP myometrium is associated with increased 5-HT2A transcript and protein levels. The fact that 5-HT dose–response curves showed an increased maximum contraction in LP myometrium without changes in the EC50 further supports the view that the mechanism of enhanced 5-HT contractility is due to an increase in number of 5-HT2A receptors at the end of pregnancy without changes in their properties. The increase in 5-HT2A receptors at the end of pregnancy associated with increased 5-HT-induced contractility could favour parturition. Additional physiological actions of the activation of these receptors by 5-HT in the uterus might also be present.

There is increasing evidence that in myometrium mast cells play a significant role in uterus contractility and tissue remodelling during the menstrual cycle. The uterus possesses numerous mast cells located in close proximity to capillaries and there is evidence that the release of mast cell mediators (histamine and serotonin) triggers myometrium contractility (Rudolph et al. 1992, 1993, 1997; Mori et al. 1997). Consistent with the role of mast cells in the regulation of uterine contractility a gradual increase in the number of mast cells has been demonstrated in animals undergoing pregnancy (Rudolph et al. 1997). Furthermore, it was recently shown that degranulation of uterine mast cells via IgE-dependent pathways results in increased myometrial contractility. This finding establishes a direct role for the immune system in regulating myometrium contraction by inducing the release of contractile substances from mast cells (Garfield et al. 2006), which could include 5-HT.

All of these studies support the view that 5-HT released from uterine mast cells and blood elements (especially platelets) can serve as a source of serotonin which will bind to myometrium 5-HT2A receptors triggering contraction. Thus in late pregnancy the combined increased of the number of mast cells and of 5-HT2A receptors would result in an increased uterine contractility favouring parturition. Furthermore, the activation of 5-HT2A receptors, besides regulating protein expression critically involved in maintaining uterus integrity, could also prevent bleeding during birth by increased clotting and vasoconstriction (Shum et al. 2002; Rogines-Velo et al. 2002; Dale et al. 2002).


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cohen ML, Carpenter R, Schenck K, Wittenauer L & Mason N (1986). Effect of nitrendipine, diltiazem, trifluoperazine and pimozide on serotonin2 (5-HT2) receptor activation in the rat uterus and jugular vein. J Pharmacol Exp Ther 238, 860–867.[Abstract/Free Full Text]

Cohen ML, Schenck KW, Colbert W & Wittenauer L (1985). Role of 5-HT2 receptors in serotonin-induced contractions of nonvascular smooth muscle. J Pharmacol Exp Ther 232, 770–774.[Abstract/Free Full Text]

Dale GL, Friese P, Batar P, Hamilton SF, Reed GL, Jackson KW, Clemetson KJ & Alberio L (2002). Stimulated platelets use serotonin to enhance their retention of procoagulant proteins on the cell surface. Nature 415, 175–179.[CrossRef][Medline]

Du YL, Wilcox BD, Teitler M & Jeffrey JJ (1994). Isolation and characterization of the rat 5-hydroxytryptamine type 2 receptor promoter: constitutive and inducible activity in myometrial smooth muscle cells. Mol Pharmacol 45, 1125–1131.[Abstract]

Garfield RE, Irani AM, Schwartz LB, Bytautiene E & Romero R (2006). Structural and functional comparison of mast cells in the pregnant versus nonpregnant human uterus. Am J Obstet Gynecol 194, 261–267.[CrossRef][Medline]

Ichida S, Hayashi T & Terao M (1983). Selective inhibition by ketanserin and spiroperidol of 5-HT-induced myometrial contraction. Eur J Pharmacol 96, 155–158.[CrossRef][Medline]

Ichida S, Oda Y, Tokunaga H, Hayashi T, Murakami T & Kita T (1984). Mechanisms of specific change by estradiol in sensitivity of rat uterus to serotonin. J Pharmacol Exp Ther 229, 244–249.[Abstract/Free Full Text]

LaPolt PS, Matt DW, Judd HL & Lu JK (1986). The relation of ovarian steroid levels in young female rats to subsequent estrous cyclicity and reproductive function during aging. Biol Reprod 35, 1131–1139.[Abstract]

Martin GR (1994). Vascular receptors for 5-hydroxytryptamine: distribution, function and classification. Pharmacol Ther 62, 283–324.[CrossRef][Medline]

Mori A, Zhai YL, Toki T, Nikaido T & Fujii S (1997). Distribution and heterogeneity of mast cells in the human uterus. Hum Reprod 12, 368–372.[Abstract/Free Full Text]

Robson JM, Trounce JR & Didicock KA (1954). Factors affecting the response of the uterus to serotonin. J Endocrinol 10, 129–132.[Medline]

Rogines-Velo MP, Pelorosso FG, Zold CL, Nowak W, Pesce GO, Sardi SP, Brodsky PT & Rothlin RP (2002). Characterization of 5-HT receptor subtypes mediating contraction in human umbilical vein. 1. Evidence of involvement of 5-HT2A receptors using functional and radioligand binding assays. Naunyn Schmiedebergs Arch Pharmacol 366, 587–595.[CrossRef][Medline]

Rudolph MI, Bardisa L, Cruz MA & Reinicke K (1992). Mast cells mediators evoke contractility and potentiate each other in mouse uterine horns. Gen Pharmacol 23, 833–836.[Medline]

Rudolph MI, de los Angeles GM, Sepulveda M, Brandan E, Reinicke K, Nicovani S & Villan L (1997). Ethodin: pharmacological evidence of the interaction between smooth muscle and mast cells in the myometrium. J Pharmacol Exp Ther 282, 256–261.[Abstract/Free Full Text]

Rudolph MI, Reinicke K, Cruz MA, Gallardo V, Gonzalez C & Bardisa L (1993). Distribution of mast cells and the effect of their mediators on contractility in human myometrium. Br J Obstet Gynaecol 100, 1125–1130.[Medline]

Rydelek-Fitzgerald L, Wilcox BD, Teitler M & Jeffrey JJ (1993). Serotonin-dependent collagenase induction in rat myometrial smooth muscle cells: mediation by the 5-HT2 receptor. Mol Cell Endocrinol 91, 67–74.[CrossRef][Medline]

Shum JK, Melendez JA & Jeffrey JJ (2002). Serotonin-induced MMP-13 production is mediated via phospholipase C, protein kinase C, and ERK1/2 in rat uterine smooth muscle cells. J Biol Chem 277, 42830–42840.[Abstract/Free Full Text]

Watts SW (2005). 5-HT in systemic hypertension: foe, friend or fantasy? Clin Sci (Lond) 108, 399–412.[Medline]

Watts SW, Yang P, Banes AK & Baez M (2001). Activation of Erk mitogen-activated protein kinase proteins by vascular serotonin receptors. J Cardiovasc Pharmacol 38, 539–551.[CrossRef][Medline]

Wrigglesworth SJ (1983). Heterogeneity of 5-hydroxytryptamine receptors in the rat uterus and stomach strip. Br J Pharmacol 80, 691–697.[Medline]


    Acknowledgements
 
This work was supported by NIH grants HD046510 (E.S.) and HL077705 (L.T.) and the American Heart Association (AHA) (M.E.).




This article has been cited by other articles:


Home page
Reproductive SciencesHome page
Y. Cordeaux, H. Missfelder-Lobos, D. S. Charnock-Jones, and G. C. S. Smith
Stimulation of Contractions in Human Myometrium by Serotonin is Unmasked by Smooth Muscle Relaxants
Reproductive Sciences, September 1, 2008; 15(7): 727 - 734.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
581/1/91    most recent
jphysiol.2007.129726v1
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Minosyan, T. Y.
Right arrow Articles by Stefani, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Minosyan, T. Y.
Right arrow Articles by Stefani, E.
Related Collections
Right arrow Cellular


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS