| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MOLECULAR AND GENOMIC |
1 Laboratory of Cellular and Molecular Physiology, Department of Structural and Functional Biology, University of Insubria, Via Dunant 3, 21100 Varese, Italy
2 Institute of General Physiology and Biological Chemistry ‘G. Esposito’, University of Milano, Via Trentacoste 2, 20134 Milano, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
(Received 16 March 2007;
accepted after revision 29 March 2007;
first published online 5 April 2007)
Corresponding author A. Peres: Laboratory of Cellular and Molecular Physiology, Dept. of Structural and Functional Biology, University of Insubria, Via Dunant 3, 21100 Varese, Italy. Email: antonio.peres{at}uninsubria.it
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
At variance with the strict Na+ dependence of known vertebrate transporters, KAAT1 and CAATCH1 are able to exploit in addition a K+ electrochemical gradient to power up the uptake of neutral amino acids from the intestinal lumen (Hanozet et al. 1992; Castagna et al. 1997). This peculiar characteristic is believed to be related to the high-potassium, low-sodium condition of the larva intestine (Harvey et al. 1975; Hennigan et al. 1993) caused by its dietary habits. In both ionic conditions the amino acid uptake is electrogenic, giving rise to a transmembrane transport-associated current. The two other types of current observed in the majority of ion-coupled cotransporters, that is the presteady-state (transient) currents, and the uncoupled (leak current), are also present in KAAT1 and CAATCH1 (Bossi et al. 1999; Feldman et al. 2000; Quick & Stevens, 2001). Moreover, CAATCH1 exhibits a peculiar behaviour of an amino acid-gated cation channel (Quick & Stevens, 2001).
Again in contrast with the high substrate specificity of the vertebrate neurotransmitter transporters, KAAT1 and CAATCH1 are capable of transporting a rather wide spectrum of neutral amino acids (Castagna et al. 1998; Feldman et al. 2000). Quite interestingly, the potency order, in terms of amplitude of transport-associated currents, is different in the two transporters, and furthermore it depends on the driver cation (Feldman et al. 2000; Soragna et al. 2004).
These clear differences in ionic requirements and amino acid selectivity, together with the limited number of divergent residues, are obviously quite useful when trying to identify the structural determinants of the ionic dependence and amino acid interactions. Indeed these have been already exploited in our laboratory to build chimeras that led to restriction of the regions of interaction with the organic substrates to the central part (transmembrane segments 4–8) of the protein sequence (Soragna et al. 2004).
A great impetus to the understanding of the structure–function relation in the Na+/Cl–-dependent transporter family has been given by the resolution of the atomic structure of a bacterial member of the family, the Aquifex aeolicus leucine transporter LeuT (Yamashita et al. 2005). Among the many suggestions deriving from this structure, the leucine-binding site of this transporter was pinpointed with great accuracy, showing that the amino acid to be transported forms specific interactions with several main-chain and side-chain atoms that may be traced in the sequence of other members of the family, opening the possibility to investigate structure–specificity relationships (Beuming et al. 2006).
The precise definition of the leucine-binding site in LeuT, together with the different ability to transport leucine of KAAT1 and CAATCH1, prompted us to investigate the structural determinants involved in substrate interaction in these transporters.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The mutant cDNAs KAAT1_S308T, KAAT1_A313P and CAATCH1_T308S were constructed by site-directed mutagenesis (Quickchange Site-Directed Mutagenesis Kit, Stratagene Inc.), as explained in detail elsewhere (Forlani et al. 2001) in the presence of 250 nM overlapping primers containing in their sequence the mutated codons:
KAAT1_S308T: ACTCAAGTGTTCTTCTCTCTGACAGTGTGCACTGGAGCT
CAATCH1_T308S: CAAGTGTTCTTCTCTCTGTCAGTGTGCACCGGACCG
KAAT1_A313P: CTGTCAGTGTGCACTGGACCTATTATCATGTTCTCC
cRNA preparation and Xenopus laevis oocyte expression
The experimental procedure has been described in detail elsewhere (Bossi et al. 2007). Briefly, the cDNAs encoding the original and mutant cotransporters constructs were linearized with NotI. cRNAs were in vitro synthesized in the presence of Cap Analogue and 200 units of T7 RNA polymerase. All enzymes were supplied by Promega Italia, Milan, Italy.
Xenopus laevis frogs were anaesthetized in MS222 (tricaine methansulphonate) 0.10% (w/v) solution in tap water; portions of ovary were removed through an incision on the abdomen. The frogs were humanely killed after the collection.
The oocytes were treated with collagenase (Sigma Type IA) 1 mg ml–1 in ND96 Ca2+-free, for at least 1 h at 18°C. Healthy-looking V- and VI-stage oocytes were selected and injected with 12.5 ng of the appropriate cRNA in 50 nl of water, using a manual microinjection system (Drummond). Oocytes were injected with 12.5 µg of each cRNAs. The oocytes were incubated at 18°C for 3–4 days in NDE solution (ND 96 solution: 96 mM NaCl, 2 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 5 mM Hepes supplemented with 50 µg ml–1 gentamicin and 2.5 mM Na+ pyruvate at pH 7.6), before electrophysiological studies.
Electrophysiology and data analysis
A two-microelectrode voltage-clamp was used to perform electrophysiological experiments (Geneclamp 500B, Axon Instruments, Union City, CA, USA). The holding potential was kept at –60 mV, and the typical protocol consisted of 200 ms voltage pulses spanning the range from –160 to +20 mV in 20 mV steps. Four pulses were averaged at each potential; signals were filtered at 1 kHz and sampled at 2 KHz. Experimental protocols, data acquisition and analysis were done using the pCLAMP 8 software (Axon Instruments).
Uptake experiments
For uptake measurements, groups of 10–14 oocytes were incubated for 60 min in 120 µl of the uptake solution (mM: 100 NaCl, 2 KCl, 1 CaCl2, 1 MgCl2, 20 Hepes/Tris, pH 8) with 1100 kBq ml–1 of [3H]leucine, [3H]proline or [3H]threonine (GE Healthcare Europe, GmbH), rinsed in ice-cold wash solution (mM: 100 choline chloride, 2 KCl, 1 CaCl2, 1 MgCl2, 10 Hepes/Tris, pH 8), and dissolved in 250 µl of 10% SDS for liquid scintillation counting. In competition experiments, 0.5 mM cold leucine was added to the uptake solution. The uptake rates were always corrected for the background uptake measured in non-injected oocytes.
Solutions
In electrophysiological experiments the external control solution had the following composition (mM): NaCl, 98, MgCl2, 1, CaCl2, 1.8, Hepes free acid, 5; in the other solutions NaCl was replaced by KCl or TMACl. The pH was adjusted to 7·6 by adding the corresponding hydroxide for each alkali ion and TMAOH for TMA+ solution. Amino acids (leucine, threonine, proline) at the desired concentrations (up to 3 mM in the dose–response experiments) were added to the same solutions to induce transport-associated currents. The oocyte was perfused continuously in a rapid solution exchange chamber (Warner Instruments model RC-1Z, http://www.warneronline.com/), and the washout time was estimated to be about 1 s.
Mathematical modelling
From the kinetic scheme of Fig. 9 the following system of differential equations may be written:
|
| (1) |
|
|
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Among leucine, threonine and proline applied at the same 500 µM concentration, leucine is the amino acid eliciting the largest currents in KAAT1 when K+ is the driver ion, while in presence of Na+, threonine and proline are transported more efficiently than leucine (Soragna et al. 2004; Feldman et al. 2000).
Conversely, in the strictly related transporter CAATCH1, leucine has the peculiar effect of blocking the constitutive leak (uncoupled) current in presence of either Na+ or K+ (Feldman et al. 2000; Soragna et al. 2004). This blocking effect is also exerted in CAATCH1 by other amino acids such as alanine, histidine and methionine, and the latter was reported to be able to inhibit the transport current induced by proline as well (Feldman et al. 2000; Soragna et al. 2004). These observations encouraged us to devise a series of competition experiments to investigate more deeply the interactions of the different amino acids with KAAT1 and CAATCH1. Figure 1A shows the result of applying, in presence of Na+, 500 µM leucine alone or in addition to 500 µM proline or threonine, to a CAATCH1-expressing oocyte kept at the holding potential of –60 mV. Besides the known leak-blocking effect visible in Fig. 1Aa, Fig. 1Ab clearly shows that leucine completely blocks the proline-induced currents, as well as those generated by threonine. It is also interesting to note that the recovery of the currents after the leucine exposure is very slow, compared to the onset of the currents, suggesting a slow dissociation rate of leucine from the transporter.
|
Figure 2 illustrates parallel experiments performed on KAAT1, showing similar results. Addition of leucine in Na+ solution has an inhibitory action on the larger threonine and proline currents, reducing the amplitude at the level corresponding to the application of 500 µM leucine alone. On the other hand, the competition between proline and threonine, appears to be dominated by threonine, since addition of the latter to proline brings the current to the level of threonine alone, while addition of proline to threonine, does not result in any current increase (Fig. 2B).
|
The electrophysiological results are again confirmed by radioactive tracer measurements, as illustrated in Fig. 2D: the uptake of threonine or proline alone is comparable to that of leucine alone in Na+ solution, while the uptake of both amino acids is strongly reduced when non-radioactive leucine is present at the same time.
While a 500 µM concentration is saturating for leucine in sodium solution (Mari et al. 2004; Vincenti et al. 2000), the apparent affinity for the other two amino acids, and for leucine in potassium, needs to be determined. The full dose–response curves for the three substrates shown in Fig. 3 indicate that indeed higher concentrations of proline and threonine are required to reach the maximal transport capacity. The K0.5 values for the three amino acids at Vm = –60 mV are 12 ± 2, 82 ± 16 and 464 ± 39 µM, for leucine, threonine and proline, respectively, in Na+ solution, while in K+ solution at –80 mV K0.5,leu is 289 ± 25 µM and K0.5,thr is in the lower millimolar range. At the same time the maximal proline- and threonine-induced currents largely exceed that elicited by leucine in Na+ (Fig. 3A), while in potassium, saturating leucine and threonine give rise to comparable currents (Fig. 3B), in agreement with previous results (Feldman et al. 2000; Soragna et al. 2004).
|
Identification of putative selectivity determinants
In addition to the functional studies, and taking advantage of the high-resolution atomic structure of LeuT recently published (Yamashita et al. 2005), it is now possible to tackle the question of substrate selectivity also on structural grounds. The initial indication that in KAAT1 and CAATCH1, substrates interact with the central part of the sequence (Soragna et al. 2004) finds support in the results from LeuT, where the leucine-binding site appears to be formed with the contribution of transmembrane segments 1, 3, 6 and 8 (Yamashita et al. 2005).
We have therefore focused our attention on the differences in residues between KAAT1 and CAATCH1 in TM segments 1, 3, 6 and 8, considering also the corresponding amino acids in other leucine-transporting and non-transporting members of the family. The sequence alignment of LeuT with KAAT1 and CAATCH1 and some selected neurotransmitter transporters of the SCL6A family, not capable of transporting leucine, is shown in Fig. 4, where the alignments recently proposed (Beuming et al. 2006) have been used, and another non-neuronal leucine transporter, SCL6A19 (B0AT1), is also included (Böhmer et al. 2005).
|
This analysis suggests that the capacity to transport leucine may be related to the presence of a serine residue in position 6.56 in the sixth transmembrane segment. We have therefore proceeded to make point mutants replacing S308 with threonine in KAAT1, and T308 with serine in CAATCH1, trying to alter the leucine selectivity of the two transporters in opposite ways. Furthermore, mutation A313P in KAAT1 was used as control.
Leucine selectivity in KAAT1 mutants
The behaviour of KAAT1_S308T in the presence of Na+ is illustrated in Fig. 5. The mutant is still able to transport proline and threonine, while the leucine transport is strongly impaired. This is shown in Fig. 5A and B, where it can be seen that, while in the wild-type the leucine-induced current is on average 25% of that induced by proline, in the mutant it is never significantly different from zero. This result is confirmed by the uptake measurements (Fig. 5E), showing a significant depression of the leucine uptake in KAAT1_S308T. Mutation of alanine 313 in the corresponding CAATCH1 residue proline, appears instead to increase the leucine-induced currents to about 35% of the one elicited by threonine (Fig. 5C).
|
We also produced the reverse mutant CAATCH1_T308S in an attempt to confer to this transporter the capacity to generate transport currents in the presence of leucine. However in Na+ this was not the case, as the behaviour of the mutant was indistinguishable from that of the wild-type form (not shown).
The currents induced by the different amino acids in the presence of potassium in KAAT1 wild-type and S308T mutant are shown in Fig. 6A and B. It can be observed that, although some current may still be generated by the presence of leucine, its amplitude is strongly reduced relative to those induced by threonine.
|
The K0.5 for leucine and threonine in K+, are plotted in Fig. 6C for both wild-type and S308T. Similarly to the results in Na+, the apparent affinity of the mutant for threonine is lower, while that for leucine is higher at negative potentials. In the presence of K+, the reverse T308S mutation in CAATCH1 has some effects on the amplitudes of the proline-induced current relative to threonine, as shown in Fig. 6D and E, and, particularly interesting, on the direction of the leucine-induced current, that becomes inward at negative potentials.
This series of experiments confirms then that the serine residue in position 308 of KAAT1 is involved in leucine interaction, although its insertion in CAATCH1 is not sufficient to restore leucine transport in Na+ solution.
Presteady-state currents
Voltage-dependent presteady-state currents, signalling rearrangements of charges in the membrane field, have been observed in both KAAT1- and CAATCH1-expressing oocytes (Bossi et al. 1999; Quick & Stevens, 2001). This process may be useful in understanding the basis of substrate specificity, as the amplitude of the transport currents often correlates with the maximal displaceable charge. Presteady-state currents in KAAT1 are best studied in the presence of Na+, since in the presence of K+ they are strongly shifted toward negative potentials (Bossi et al. 1999). Figure 7A shows current traces in a representative KAAT1-expressing oocyte in control Na+ solution, and after addition of 500 µM leucine. It can be seen that the slow relaxations present in the control traces (arrows) are abolished by the addition of leucine.
|
) is shown in Fig. 7E. Similarly to KAAT1, the presteady-state currents of CAATCH1 are abolished by addition of leucine (Fig. 7B), although no transport-associated current is produced, but on the contrary the steady currents are reduced (Fig. 7Bb).
Analysis of the currents elicited by voltage jumps in KAAT1_S308T reveals that this mutant behaves like CAATCH1 in this respect: the Na+-dependent presteady-state currents are preserved (Fig. 7Ca) and resemble those of the wild-type, although no transport-associated currents are generated by addition of leucine (Fig. 7Cb). As shown in Fig. 7D and E, the voltage dependence and absolute values of Q and , are also comparable to those of the wild-type.
This behaviour confirms then that substitution of serine 308 with threonine has the effect of stabilizing the binding of leucine to KAAT1, mimicking all the effects of this amino acid on CAATCH1.
The abolishment of the presteady-state currents upon addition of 500 µM leucine in KAAT1_S308T demonstrates that the mutant transporter is still able to interact with leucine. The inhibition of the presteady-state currents by leucine is dose dependent, as it is shown in Fig. 8, with an IC50 value in the low micromolar range.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Substrate competition
The effects of leucine in CAATCH1 indicate that this amino acid acts as a blocker of all the three kinds of current that may be observed in this transporter: the leak or uncoupled current, the voltage-dependent transient current, and the transport-associated current. These results suggest that in CAATCH1 leucine binds strongly to the transporter, locking it in an inactive state, unable to proceed in the transport cycle, preventing the binding of other substrates, inhibiting the intramembrane charge movement and blocking the leak pathway.
The substrate competition experiments in KAAT1 reported above indicate that leucine has a dominant role in this transporter as well. The fact that the amplitude of the transport current converges to that characteristic of leucine, even when other amino acids capable of larger currents are present at the same time, suggests, in analogy to CAATCH1, a stronger binding of this amino acid. However, in contrast to CAATCH1, KAAT1 is able to complete the transport cycle in the presence of leucine, though with less efficiency compared to other amino acids.
Kinetic scheme
To interpret the results presented in this paper, we devised the kinetic scheme shown in Fig. 9, designed to include the minimal necessary number of states. State T1 represents the empty, outward-facing conformation of the transporter, with which cations (Na+ or K+), and possibly chloride, may interact to move to state T2, ready to bind the organic substrate. In order to simulate our competition experiments we have represented in the scheme two possibilities: binding of leucine leads to state T3, while binding of another amino acid (aa) leads to state T4. From either of these two states the transporter may reach state T5, a unified inward-facing state that releases substrates in the cytosol and may rearrange to return to state T1. The uncoupled leak current is represented in the scheme by the T2
T5 transition, while the presteady-state currents are generated by the voltage-dependent T1
T2 transition. In other models (Parent et al. 1992; Forster et al. 1998; Sala-Rabanal et al. 2006) rearrangement of the empty transporter (T5
T1 transition) is also considered to contribute to the intramembrane charge movement; however, this step does not seem to be important in KAAT1, since in this transporter the presteady-state currents are abolished in the absence of Na+ and K+ (Bossi et al. 1999). In any case, this difference is not relevant in the present context, because these transitions are not involved in the interaction with the organic substrate. In the scheme of Fig. 9, the transitions of interest for the interpretation of the present results are those involved in substrate binding (T2
T3 and T2
T4), and the conformational changes of the fully loaded transporter leading to the release of substrates into the cytoplasm (T3
T5 and T4
T5).
The grey areas in Fig. 9 underline the voltage-dependent steps. In addition to the charge-moving transition T1
T2, which generates the presteady-state currents in the absence of substrate, the T3
T5 and T4
T5 transitions are also considered voltage dependent, since states T3 and T4 are electrically charged and, according to previous determinations (Bossi et al. 1999), the T1
T2 transition does not occur over the entire electrical field of the membrane.
The system of differential equations (see Methods) arising from the scheme has been solved numerically, using the kinetic parameters of Table 1. The rates k12 and k21, were derived from the data in Fig. 7 and from (Bossi et al. 1999), and are given by the following expressions:
|
| (2) |
and 
are the fractions of electrical field sensed by the transition, F is the Faraday constant, R the gas constant and T the absolute temperature. The leucine dissociation rate k32 was derived from the rate of recovery of the currents after leucine exposure (see Fig. 2). The outward-facing conformation of the empty transporter was assumed to be favoured, so that k51 and k15 were arbitrarily set at 2000 s–1 and 20 s–1, respectively. The inward leak rate k25 was estimated from the currents in the absence of organic substrates, while k52 was calculated to ensure microreversibility (Läuger, 1991); The remaining rates were adjusted by trial and error until a satisfactory simulation of the experimental results was obtained, taking into account the current amplitudes and the apparent affinities derived from the experiments. Rates k53 and k54 were calculated to satisfy microreversibility, respectively, in the presence of leucine alone, and in the presence of leucine plus a second substrate.
The expressions for the two rates leading from states T3 and T4 to state T5 were:
|
| (3) |
is the fraction of the electrical field sensed by these transitions, taken as 1 – (
+
).
The total transmembrane current at each potential was given by
|
| (4) |
+
) x (k21
x (T2) –
k12
x (T1)) were satisfactorily fitted with single exponentials to determine the relaxation time constants, while the normalized steady-state charge distribution was given by the occupancy probability of state T2. Simulation results
The voltage dependence of the simulated transport currents induced by leucine and a second amino acid present separately or in combination (each at 500 µM concentration) is shown in Fig. 10A for the Na+ condition, and in Fig. 10B for the K+ condition (continuous lines). To facilitate comparison with the experimental data (symbols), the I–V relationships are the result of the subtraction of the leak current from the transport current in each situation. It is worthwhile to note in this respect, that the simulations show that the transport current is not simply additive to the leak current, but the presence of transport current through the pathways T2
T3
T5 and T2
T4
T5 has the effect of lowering the current through the pathway T2
T5, suggesting that the commonly used procedure of defining the transport current as the current in the presence of substrate minus the current in its absence may not be entirely correct.
|
To simulate the behaviour in the presence of K+, a different set of parameters must be used (Table 1). To account for the negative shift in the voltage dependence of the presteady-state and transport currents (Bossi et al. 1999), the rates k12, k21, k25, k35 and k45 were moved by 100 mV toward more negative potentials. Since in K+ leucine becomes the most efficient substrate, the k35 rate has been substantially increased, while k32 has been kept constant. Figure 10B shows that the simulated curves are able to satisfactorily reproduce the results of the competition experiments also in K+ solution, although the effect of leucine on the current amplitude is opposite.
Figure 10C shows in addition the values of K0.5 for leucine obtained from the simulations both in Na+ and in K+ conditions. Clearly the agreement with the experimentally derived values is very good, confirming that the set of parameters used for the simulations is satisfactory.
The effects of the mutation S308T on the leucine-induced currents may be also reproduced by the model, both in Na+ and in K+, by simply reducing the values of the rate k35. This is shown in Fig. 10D where the I–V curves obtained using a 100-fold reduced k350 (from 4 s–1 to 0.04 s–1 in Na+, and from 3000 s–1 to 30 s–1 in K+, and keeping all the other parameters constant) are compared to the simulations of the threonine-induced currents. According to the experimental observations, while the current in potassium becomes significantly smaller, in sodium the leucine-induced current is negligible.
As expected from the fact that the rate constants for the T2
T2 transition are derived from experimental data (Bossi et al. 1999), the model satisfactorily simulates the characteristics of the presteady-state currents in the wild-type, in terms of voltage dependence of both the charge movement and of the relaxation time constant (Fig. 10E and F). Furthermore, addition of saturating amounts of substrates abolishes the presteady-state currents both in the wild-type and in the S308T simulation (i.e. using k350
= 4 s–1 or 0.04 s–1).
The role of S308
From the structural point of view, we have seen that serine 6.56, a residue contributing to the binding of leucine in LeuTAa (Yamashita et al. 2005), is present in KAAT1 and other leucine cotransporters, while it is absent in CAATCH1 and in other eukaryotic members of the family unable to transport this amino acid. As shown in Figs 5 and 6, replacement of serine 308 with a threonine present in CAATCH1, abolishes the transport-associated current in the presence of Na+, and strongly reduces it in the presence of K+. The analysis of the presteady-state currents in this mutant (Figs 7 and 8) clearly indicates that the transporter is still able to interact with leucine, since in presence of the amino acid these currents are abolished with an IC50
= 4.2 µM, a value lower than the apparent affinity derived from the transport activity of the wild-type (K0.5
20–50 µM, Fig. 5D). The loss of function of S308T appears then to be due to the inability to complete the transport cycle rather than to impaired interaction with leucine. Thus, KAAT1_S308T exhibits the same characteristics as CAATCH1 concerning the role of this amino acid.
Although the lack of a detailed knowledge of the atomic structure of KAAT1 and CAATCH1 does not allow one to exclude indirect allosteric effects of serine 308, our results confirm that this residue has a major role in the pore structure, as described in LeuT (Yamashita et al. 2005), where the equivalent serine 256, together with glycine 260, appears to adopt an extended, non-helical, conformation that may affect hydrogen bonding and ion coordination, possibly favouring the transition to the inward-facing conformation.
Leucine specificity
From the above considerations the amino acid specificity in KAAT1 appears to be determined by a combination of affinity proper, that is the ratio of dissociation to association rates of the substrate to the transporter, and the role of the rates at which the subsequent steps in the transport cycle occur. These two factors act somehow in contrast to each other to determine the overall transport efficiency, since high affinity implies a lower free-energy level of the bound state, from which it is more difficult to proceed in the transport cycle (that then will occur less freequently). Indeed, in Na+ conditions, the dominance of leucine is consistent with low exit rates from state T3 towards both T2 and T5, since its infrequent replacement by other amino acids is accompanied by a low transport rate. However in K+ conditions, the leucine dominance goes along with a high turnover rate, at least at the physiological negative potentials. This may be accounted for in the scheme of Fig. 9 by a low dissociation rate T3
T2, together with a high rate of the T3
T5 conformational change.
Physiological and biophysical implications
The electrophysiological data show that at the physiologically relevant membrane potential (very negative) and ionic conditions (high K+) of the Manduca sexta intestine, leucine is at the same time the preferred and the most efficiently transported amino acid. This occurs at the expense of other potentially transportable amino acids. While understanding the physiological relevance of this observation requires better knowledge of the dietary requirements of the animal in terms of relative quantities of the various amino acids, and of the amino acidic composition of its diet, some speculations may be of interest regarding the biophysical basis of this selectivity mechanism.
In fact the considerations developed here for the competition of different amino acids in these cotransporters may find a remarkable analogy in the behaviour of some ionic channels in which an apparently anomalous competition among ions occurs. As an example, most Ca2+-selective channels are found to be permeated much better by Na+ when Ca2+ is absent, while at physiological Ca2+ no Na+ can flow even if the Ca2+ concentration is much lower than that of Na+ (Almers & McCleskey, 1984). This phenomenon has been explained by the existence of high-affinity binding sites for Ca2+ in the channel pore that may then select Ca2+ over Na+, but at the price of a much smaller current flux (Hess & Tsien, 1984).
In KAAT1 in high Na+, leucine appears to perform the role played by Ca2+ in the channels, while threonine and proline perform the role played by Na+, that is leucine is preferred but at the price of a slower transport rate. However the analogy fails in the presence of K+, since in this case the preference for leucine goes together with a high transport rate; clearly this diversity reveals the difference between the Ca2+ ionic channel in which the model of permeation is based on electrostatic repulsive forces between two adjacent Ca2+ ions (Hess & Tsien, 1984), and the conformational change required for the transporter operation.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Beuming T, Shi L, Javitch JA & Weinstein H (2006). A comprehensive structure-based alignment of prokaryotic and eukaryotic neurotransmitter/Na+ symporters (NSS) aids in the useof the LeuT structure to probe NSS structure and function. Mol Pharmacol 70, 1630–1642.
Böhmer C, Bröer A, Munzinger M, Kowalczuk S, Rasko JEJ, Lang F & Bröer S (2005). Characterization of mouse amino acid transporter B0AT1 (slc6a19). Biochem J 389, 745–751.[CrossRef][Medline]
Bossi E, Centinaio E, Castagna M, Giovannardi S, Vincenti S, Sacchi VF & Peres A (1999). Ion binding and permeation through the lepidopteran amino acid transporter KAAT1 expressed in Xenopus oocytes. J Physiol 515, 729–742.
Bossi E, Fabbrini MS & Ceriotti A (2007). Exogenous protein expression in Xenopus laevis oocyte: Basic procedure. In In Vitro Transcription and Translation Protocols, ed. Grandi G, pp. 107–131. Humana Press, Totowa, NJ, USA.
Boudko DY, Kohn AB, Meleshkevitch EA, Dasher MK, Seron TJ, Stevens BR & Harvey WR (2005). Ancestry and progeny of nutrient amino acid transporters. Proc Natl Acad Sci U S A 102, 1360–1365.
Castagna M, Shayakul C, Trotti D, Sacchi VF, Harvey WR & Hediger MA (1997). Molecular characteristics of mammalian and insect amino acid transporters: implications for amino acid homeostasis. J Exp Biol 200, 269–286.[Abstract]
Castagna M, Shayakul C, Trotti D, Sacchi VF, Harvey WR & Hediger MA (1998). Cloning and characterization of a potassium-coupled amino acid transporter. Proc Natl Acad Sci U S A 95, 5395–5400.
Dow JAT & Peacock JM (1989). Microelectrode evidence for the electrical isolation of goblet cell cavities in Manduca sexta middle midgut. J Exp Biol 143, 101–114.
Feldman DH, Harvey WR & Stevens BR (2000). A novel electrogenic amino acid transporter is activated by K+ or Na+, is alkaline pH-dependent, and is Cl– independent. J Biol Chem 275, 24518–24526.
Forlani G, Bossi E, Ghirardelli R, Giovannardi S, Binda F, Bonadiman L, Ielmini L & Peres A (2001). K448E mutation in the external loop 5 of rGAT1 transporter induces pH sensitivity and altered substrates interactions. J Physiol 536, 479–494.
Forster I, Hernando N, Biber J & Murer H (1998). The voltage dependence of a cloned mammalian renal type II Na+/Pi cotransporter (NaPi-2). J Gen Physiol 112, 1–18.
Hanozet GM, Sacchi VF, Nedergaard S, Bonfanti P, Magagnin S & Giordana B (1992). The K+-driven amino acid cotransporter of the larval midgut of lepidoptera: Is Na+ an alternate substrate? J Exp Biol 162, 281–294.
Harvey WR, Wood JL, Quatrale RP & Jungreis AM (1975). Cation distributions across the larval and pupal midgut of the lepidopteran, Hyalophora cecropia, in vivo. J Exp Biol 63, 321–330.
Hennigan BB, Wolfersberger MG, Parthasarathy R & Harvey WR (1993). Cation-dependent leucine, alanine, and phenylalanine uptake at pH 10 in brush-border membrane vesicles from larval Manduca sexta midgut. Biochim Biophys Acta 1148, 209–215.[Medline]
Hess P & Tsien RW (1984). Mechanism of ion permeation through calcium channels. Nature 309, 453–456.[CrossRef][Medline]
Läuger P (1991). Electrogenic Ion Pumps. Sinauer Associates, Sunderland, MA, USA.
Mari SA, Soragna A, Castagna M, Bossi E, Peres A & Sacchi VF (2004). Aspartate 338 contributes to the cationic specificity and to the driver-amino acid coupling in the insect cotransporter KAAT1. Cell Mol Life Sci 61, 243–256.[CrossRef][Medline]
Parent L, Supplisson S, Loo DDF & Wright EM (1992). Electrogenic properties of the cloned Na+/glucose cotransporter: II. A transport model under nonrapid equilibrium conditions. J Membr Biol 125, 63–79.[Medline]
Peres A & Bossi E (2000). Effects of pH on the uncoupled, coupled and presteady-state currents at the amino acid cotransporter KAAT1 expressed in Xenopus oocytes. J Physiol 525, 83–89.
Quick M & Stevens BR (2001). Amino acid transporter CAATCH1 is also an amino acid-gated cation channel. J Biol Chem 276, 33413.
Sala-Rabanal M, Loo DDF, Hirayama BA, Turk E & Wright EM (2006). Molecular interactions between dipeptides, drugs and the human intestinal H+/oligopeptide cotransporter, hPEPT1. J Physiol 574, 149–166.
Soragna A, Mari S, Peres A, Pisani R, Castagna M, Sacchi VF & Bossi E (2004). Structural domains involved in substrate selectivity in two neutral amino acid transporters. Am J Physiol Cell Physiol 287, C754–C761.
Vincenti S, Castagna M, Peres A & Sacchi VF (2000). Substrate selectivity and pH dependence of KAAT1 expressed in Xenopus laevis oocytes. J Membr Biol 174, 213–224.[CrossRef][Medline]
Yamashita A, Singh SK, Kawate T & Gouaux E (2005). Crystal structure of a bacterial homologue of Na+/Cl–-dependent neurotransmitter transporters. Nature 437, 215–223.[CrossRef][Medline]
|
Acknowledgements |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
and 
indicate residues involved in coordinating Na+ ions (1 and 2, respectively); 
marks leucine-binding residues. The leucine-transporting members are denoted by *. Arrows indicate residues 6.56 and 6.61 generic numbering. (256 and 261 in LeuT, 308 and 313 in KAAT1 and CAATCH1).
) is plotted as an average between ‘on’ and ‘off’ areas, and following the convention of setting the zero charge level at the holding potential. E, time constants of decay from Ac (
